ID: 1007581163

View in Genome Browser
Species Human (GRCh38)
Location 6:42960961-42960983
Sequence CTGGGCTCACCCAGTGCCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581163_1007581176 7 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG 0: 1
1: 0
2: 0
3: 5
4: 32
1007581163_1007581170 -10 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581170 6:42960974-42960996 GTGAGCCCAGGCCGGGGCCGGGG 0: 1
1: 0
2: 1
3: 49
4: 538
1007581163_1007581171 -9 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 100
4: 906
1007581163_1007581177 8 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581177 6:42960992-42961014 CGGGGGCGTTGCATGAGATCGGG 0: 1
1: 0
2: 0
3: 10
4: 237
1007581163_1007581178 9 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581163 Original CRISPR CTGGGCTCACCCAGTGCCAC AGG (reversed) Exonic
900694069 1:3999503-3999525 CTGGCTTCAGCCAGGGCCACAGG - Intergenic
900981355 1:6047927-6047949 CTGGGCTCCCTCCGTGCCGCAGG + Intronic
902294858 1:15460160-15460182 CCGGGCTAACCCAGTGCCTTTGG - Intronic
902297601 1:15478973-15478995 CCGGGCTAACCCAGTGCCTTTGG - Intronic
902881608 1:19375307-19375329 TTTGACTCACCCAGTGCCATCGG - Intronic
904042753 1:27593749-27593771 CTGGGCTAAGCCAGTGCCTGCGG + Intronic
904238466 1:29128801-29128823 CTGGCATCACCCTGTCCCACAGG - Intergenic
904343661 1:29854146-29854168 CTGGGCTCACCCTGTGAGGCGGG - Intergenic
904963709 1:34355320-34355342 TTGTTCTCACCCAGTCCCACTGG + Intergenic
905641830 1:39595300-39595322 CTGGGCTCTCACAGGGGCACTGG + Intergenic
905886340 1:41494071-41494093 CGGGGCTCACCCACTGCATCTGG - Intergenic
906151436 1:43590059-43590081 CTGTGGTCTCCCAGGGCCACTGG + Intronic
906606329 1:47174908-47174930 CTGGGCTCACCCAGCCCAGCTGG + Intergenic
906616319 1:47235226-47235248 CTGGGCACACCCTCTGCCACAGG - Intergenic
912544666 1:110442055-110442077 CTGGCCTTAAGCAGTGCCACTGG + Intergenic
913971703 1:143421967-143421989 CGGGGCTGAGCCAGGGCCACGGG - Intergenic
914066080 1:144247580-144247602 CGGGGCTGAGCCAGGGCCACGGG - Intergenic
914113071 1:144718774-144718796 CGGGGCTGAGCCAGGGCCACGGG + Intergenic
917191447 1:172423029-172423051 CTGGACTCACCCAGGGCCCAGGG + Intronic
918117880 1:181512193-181512215 CTGGGTTGACCCAGTGCCCTTGG + Intronic
918209757 1:182340248-182340270 CTGGGCTCACCAGGCTCCACTGG + Intergenic
923204423 1:231744268-231744290 TTGGGCCCACCCACTGCCCCAGG + Intronic
923595953 1:235361078-235361100 CTGTCCTCTCCCTGTGCCACGGG + Intergenic
924928923 1:248709875-248709897 CTGGGTTCCCCCAGTGGCCCAGG - Intergenic
1063098894 10:2932535-2932557 GTGGGATCACCCATTCCCACAGG - Intergenic
1063297846 10:4825415-4825437 CTGGGCTCCCCCAGGGCCAGTGG - Intronic
1069759296 10:70797787-70797809 CTGGGCTCTCCAAGGCCCACAGG + Intergenic
1070188973 10:74093931-74093953 CTGGGCCCACCCAGTTCCAGAGG + Intronic
1070897237 10:79995353-79995375 CTTGGCCCATCCAGTGCCAGAGG - Intergenic
1072608640 10:97002676-97002698 AAGGGCTCCCCCAGTGCCCCAGG + Intronic
1074302082 10:112242070-112242092 CTGGACCCATCCAGTGCCAGGGG - Intergenic
1074562188 10:114544379-114544401 CTGGGCTGAGCCAGTTCCTCTGG - Intronic
1074785309 10:116834201-116834223 CTGGGGCCTCCCAGTGCAACCGG - Intergenic
1075620739 10:123926358-123926380 CTGGGTTCCCCCAGTGCCCTGGG + Intronic
1076643252 10:131933404-131933426 CTGGGCACACCCAGGGCCCACGG - Intronic
1076792357 10:132784304-132784326 CTGGGCTCAGCCGGTGGAACCGG - Intergenic
1076800152 10:132818010-132818032 CTGGGCCCACCCAGATCCCCAGG + Intronic
1076849760 10:133087090-133087112 GTGGGGTCACCCAGGGCCAAAGG + Intronic
1076849777 10:133087131-133087153 GTGGGGTCACCCAGGGCCAAAGG + Intronic
1077130175 11:968099-968121 CTGGCCTAACCCAGGGCCACAGG - Intronic
1077308166 11:1877060-1877082 CGGGGCTGAGCCAGGGCCACGGG + Intronic
1077534984 11:3119730-3119752 CTGGACACCCCCAGGGCCACAGG + Intronic
1078023588 11:7673955-7673977 CAGGGCTGACCCAGAGCCAGCGG - Exonic
1080892259 11:36419160-36419182 CTGGCCCCACCCCGTGCCACTGG + Intronic
1082846903 11:57733828-57733850 CTGGGATGACCCAAGGCCACAGG - Intronic
1083254742 11:61489193-61489215 CTGGTCTCTGCCAGAGCCACAGG - Intronic
1083405277 11:62452695-62452717 CTGGGCTCACACAATGGGACAGG + Intronic
1083692131 11:64415802-64415824 CTGGGCTCCCCGAGGGCCTCAGG + Intergenic
1083697375 11:64451892-64451914 CTGAGCTCTCCCATAGCCACAGG + Intergenic
1083775497 11:64892685-64892707 CTGGGCTCACTCAGGGACCCTGG - Intergenic
1084521002 11:69662841-69662863 CTGGGCTCCCAAAGTGCCAGAGG + Intronic
1084857728 11:71999650-71999672 ATGGACTCACCCAGTCACACAGG - Exonic
1085349601 11:75790072-75790094 CTAGGCACACCCAGGGCCATGGG - Intronic
1087389445 11:97515120-97515142 CTGGCCTGACCCAGTGTCTCTGG + Intergenic
1087890430 11:103531679-103531701 CTGGGCTCACCCAGGGCATCAGG + Intergenic
1088064227 11:105696240-105696262 CTTGGCTCACACAGTGGCCCAGG + Intronic
1089554722 11:119310101-119310123 ATGGCCACACCCAGAGCCACGGG + Intronic
1089560593 11:119341312-119341334 CTGGCCCCACACTGTGCCACCGG - Exonic
1089600291 11:119610179-119610201 CTGGGCTCAAGCAGTCTCACTGG + Intergenic
1090449779 11:126796328-126796350 CTGGGCTGACCCAGGGCATCAGG + Intronic
1091201648 11:133785126-133785148 CAGGGCTCGCCCAGAGCCACTGG - Intergenic
1091787808 12:3253539-3253561 CTGAGCTCGGCCAGTGCCATGGG + Intronic
1092536707 12:9395632-9395654 CTGGGCTCTCCCACTCCCCCAGG - Intergenic
1092548090 12:9469007-9469029 CTGGGCTCTCCCACTCCCCCAGG + Intergenic
1092557968 12:9577689-9577711 CTGGGCTCTCCCACTCCCCCAGG + Intergenic
1092563832 12:9643901-9643923 CTGGTACCACCCTGTGCCACTGG - Intergenic
1094504908 12:31053440-31053462 CTGGGCTCTCCCACTCCCCCAGG - Intergenic
1094513327 12:31110232-31110254 CTGGGCTCTCCCACTCCCCCAGG - Intergenic
1096497206 12:52045484-52045506 CTGGGCTCCCCCACTGTCATGGG - Intronic
1098250157 12:68560804-68560826 CTAGCCTCCTCCAGTGCCACAGG - Intergenic
1099325726 12:81212381-81212403 CTGGGCTCACTTCCTGCCACAGG + Intronic
1101148635 12:101865050-101865072 CAGGGCTCACCAAATGTCACCGG + Intergenic
1101446262 12:104738868-104738890 CTGGGCTCCCCCAGCGCCTCAGG + Intronic
1101583491 12:106064960-106064982 TTGGGCTCTCCCCTTGCCACCGG - Exonic
1101642944 12:106601614-106601636 CTGTTCTCATCCAGTGCCTCAGG + Intronic
1102255128 12:111410643-111410665 CTGGGGTCACCTTGTGCCCCGGG - Intronic
1102472172 12:113165549-113165571 CTGGGGTCACACAGTGACAACGG - Intronic
1102774820 12:115509234-115509256 CTGAACTCACCAGGTGCCACAGG - Intergenic
1102956012 12:117059373-117059395 CTGGGCTCACTCATGGCCTCTGG + Intronic
1103204928 12:119121176-119121198 CTGGGCTCTCCCACTGCCTAGGG + Intronic
1103218876 12:119226307-119226329 AAGGGCTCAGCCAATGCCACGGG - Intergenic
1103924611 12:124416642-124416664 GTGGGGTCTCCCTGTGCCACGGG - Intronic
1104589962 12:130076165-130076187 CTGGGATCATCCAGGGCCACAGG + Intergenic
1107425993 13:40293345-40293367 CTAGCCTCACCCAGCCCCACAGG + Intergenic
1109007840 13:56901161-56901183 CTGGCCTCACCCAGTGGTTCTGG - Intergenic
1111971633 13:94923204-94923226 CTAGGCTTTCCCAGTGCCACAGG + Intergenic
1113782245 13:112983356-112983378 CTGGGTTTCCGCAGTGCCACTGG - Intronic
1118132117 14:62978027-62978049 CTGGGCTCACACATTTCCCCAGG - Intronic
1118753076 14:68820446-68820468 CTGAGCTCAGCCAGTGACACTGG - Intergenic
1119783713 14:77296939-77296961 CAGGGCTCTTCCAGGGCCACAGG - Intronic
1120036460 14:79703952-79703974 CTGGGCTTATCCAGCCCCACAGG - Intronic
1120711694 14:87799214-87799236 CTAGGCTCCCCCAGTGAGACGGG + Intergenic
1121088514 14:91164938-91164960 CTGGACTCACCCAGGGCCTGGGG - Intronic
1121570667 14:94944499-94944521 CAGGCCTCACCCAGCTCCACCGG + Intergenic
1122104961 14:99446094-99446116 CTGGGCTTACTCAGTGGCTCTGG + Intronic
1123682985 15:22775848-22775870 CTGGGCCCCCCCAGTGCCTCTGG - Intronic
1125501142 15:40240933-40240955 CTGGGCCAAGCCAGTGCCACCGG + Intronic
1125773001 15:42184507-42184529 TTGGTCTCACCCATGGCCACTGG + Exonic
1126704117 15:51391829-51391851 CTGTGCTCCCCCAGTTCCACTGG + Intronic
1127775600 15:62262040-62262062 CTAGGAGCACCCAGTGCCAAGGG - Intergenic
1128336194 15:66787180-66787202 CTGGGCTGGCCCATGGCCACGGG - Intergenic
1129166707 15:73782617-73782639 CTGGTCTGACCCACTGGCACAGG + Intergenic
1132004508 15:98214509-98214531 CAGGGCTCTGCCTGTGCCACCGG + Intergenic
1132606465 16:795663-795685 CTTGGCTCACCCCCTGCCCCAGG + Exonic
1132867928 16:2103043-2103065 CTGAGCCCACCCTCTGCCACGGG + Intronic
1133024113 16:2980276-2980298 CTGGGCTCACCTGGGGCGACTGG + Exonic
1134549062 16:15130864-15130886 CTGAGCCCACCCTCTGCCACGGG + Intronic
1134719283 16:16371855-16371877 CTGAGCCCACCCTCTGCCACGGG - Intergenic
1134948143 16:18340030-18340052 CTGAGCCCACCCTCTGCCACGGG + Intergenic
1135680323 16:24450866-24450888 CTGGGCTGATCCAAGGCCACTGG + Intergenic
1138180695 16:54938456-54938478 CTGGGCTCGCCTAGTGCCCGAGG - Intergenic
1140479325 16:75253881-75253903 CTGCGCCCAGCCAGTGCCAGGGG + Intronic
1141095362 16:81159258-81159280 CTGGGAGCCCCCAGTGCAACAGG - Intergenic
1141181143 16:81754104-81754126 CAGGGTTGACCCAGTGACACAGG + Intronic
1141734172 16:85841128-85841150 CTTGGATAACCCAGAGCCACTGG + Intergenic
1142000851 16:87663555-87663577 CTGTGTTCACCCAGTGCTTCTGG - Intronic
1142148810 16:88503760-88503782 CTGGGCTCACCCCGGGGCACAGG + Intronic
1142150617 16:88511052-88511074 CTGGGCTCACCCAGTTGTTCTGG + Intronic
1142168601 16:88607491-88607513 CTGCGCTCTCCCAGTGCAAGAGG + Intronic
1142177899 16:88653269-88653291 TGGGGCTCACCCAGTACCCCGGG - Intronic
1142213802 16:88821255-88821277 CTCGGCTCACCTGGGGCCACTGG - Intronic
1142441804 16:90103248-90103270 CTGGGCTGGCTCAGTTCCACGGG + Intergenic
1144726489 17:17505020-17505042 GTAGGCTCAGCCATTGCCACTGG - Intergenic
1144832243 17:18138252-18138274 CTAGGCTCACACAGTGCCTGCGG - Intronic
1144938742 17:18921504-18921526 CTGGGGTCACACATTGCCTCTGG + Intronic
1145777874 17:27541906-27541928 CTGGGCTCACTCACTGGCTCAGG - Intronic
1146133436 17:30297651-30297673 CTGGGCCAACCCAGAGCCATGGG + Intergenic
1148816074 17:50329150-50329172 CTGGGGGCACCCAGAGCCCCTGG + Intergenic
1149563614 17:57626743-57626765 CAGGGCTCACCCTGGGCCTCTGG - Intronic
1149685663 17:58533124-58533146 CTGGTCCCAACCAGTGCTACTGG - Intronic
1151419620 17:73988650-73988672 CTGGGGGTATCCAGTGCCACGGG - Intergenic
1151558779 17:74860115-74860137 CTGGGTTCGCCCAGGGCCCCCGG - Intronic
1151652055 17:75476125-75476147 ATGGGCTCACCCAGTGACTTGGG + Intronic
1152667739 17:81580972-81580994 GTGGGCTGGCCCAGGGCCACTGG - Intronic
1153829855 18:8912583-8912605 CTGTGCTCAGCCAGAGCGACAGG - Intergenic
1155346454 18:24862179-24862201 CTGGTCTCTCCCAGTGCTGCAGG - Intergenic
1156261039 18:35445248-35445270 CTGGGCTCCCCCAGTGTAAAAGG - Intronic
1157033344 18:43940393-43940415 CTGGGCTGACACAGTCCCACTGG + Intergenic
1157284535 18:46368476-46368498 CTGGGCACACGCAGACCCACAGG - Intronic
1157443674 18:47729257-47729279 GTGGTCTCACTCAGTGCTACTGG + Intergenic
1158233411 18:55284794-55284816 CTGGGCTCATTCAGTGACTCAGG + Intronic
1158936990 18:62373693-62373715 CTGGGCTCACCTAGTGTCCTGGG + Intronic
1159091951 18:63860099-63860121 CTGGACCCACCCAGAGCCAGGGG - Intergenic
1159400681 18:67929665-67929687 CTGGGCTGGCCCAGTACAACTGG + Intergenic
1159655893 18:71030220-71030242 CTGGCCTCACCCAGTGGCTCAGG + Intergenic
1160321124 18:77896719-77896741 CTGCGCTCACCCACTGACATGGG + Intergenic
1160347488 18:78145854-78145876 AGGGGCTCACCCAGTGTCACAGG + Intergenic
1160835734 19:1123694-1123716 CTGGGCTCCCCCAGGGGCAGGGG + Intronic
1161802379 19:6423684-6423706 CTGGGCTGTCCCAATGCCTCCGG - Intronic
1162032041 19:7921672-7921694 CTGGGCTGACCCTGTACCTCTGG + Intronic
1162066257 19:8126922-8126944 CTGGGTGCACCCCGTGCCACCGG - Intronic
1162588238 19:11574647-11574669 CAAGGCTGAACCAGTGCCACTGG - Intronic
1163647594 19:18498696-18498718 CTTGGCTTCCCAAGTGCCACAGG - Intronic
1164697560 19:30257786-30257808 CTGGGCGGACCCATTGCAACTGG + Intronic
1165957900 19:39513456-39513478 CTGGGCTCAAGCAGTCCCCCTGG + Intergenic
1166065485 19:40356048-40356070 CTGGGCTCACACAGTCCCCTGGG - Intronic
926803523 2:16683657-16683679 CTGGGCACACTCATTGGCACAGG + Intergenic
926987397 2:18639634-18639656 TTGGGCTCACCAAGGCCCACAGG + Intergenic
927097663 2:19759812-19759834 ATGGGCCCACCCAGACCCACAGG - Intergenic
927199200 2:20568015-20568037 CTGGTCTCGCTCAGTGCCTCAGG + Intronic
927462719 2:23312977-23312999 CTGGGCACAAACAGAGCCACAGG + Intergenic
927963859 2:27257307-27257329 CTGGGCCCCCCCACAGCCACGGG - Exonic
928130087 2:28642935-28642957 CTGGGCTGTCCCAGTGGCAGCGG + Exonic
928359806 2:30654089-30654111 CAGAGCTCACCCAGCACCACAGG - Intergenic
932691540 2:73917794-73917816 CTCTTCTCACCCAGAGCCACAGG + Intronic
932756796 2:74415012-74415034 GAGGGCGCACCCAGTGGCACGGG + Exonic
934789740 2:97048647-97048669 CTGGGCGGAGCCTGTGCCACTGG + Intergenic
934816730 2:97333892-97333914 CTGGGCGGAGCCTGTGCCACTGG - Intergenic
934820966 2:97374592-97374614 CTGGGCGGAGCCTGTGCCACTGG + Intergenic
937434551 2:121869717-121869739 CTTGGGCCACGCAGTGCCACAGG - Intergenic
937987884 2:127646694-127646716 CTCGACTCACCCACAGCCACGGG + Intronic
938067797 2:128291493-128291515 CTGAGCTCACCCAGTGCCTGGGG - Intronic
938264128 2:129914055-129914077 CTTGGCTAACCCACTCCCACTGG - Intergenic
939976152 2:148719801-148719823 CTGGGCTCTCCAAGCCCCACTGG + Intronic
942034024 2:171993353-171993375 CTGGCCTCACACAGTCCTACAGG + Intronic
946355746 2:219183196-219183218 CTGGCCTGACCCACTGCCCCAGG - Exonic
946360361 2:219216006-219216028 CGGGGCACATCCAGTGTCACAGG - Exonic
947707759 2:232290403-232290425 CTGGGCTCACCCAGTAATACAGG + Intronic
948253780 2:236551442-236551464 CTGTGCCCACCCAGTACCTCAGG - Intergenic
948748614 2:240113644-240113666 CTGGATTCACCCAGAGCCATTGG - Intergenic
1169128469 20:3148772-3148794 CTGGGCTCACCCAGGGCCACAGG - Exonic
1172179101 20:32989831-32989853 CTGGGCTTTCACAGAGCCACAGG - Intronic
1172935340 20:38616105-38616127 CTGGGCTTGCCCAGAGCCAAAGG + Intronic
1173202299 20:40962927-40962949 CTGGGCTTCCCCAGTCCCGCAGG + Intergenic
1174195865 20:48772407-48772429 CACGTCTCACCCAGTGTCACAGG - Intronic
1174448277 20:50604730-50604752 CTGGTGTCACCCAGCCCCACGGG - Exonic
1174457877 20:50662415-50662437 CATGACTCACCCAGAGCCACTGG + Intronic
1175256905 20:57653056-57653078 CTGTGCTCTCCGAGGGCCACAGG + Exonic
1175548908 20:59802983-59803005 CAGAGCTCACCCAGTGCAAAAGG - Intronic
1175934309 20:62508063-62508085 CTGGGCTCCGCCAGGGCCCCTGG - Intergenic
1176917638 21:14645060-14645082 CTGGACTCACCCAGGGCCTGGGG + Intronic
1179285125 21:39970705-39970727 CTCCTCTCTCCCAGTGCCACAGG + Intergenic
1179984616 21:44913598-44913620 CTGGGCTCAGCCACTGGCATTGG - Intronic
1180079246 21:45479044-45479066 CGGGGCCCACCCACTGCAACAGG + Intronic
1181169077 22:20998250-20998272 CTGGGGTCACCCAGTCACATTGG + Exonic
1181345250 22:22215263-22215285 CAGTGCTCACACAGTGCCTCAGG + Intergenic
1181462960 22:23096088-23096110 CTGGGCCGACCCAGGGGCACAGG + Exonic
1181633035 22:24161419-24161441 CTCGCCTCTCCCAGTTCCACAGG - Intronic
1182353766 22:29713056-29713078 CTGTGGTCACCCAGTGCCCTGGG + Intergenic
1183279598 22:36924797-36924819 CACAGCTCACCCAGTGCCCCCGG + Intronic
1183387132 22:37521250-37521272 CTGGGTACACCGAGTGCCCCTGG + Intergenic
1183933440 22:41248842-41248864 CTGGGGACACACATTGCCACGGG - Intronic
1184458363 22:44624039-44624061 GGGGGCTCACCCAGGGCCCCAGG - Intergenic
1185351495 22:50342031-50342053 CTGTGCTCAGCCAGTGCAACTGG - Intergenic
949357455 3:3197028-3197050 CTGGGCTTACCCACCGCAACTGG + Intergenic
950128728 3:10527479-10527501 CTGGCCTCACCCAGCTCCATAGG - Intronic
950310059 3:11949325-11949347 CTGGGCTCAGCCCCTGACACTGG + Intergenic
950640828 3:14347045-14347067 CTGGGCTGACCCCATGCCTCCGG + Intergenic
952331051 3:32364858-32364880 CAGGGCCCACCCAGTGGCAGAGG - Intronic
952964928 3:38615209-38615231 TTGCACTCACCCAGAGCCACAGG - Intronic
953569319 3:44058688-44058710 CTGGGCTCACCTGGTGCCTGAGG + Intergenic
954137243 3:48587668-48587690 CTGGGGTCACCCAGGGTCAGAGG + Intronic
956349630 3:68320612-68320634 CTGGGCTCTCCCTGTGACCCAGG + Intronic
956775428 3:72561426-72561448 CTGGGCTCCCCCATGGTCACTGG - Intergenic
961371330 3:126433740-126433762 CTGGGCACAGCCAGTGCCCATGG - Intronic
962693859 3:137928516-137928538 CTGGGATCACACATTGCCAATGG - Intergenic
964952708 3:162316667-162316689 CTGGACTCACCCAGCGCCTGGGG - Intergenic
966762085 3:183427806-183427828 CTGGCCTCACCCGCTGCCCCGGG - Intronic
966912623 3:184568071-184568093 CTGGGCTCACTCCCCGCCACTGG - Intronic
967946338 3:194807095-194807117 CTGGGCTGGCCCAGGGCCTCAGG + Intergenic
968232470 3:197011885-197011907 CTGGGCTCACAGAGGGCCACGGG - Intronic
968356471 3:198111501-198111523 CTGGGCACAGCCAGTGGCACAGG + Intergenic
968362069 3:198154215-198154237 CTGGGCTGGCTCAGTTCCACGGG + Intergenic
968510971 4:995792-995814 CTGGGCTCACCCAGGGCTGTGGG - Intronic
968519765 4:1030079-1030101 CGGGGCCCACACAGTGCCCCAGG - Intergenic
968542522 4:1175335-1175357 CCAGGCTCACCCAGTCTCACAGG + Intronic
968648586 4:1751588-1751610 CTGGGCCCACTCAGTGTCCCGGG - Intergenic
969298306 4:6282259-6282281 CTGGGGTCACCCTGCACCACAGG - Intronic
969327839 4:6453937-6453959 CGGTGCACACCCAGGGCCACCGG + Intronic
969717989 4:8877639-8877661 CTGGGCTCACTCATTGTCCCGGG + Intergenic
973624032 4:52752983-52753005 CTGGGCTCTGCCAGCCCCACGGG + Intergenic
973983569 4:56327657-56327679 CTCGGCTCCCCCAGCGCCGCTGG + Exonic
979628686 4:122876065-122876087 CTCTGCTCACCCTGTGACACAGG + Intronic
979892720 4:126119810-126119832 CTGGACTCACCCAGGGCCTGGGG - Intergenic
983755472 4:171329285-171329307 TGGGGCTCACCCAGTGCCTGTGG - Intergenic
984348210 4:178558611-178558633 CTGGGCTCCCCAAATGCCAATGG + Intergenic
985868901 5:2538387-2538409 CTGGCCTCACCCATTGTCACCGG + Intergenic
986393585 5:7306382-7306404 CTGGGCCCCCCCAGTGCCTCTGG - Intergenic
986541707 5:8851278-8851300 CTGGGGCCACCCAGTGGCAAAGG - Intergenic
986592601 5:9386887-9386909 ATGGGCTCACTCAGTGGCAGGGG - Intronic
987091365 5:14510660-14510682 CTGGGCCCACCCAGTCCAAGGGG + Intronic
987537472 5:19207166-19207188 CTGGACTCACCCAGAGCCAGTGG + Intergenic
988818084 5:34853814-34853836 CTGGGCTCTCCCAGGGCCCAAGG - Intronic
991649198 5:68834489-68834511 CAGGGCTCTCCCAGTGCACCAGG - Intergenic
992608071 5:78481985-78482007 ATGTGCTCACCCAATGCTACCGG + Intergenic
993467630 5:88268416-88268438 CTGGGATCACCTGGCGCCACAGG + Intronic
997407262 5:133660651-133660673 CTGCAGTCACCCAGTGGCACAGG - Intergenic
997977113 5:138446922-138446944 ATTGGCTCATCCAGTGCCAAAGG - Exonic
1000270293 5:159677580-159677602 CTGGACCCACCCAGTGCCTGGGG + Intergenic
1003033980 6:2626767-2626789 CTGGGCTCACTCTGTGGCCCAGG - Intronic
1003817799 6:9861862-9861884 ATTGGCTCACACAGTTCCACAGG + Intronic
1006215993 6:32443217-32443239 TTGGGCTCTCTCAGTTCCACAGG - Exonic
1006236952 6:32642004-32642026 TTGGGCTGACCCAGTGTCACGGG - Exonic
1006246948 6:32745823-32745845 TTGGGCTGACCCAGCGTCACAGG - Exonic
1007073706 6:39053804-39053826 CTAGGGCCACCCAGTGCCATAGG - Intronic
1007581163 6:42960961-42960983 CTGGGCTCACCCAGTGCCACAGG - Exonic
1010324521 6:74549755-74549777 CTGGGCCCACCCAGGGCCAAGGG - Intergenic
1013571152 6:111427453-111427475 CTGGCTTCACTCACTGCCACAGG + Intronic
1016054472 6:139565311-139565333 CGGGTCTGACCCAGTGCTACAGG - Intergenic
1016997482 6:149970612-149970634 CTTGGCCCACCCAGTTCCAAAGG + Intronic
1019191172 6:170251757-170251779 GGGTGCTCACACAGTGCCACAGG - Intergenic
1019253611 7:34492-34514 CTGGGCTGGCTCAGTTCCACGGG - Intergenic
1019299244 7:295318-295340 CTGTGCACAGCCTGTGCCACGGG - Intergenic
1019299895 7:297629-297651 CTGGGCTGACCCCGGGACACTGG - Intergenic
1019327177 7:444216-444238 CTGGGTGCTCCCTGTGCCACAGG + Intergenic
1019388560 7:772621-772643 CTGGGCACAGCCAGACCCACAGG - Intronic
1019503852 7:1380684-1380706 CTGGGCTCTCCCAGAGACAGGGG + Intergenic
1019508544 7:1405531-1405553 CAGGGGTCACCCTGGGCCACGGG - Intergenic
1019733588 7:2639942-2639964 CTGGTCTCTCCCAATGCCTCGGG + Intronic
1019923878 7:4179870-4179892 CTGTGCTCCCCCGATGCCACAGG - Intronic
1021469022 7:20980244-20980266 CTGGGCTCACCGTATGCCAGTGG - Intergenic
1023832595 7:44048581-44048603 CAGGGCTTTGCCAGTGCCACTGG - Intronic
1024224565 7:47315617-47315639 CGGGGCTCAGGCAGGGCCACTGG + Intronic
1025064146 7:55838669-55838691 CTGGGCTCAAGCAATCCCACAGG + Intronic
1025216498 7:57060770-57060792 CTGGGTTCACCCGGTGGTACTGG + Intergenic
1026382884 7:69817107-69817129 ATGGGCTCACTCAGTGGTACAGG + Intronic
1027233677 7:76285869-76285891 CTCGCCTCTCCCAGTGCCAGGGG - Exonic
1027375485 7:77544322-77544344 TAGTGCTTACCCAGTGCCACTGG + Intronic
1029174111 7:98651871-98651893 CGGGCCTCACCCAGTGTCCCCGG + Intergenic
1030408251 7:109142745-109142767 CTGGGCCCACCCAGGGCCCAGGG - Intergenic
1033683159 7:143616304-143616326 TTGGGCTAACTCAGTTCCACTGG + Intergenic
1033701453 7:143841334-143841356 TTGGGCTAACTCAGTTCCACTGG - Intergenic
1035582014 8:746426-746448 GTGGGGTCACACAGAGCCACAGG + Intergenic
1036385341 8:8274388-8274410 TTGGGCTCTCCCAGTGCTAAGGG - Intergenic
1039989630 8:42476611-42476633 CCGGGCTGACACAGTGCCAAGGG - Intronic
1040415903 8:47195902-47195924 CTTGGCCCAGCCAATGCCACAGG + Intergenic
1040595213 8:48831901-48831923 CTGGGCTGCCCAAGTGCCTCTGG + Intergenic
1040864221 8:52032035-52032057 TTGGGAGCACCCAGTGCCAACGG - Intergenic
1041823352 8:62063942-62063964 CTGGACCCACCCAGTGCCTGAGG + Intergenic
1043289457 8:78579181-78579203 CTTGCCTCACCTAGTGCAACAGG + Intronic
1046420783 8:113980480-113980502 TTGGGGTCACCCAGTGCACCTGG + Intergenic
1047711149 8:127553727-127553749 CTGGCCACTCCCACTGCCACAGG - Intergenic
1047922689 8:129651748-129651770 CTGGGCTCTGCAATTGCCACAGG - Intergenic
1048575643 8:135687744-135687766 CAGGGATGACCAAGTGCCACTGG - Intergenic
1049446072 8:142632258-142632280 CAGGGCTCGCCCAGGGCCGCCGG + Intergenic
1049532449 8:143161029-143161051 CGGGGCTTCCCCAGTGCCCCGGG - Intergenic
1049622183 8:143603519-143603541 CTGAGCTCACCTAGTGCCCAGGG + Intergenic
1049766906 8:144359104-144359126 CGGGGCTCCCCCAGTTCCCCTGG + Intronic
1053034184 9:34810276-34810298 CGGGGTTCATCCAGTGACACGGG - Intergenic
1055827086 9:80339703-80339725 CTGGACTCACCCAGGCCCACAGG + Intergenic
1056999369 9:91493274-91493296 CAGGGTTGACCCAGAGCCACAGG + Intergenic
1057289097 9:93789067-93789089 CTAGGCACACCCTGTGCCAGGGG - Intergenic
1057832720 9:98419283-98419305 CTGGGATCCCCCAGTCACACTGG + Intronic
1059755728 9:117291527-117291549 TACGGCTCACCCAGTGCCTCGGG - Intronic
1060969644 9:127730837-127730859 CTGAGCCCACCCAGAGCCAGAGG + Exonic
1061877418 9:133551401-133551423 CTAGGCACACCCAGGGCCAGAGG - Intronic
1061969427 9:134035853-134035875 CTGTGCTCACCCAGGGCCAGTGG - Intronic
1062261872 9:135666851-135666873 CTGGGCTCAGCCACTGCCTTTGG + Intergenic
1062518146 9:136946256-136946278 ATGGGCTCACCCAGCCCCTCGGG - Intronic
1062612615 9:137381851-137381873 CCTGGCCCACCCAGGGCCACTGG + Intronic
1062746756 9:138217877-138217899 CTGGGCTGGCTCAGTTCCACGGG + Intergenic
1185873963 X:3687044-3687066 CAGGTCTCACTCTGTGCCACAGG + Intronic
1187273854 X:17801749-17801771 CTGGGCTCTCCCCGAGGCACAGG + Exonic
1187707380 X:22021958-22021980 CTGGGTTTATCCAGGGCCACAGG - Intergenic
1189274851 X:39778259-39778281 CTGGGCTCAGTCAGTGCCAAGGG - Intergenic
1189405809 X:40721541-40721563 CTGGGCTCACCCAAAGCCTGGGG + Intronic
1189725402 X:43963904-43963926 CTGGGCTGACCCAGAGGCAGCGG + Intronic
1190374269 X:49774229-49774251 CTGGACCCACCCAGGGCCAGGGG - Intergenic
1193409087 X:81141209-81141231 CTGGATTCACCCAGTGCCTGGGG + Intronic
1196625410 X:117871869-117871891 CTGGACCCACCCAGGGCCTCGGG + Intergenic
1199867380 X:151864327-151864349 CTGTGCTCACCCACTGCTAAAGG + Intergenic
1200094037 X:153649009-153649031 CTGGGCTCACGCTGAGCCACCGG - Intronic
1202187185 Y:22197597-22197619 CGGGGCTCAGGCAGTGCCAGAGG + Intergenic
1202204175 Y:22388799-22388821 CGGGGCTCAGGCAGTGCCAGAGG - Intronic
1202241074 Y:22770622-22770644 CGGGGCTCAGGCAGTGCCAGAGG - Intergenic
1202394060 Y:24404365-24404387 CGGGGCTCAGGCAGTGCCAGAGG - Intergenic
1202476725 Y:25265727-25265749 CGGGGCTCAGGCAGTGCCAGAGG + Intergenic