ID: 1007581164

View in Genome Browser
Species Human (GRCh38)
Location 6:42960962-42960984
Sequence CTGTGGCACTGGGTGAGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581159_1007581164 -2 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581164 6:42960962-42960984 CTGTGGCACTGGGTGAGCCCAGG 0: 1
1: 0
2: 3
3: 33
4: 340
1007581158_1007581164 10 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581164 6:42960962-42960984 CTGTGGCACTGGGTGAGCCCAGG 0: 1
1: 0
2: 3
3: 33
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581164 Original CRISPR CTGTGGCACTGGGTGAGCCC AGG Exonic
900457881 1:2786172-2786194 CGTTGGAACTGGGTGAGCCGTGG - Intronic
900820113 1:4879985-4880007 GTGGGCCACTGGGTGAGCCTGGG + Intergenic
900997213 1:6129094-6129116 CTGGAGCCCTGGGTGAGCCACGG - Intronic
901204411 1:7485612-7485634 CTGGGCCCCTGGGTGAGTCCAGG + Intronic
901324964 1:8360472-8360494 TTCTGGCTCTGGGTCAGCCCGGG + Exonic
902042901 1:13505513-13505535 CTGTGGGAGTGAGTGAGCCAAGG - Intronic
902294860 1:15460161-15460183 CAAAGGCACTGGGTTAGCCCGGG + Intronic
902297603 1:15478974-15478996 CAAAGGCACTGGGTTAGCCCGGG + Intronic
902437606 1:16408542-16408564 CTCTGGCACAGGGAGAGCGCTGG + Intronic
902443132 1:16444274-16444296 CTGTGCCTCTGGGTGAGCTGTGG + Intronic
902557459 1:17255361-17255383 GTGTGGGGCTGGGAGAGCCCTGG + Intronic
903537147 1:24074478-24074500 CTCTGGCACTGGGTCTGCACTGG + Intronic
903593892 1:24479349-24479371 ATGAGGCTCTGGATGAGCCCTGG + Intergenic
903658146 1:24961261-24961283 CTGTGGCACTGGCTGAGTACAGG + Intronic
903744801 1:25579629-25579651 CTGTGGCACTGGGCGATTCAAGG - Intergenic
904199032 1:28807360-28807382 CTGATGCCCTGGGTTAGCCCAGG + Intergenic
904622972 1:31786556-31786578 CTGTGGCCCGGGGTGGGGCCAGG + Intergenic
904674618 1:32191297-32191319 GTGTGGCAGTGGGTGAGACCGGG + Intronic
905886341 1:41494072-41494094 CAGATGCAGTGGGTGAGCCCCGG + Intergenic
906616320 1:47235227-47235249 CTGTGGCAGAGGGTGTGCCCAGG + Intergenic
906703910 1:47880715-47880737 CTCTGGCACTGTCTGAGTCCTGG + Intronic
907297623 1:53465371-53465393 CTGGGGCACTGGATGATCCTGGG + Intronic
907321245 1:53603720-53603742 CTGTGGCACAGAGTGAGACATGG - Intronic
907720651 1:56968963-56968985 CTGTGGAACTGGGTGGAGCCTGG - Intergenic
908262157 1:62347559-62347581 CTGTGGAGCTGGCTGAGCTCTGG + Intergenic
909512206 1:76466350-76466372 CTGTGGCACTGTGTGTGAACTGG - Intronic
911638835 1:100266173-100266195 CTGCGGAACTGGGCGAACCCGGG + Intergenic
915433033 1:155881403-155881425 CTGTGACACTGTGTGCCCCCAGG - Exonic
915516512 1:156415906-156415928 CTTTGGCCCTGGGAGAGCCTGGG + Intronic
915626436 1:157116826-157116848 CAGAGACACTGGGTGAGTCCTGG + Intergenic
916025527 1:160830341-160830363 CTGTGACTCTGGCTGAGCCCAGG - Intronic
916722916 1:167498350-167498372 CAGGGACACTGGGTGAGGCCAGG + Intronic
917438638 1:175045768-175045790 CCGCGGCACTGGCGGAGCCCGGG - Intergenic
917666575 1:177230829-177230851 CTGGTGCACTGTGGGAGCCCTGG - Intronic
917789374 1:178489592-178489614 CTCTGGCACAGAGTGGGCCCCGG - Intergenic
919752232 1:201044849-201044871 CTGGGGCTTTGGGAGAGCCCTGG - Intronic
919986337 1:202678493-202678515 GAGGGGCACTGGGTGAGCCTTGG - Intronic
920177636 1:204113026-204113048 CAGCGGCAGTGGCTGAGCCCTGG - Exonic
920435347 1:205943498-205943520 CAGGGCCACGGGGTGAGCCCCGG + Intergenic
921212997 1:212915917-212915939 CTGGGCCACTGGGTGGGGCCTGG - Intergenic
922213763 1:223504790-223504812 CTGTGGCCCTGAGTGGGCCTGGG + Intergenic
924439901 1:244077501-244077523 CGGTGGGGCTGGGAGAGCCCAGG + Intergenic
1064324485 10:14336150-14336172 TTCTGGCCCTGGGTGAGCACTGG - Intronic
1067940088 10:50647911-50647933 CAGTGGCACTGGGAGGGCCTGGG - Intergenic
1068524042 10:58107154-58107176 GTGTGTAACTGGGTGAGCCCAGG - Intergenic
1068968187 10:62934456-62934478 CTTTGTTACTGGGTGAGCACCGG + Intergenic
1070188972 10:74093930-74093952 CTCTGGAACTGGGTGGGCCCAGG - Intronic
1070561098 10:77567056-77567078 CTCAGGCCCTGGGGGAGCCCTGG + Intronic
1070599297 10:77854521-77854543 CTGTGGGTCTGAGTGAGGCCAGG - Intronic
1070789755 10:79181991-79182013 GCTTGGCACTGGGTGAGTCCTGG - Intronic
1070897238 10:79995354-79995376 CTCTGGCACTGGATGGGCCAAGG + Intergenic
1071603864 10:86971597-86971619 ACGTGGCACTGGTTGAGCGCCGG + Intronic
1071737512 10:88318234-88318256 CTGTGGAGCTGTGGGAGCCCTGG + Intronic
1072969373 10:100003650-100003672 CTGTTGCCCTGGCTGGGCCCTGG - Intronic
1073025326 10:100483223-100483245 GTGCAGCAGTGGGTGAGCCCTGG - Exonic
1074528667 10:114281711-114281733 CTGGGGCACTGCGGGAGGCCTGG + Intronic
1076046099 10:127295356-127295378 CTGTGGCAATGAGTGAGGTCTGG - Intronic
1076611918 10:131731422-131731444 CTGAGGCACTGGGTGTCCCTCGG - Intergenic
1076730971 10:132438715-132438737 CTGGGGCAGTGGGTGAGTCTGGG + Intergenic
1076800151 10:132818009-132818031 CTGGGGATCTGGGTGGGCCCAGG - Intronic
1077130176 11:968100-968122 CTGTGGCCCTGGGTTAGGCCAGG + Intronic
1077534983 11:3119729-3119751 CTGTGGCCCTGGGGGTGTCCAGG - Intronic
1077649876 11:3961215-3961237 CTGAGGCATTGCTTGAGCCCAGG - Intronic
1078486422 11:11727225-11727247 CTGGGGCCATGGCTGAGCCCGGG + Intergenic
1078605368 11:12770390-12770412 CTGTGGCAGTGGATGAGCCCTGG + Intronic
1079803190 11:24896505-24896527 CTGGGGCAGTGGCTGAGGCCTGG - Intronic
1080892258 11:36419159-36419181 CAGTGGCACGGGGTGGGGCCAGG - Intronic
1081313992 11:41608757-41608779 CTGTGGCACTGGATGAGTATTGG - Intergenic
1081496184 11:43612860-43612882 CTGTGGAACTGGGTGAGAAATGG + Intronic
1081604277 11:44517716-44517738 ATGGTGCAGTGGGTGAGCCCTGG + Intergenic
1082003501 11:47407709-47407731 CTGTGCCACTGTGTGACCCTGGG + Intronic
1083405276 11:62452694-62452716 CTGTCCCATTGTGTGAGCCCAGG - Intronic
1083692130 11:64415801-64415823 CTGAGGCCCTCGGGGAGCCCAGG - Intergenic
1084474095 11:69378910-69378932 CACAGGCACCGGGTGAGCCCTGG + Intergenic
1084521001 11:69662840-69662862 CTCTGGCACTTTGGGAGCCCAGG - Intronic
1085660886 11:78365623-78365645 CTGTGGAGCTGGGTGGGACCAGG + Intronic
1085688551 11:78647447-78647469 CTGAGGCAGAGGATGAGCCCTGG - Intergenic
1087890429 11:103531678-103531700 CTGATGCCCTGGGTGAGCCCAGG - Intergenic
1088064226 11:105696239-105696261 CTGGGCCACTGTGTGAGCCAAGG - Intronic
1088752897 11:112859767-112859789 CTGTGGTAGTGGGTGAGGGCAGG + Intergenic
1088971307 11:114776614-114776636 GTTTGGCACTGGGTGGGCCTGGG + Intergenic
1091938120 12:4449768-4449790 CTGTGTAAGTGGGTGAGGCCTGG - Intergenic
1092024281 12:5227896-5227918 CTGTGGCAGAGGGTGAGGCCAGG - Intergenic
1092996173 12:13953110-13953132 CAGTGGTCCTGGCTGAGCCCAGG - Intronic
1094608413 12:31969729-31969751 CTGAGGCATTGGATGAACCCAGG - Intronic
1095275456 12:40277066-40277088 CTGTGGGATTGCTTGAGCCCAGG - Intronic
1095870165 12:47018170-47018192 GTGTGGTACTGGGTGAGGCCAGG - Intergenic
1097683933 12:62674844-62674866 CTGTGGTACTGGATGTCCCCTGG + Intronic
1097829977 12:64214057-64214079 CTGTGGCACTGTGTGTGCAATGG - Intronic
1098250158 12:68560805-68560827 CTGTGGCACTGGAGGAGGCTAGG + Intergenic
1101642943 12:106601613-106601635 CTGAGGCACTGGATGAGAACAGG - Intronic
1102774821 12:115509235-115509257 CTGTGGCACCTGGTGAGTTCAGG + Intergenic
1103806688 12:123579319-123579341 CTTTGGGACTGCTTGAGCCCAGG + Intergenic
1104719350 12:131036433-131036455 CTGGGGCAGTGAGTGAGACCTGG - Intronic
1104719426 12:131036813-131036835 CTGGGGCAGTGAGTGAGACCCGG - Intronic
1107425992 13:40293344-40293366 CTGTGGGGCTGGGTGAGGCTAGG - Intergenic
1116218532 14:42052515-42052537 TTCTGGCACTGGATGAGTCCAGG - Intergenic
1118052293 14:62042576-62042598 TTGTGGCTCTCAGTGAGCCCTGG + Intronic
1118753077 14:68820447-68820469 CAGTGTCACTGGCTGAGCTCAGG + Intergenic
1118798438 14:69166958-69166980 CAGGAGCACTGCGTGAGCCCAGG + Intergenic
1119067624 14:71545988-71546010 CTGTCGCAAAAGGTGAGCCCAGG + Intronic
1119645623 14:76346423-76346445 GTGTTGCCCTGGGTGAGCCAGGG - Intronic
1120036461 14:79703953-79703975 CTGTGGGGCTGGATAAGCCCAGG + Intronic
1121048547 14:90805015-90805037 CTGGGGCTCCGGGTGAGTCCTGG - Intronic
1122458610 14:101877389-101877411 CTGTGCCTCTGGGTGTGCGCTGG + Intronic
1122897961 14:104769736-104769758 CTGTCCCACTGGGTAAACCCTGG + Exonic
1123122123 14:105921593-105921615 CTGTGCCCCTGGGGGACCCCTGG - Intronic
1202931070 14_KI270725v1_random:31910-31932 CTGTGGCTCTGGTTCTGCCCTGG + Intergenic
1123684950 15:22790206-22790228 CAGTGGCACTGGGTGGTCACTGG - Intronic
1123685059 15:22791136-22791158 CAGTGGCACTGGGTGGTCACTGG + Intronic
1125476465 15:40051035-40051057 GTGTTGGCCTGGGTGAGCCCTGG + Intergenic
1126110151 15:45170155-45170177 ATATGGCACTGGTGGAGCCCTGG + Intronic
1126781466 15:52142744-52142766 CTGAGGCACTGGGAAAGCCAAGG + Intronic
1127678522 15:61269665-61269687 CTGGGCCTCTGGCTGAGCCCAGG - Intergenic
1127899342 15:63329705-63329727 CTGAGGCCCTGGGAGAGCCCTGG + Intronic
1127906810 15:63382031-63382053 CTGTGTTCCTGGGTCAGCCCTGG - Exonic
1129205064 15:74032657-74032679 CACTGGCACGGGGTGTGCCCCGG - Exonic
1131595100 15:93790233-93790255 CTGTGGCACTGGTCAAGGCCAGG - Intergenic
1132004507 15:98214508-98214530 CGGTGGCACAGGCAGAGCCCTGG - Intergenic
1132304904 15:100803966-100803988 CTCTGGCTCTGGATGAGCTCGGG + Intergenic
1132606464 16:795662-795684 CTGGGGCAGGGGGTGAGCCAAGG - Intronic
1132623848 16:880813-880835 CTGTGTGAGTCGGTGAGCCCAGG + Intronic
1132668396 16:1092115-1092137 CTGTGGTACTGGGTGTGCGGTGG - Intronic
1133152069 16:3841546-3841568 CTGGAGCACTGCTTGAGCCCAGG + Intronic
1136286718 16:29248469-29248491 GTGAGGCACTGGGAGTGCCCAGG + Intergenic
1136710649 16:32234153-32234175 CTGTGGCACAGGATGTTCCCAGG - Intergenic
1136757262 16:32695258-32695280 CTGTGGCACAGGATGTTCCCAGG + Intergenic
1136810846 16:33175117-33175139 CTGTGGCACAGGATGTTCCCAGG - Intergenic
1136817322 16:33285197-33285219 CTGTGGCACAGGATGTTCCCAGG - Intronic
1136823885 16:33341726-33341748 CTGTGGCACAGGATGTTCCCAGG - Intergenic
1137291497 16:47055068-47055090 CTCTTGCTCTGGCTGAGCCCAGG + Intergenic
1137719510 16:50619795-50619817 CTCTGGCACTGTGTGACCCTGGG - Intronic
1138180696 16:54938457-54938479 CTCGGGCACTAGGCGAGCCCAGG + Intergenic
1139048620 16:63095573-63095595 CTATGGAACTGCTTGAGCCCAGG + Intergenic
1139602232 16:67993690-67993712 ATGTGGCCCTGGGTGTGGCCGGG - Exonic
1139635500 16:68255931-68255953 TCGTGTCACTGGGTGCGCCCTGG + Exonic
1140506004 16:75473253-75473275 CTCTGAATCTGGGTGAGCCCTGG + Exonic
1140773811 16:78230993-78231015 CTGTGGTACTGAGTCATCCCTGG + Intronic
1141256061 16:82403533-82403555 CTCAGGCACTGACTGAGCCCTGG - Intergenic
1141277729 16:82603433-82603455 GTGTGGCACTGAGAAAGCCCTGG + Intergenic
1141628852 16:85276033-85276055 CTGTGGCACTGTGCTAGCACAGG - Intergenic
1141977859 16:87529494-87529516 CAGTGGCACTGAGCCAGCCCTGG + Intergenic
1203059412 16_KI270728v1_random:955609-955631 CTGTGGCACAGGATGTTCCCAGG + Intergenic
1142769849 17:2088760-2088782 CTGTGCCTCTGGGCAAGCCCTGG - Intronic
1143022676 17:3924926-3924948 GTCTGGGACTGGGTCAGCCCTGG - Intronic
1143103019 17:4514448-4514470 CTGTGGCATTCTGTGAGCTCGGG - Intronic
1143873503 17:9974837-9974859 CTGTGGGTGGGGGTGAGCCCTGG - Intronic
1144016055 17:11197442-11197464 CTCTGGCACTGAGTCAGTCCTGG - Intergenic
1144106666 17:11992432-11992454 CTGTGGCAATGGGTAAGCAGAGG - Exonic
1144592397 17:16535825-16535847 CTGGGACACTGGGCGGGCCCAGG - Intergenic
1146374700 17:32286163-32286185 CTGTGGCTGTGGATGAGCCTGGG - Intronic
1147249708 17:39145584-39145606 CTGTGGGACAGGATGAGCCAGGG - Intronic
1147686085 17:42287728-42287750 GTGTGGCCCTGGGTGGCCCCGGG + Intronic
1147987133 17:44313093-44313115 CTGGGGCACAGGCTGAGCCAGGG - Exonic
1148103226 17:45105368-45105390 CTGTGGCACTGGGGGAGGAAGGG - Intronic
1150267247 17:63839462-63839484 CTGGGGCCCTGAGTGAGCCAGGG - Intronic
1150316960 17:64176956-64176978 CTGTGGGGCTGGGTGGGCTCTGG + Intronic
1151337769 17:73450172-73450194 CTGGGGCACGGGGTGAGCTCTGG + Intronic
1152459095 17:80432003-80432025 CTGTGGAGCTGTGTGAGCCTCGG + Intronic
1152593186 17:81223435-81223457 CTAGGACACTGGGGGAGCCCCGG - Intergenic
1152686110 17:81694547-81694569 GGGTGGCACTGGGCCAGCCCTGG - Intronic
1153375536 18:4373017-4373039 CTGAGGCACTGGGGGTGCACGGG + Intronic
1153829856 18:8912584-8912606 CTGTCGCTCTGGCTGAGCACAGG + Intergenic
1154175741 18:12086627-12086649 CTGTGGCCCTGCGTCTGCCCTGG + Intergenic
1154327525 18:13402204-13402226 TTGTGCCCCTGGGTGAGTCCTGG + Intronic
1155198243 18:23495191-23495213 CTGGGCCACAGGGTGTGCCCAGG - Intergenic
1155346455 18:24862180-24862202 CTGCAGCACTGGGAGAGACCAGG + Intergenic
1157115613 18:44860030-44860052 CTCTGCCACTGAGTGAGCCCAGG + Intronic
1157284536 18:46368477-46368499 CTGTGGGTCTGCGTGTGCCCAGG + Intronic
1160340888 18:78087684-78087706 CTGTGGACCTGAGGGAGCCCTGG + Intergenic
1161236148 19:3199127-3199149 CTGTGTCAGAGGCTGAGCCCAGG + Intronic
1161257255 19:3316287-3316309 CTGGGGGCCTGAGTGAGCCCAGG + Intergenic
1162588239 19:11574648-11574670 CAGTGGCACTGGTTCAGCCTTGG + Intronic
1163497430 19:17655039-17655061 CGGTGACATTGGGTGAGGCCAGG + Intronic
1163592915 19:18204395-18204417 CTGAGGCCTTGGCTGAGCCCCGG + Intergenic
1163647595 19:18498697-18498719 CTGTGGCACTTGGGAAGCCAAGG + Intronic
1163662817 19:18588889-18588911 GCGTGGCCCTGGGTGAGCCCAGG + Exonic
1165006987 19:32815233-32815255 CTGTGGCATGGGGTGAGGCCTGG + Intronic
1165317563 19:35065945-35065967 TTGGGGCACTGGCTGTGCCCTGG + Exonic
1165403259 19:35615136-35615158 CTGAGGCTCAGGGTGAGCCATGG + Exonic
1165421153 19:35722623-35722645 CTGTGGCCCTGGGTCAGGCCCGG + Exonic
1165446744 19:35860834-35860856 CTGTGGGGCTGGCTGATCCCAGG + Intronic
1165822224 19:38683862-38683884 CTGAGCCACTGGGTGAGTCATGG - Intronic
1166184575 19:41131473-41131495 CTGTGTCCCTGGCTGGGCCCTGG - Intergenic
1166372493 19:42309980-42310002 CTGGGGAACTGGGTGGGCCTGGG - Exonic
1167685317 19:50952489-50952511 CTGGGGAACTGTGTGAGCCTGGG - Intronic
1168596794 19:57683965-57683987 CTGTGGGACTCGATGGGCCCGGG + Intronic
925891654 2:8439516-8439538 CTGAGGGAGAGGGTGAGCCCCGG + Intergenic
926291354 2:11533498-11533520 CTGTGGAGCTGGGTGTGCCTGGG - Intergenic
926777703 2:16438733-16438755 CAGGGGGACTGGCTGAGCCCTGG - Intergenic
927462718 2:23312976-23312998 CTGTGGCTCTGTTTGTGCCCAGG - Intergenic
927975014 2:27331844-27331866 CTGGGGCATTGCTTGAGCCCAGG + Intronic
929898739 2:45983595-45983617 CTGTGACACTGGGTGGGACAGGG + Intronic
932664486 2:73685903-73685925 CAGTGGCAGTGGATGAGGCCAGG - Intergenic
936029477 2:109059671-109059693 CTGTGGCACTGTGCCAGCCCCGG + Intergenic
937434552 2:121869718-121869740 CTGTGGCACTGCGTGGCCCAAGG + Intergenic
939801954 2:146721229-146721251 CAGTGGGACTGGGCCAGCCCAGG + Intergenic
941328378 2:164145042-164145064 GTGTGGCACTGGGTGAGACCCGG + Intergenic
944210115 2:197198270-197198292 CTGTGGAACTGGGGGAGCAGTGG + Intronic
946231195 2:218292229-218292251 CTGTGGCACCTGGTTAGCCTTGG - Intronic
946413216 2:219526041-219526063 CTGTGGCAGGGGGAGGGCCCTGG - Intronic
947411341 2:229843649-229843671 CTGGAGGAATGGGTGAGCCCAGG + Intronic
947536142 2:230941444-230941466 ATGTGGCCATGGGAGAGCCCAGG - Intronic
947622082 2:231597308-231597330 CTGAGGACCAGGGTGAGCCCTGG - Intergenic
949007675 2:241658952-241658974 CTGTGGCATTGGCTGTGCCCCGG + Intronic
1169973877 20:11301889-11301911 CTGTGGGGCTGGCTGGGCCCTGG + Intergenic
1170937575 20:20823402-20823424 CTGTGGCAGTGGCTCAGCCTTGG + Intergenic
1171216229 20:23354392-23354414 CTGTGTTGCTGGGTGAGGCCTGG - Exonic
1171492341 20:25529971-25529993 CTGGTGGGCTGGGTGAGCCCTGG - Intronic
1171723195 20:28587220-28587242 GGATGGCTCTGGGTGAGCCCTGG + Intergenic
1172179102 20:32989832-32989854 CTGTGGCTCTGTGAAAGCCCAGG + Intronic
1172252734 20:33490774-33490796 CTGAGGCACCGGGAGAGCCAAGG - Intronic
1172577226 20:36018623-36018645 GTGTGGAGCTGGGTCAGCCCTGG + Intronic
1172935339 20:38616104-38616126 CTTTGGCTCTGGGCAAGCCCAGG - Intronic
1173489705 20:43469866-43469888 CTGTGGCACTGACTGAGGCAGGG - Intergenic
1174780223 20:53382649-53382671 CTGTGGCCCGGGGGGAGCCATGG - Intronic
1175265351 20:57699816-57699838 GTGTGTCACAGGGTGAGCTCAGG - Intronic
1175548909 20:59802984-59803006 CTTTTGCACTGGGTGAGCTCTGG + Intronic
1175777820 20:61664061-61664083 CTCTGGCACTGACTGAGGCCCGG - Intronic
1176285189 21:5015700-5015722 CTGTGGGGCTGGGTGAGCGGGGG + Intergenic
1176593093 21:8660532-8660554 CTGTGGCTCTGGTTCTGCCCTGG + Intergenic
1178021754 21:28416387-28416409 CTGTGGCACTGGGAAGGCACAGG - Intergenic
1179097572 21:38329342-38329364 CTGAGTCACTGGCTAAGCCCAGG - Intergenic
1179381378 21:40902551-40902573 CAGTGGCACTGAGCTAGCCCTGG - Intergenic
1179815688 21:43904628-43904650 TTGAGTCACTGGGTGGGCCCAGG + Intronic
1179871992 21:44247775-44247797 CTGTGGGGCTGGGTGAGCGGGGG - Intronic
1180275940 22:10637659-10637681 CTGTGGCTCTGGTTCTGCCCTGG + Intergenic
1180612900 22:17109186-17109208 CTGCGGCGCTGGCTGACCCCGGG - Exonic
1180839056 22:18950279-18950301 CTGTGCCACTGGGCGACCACTGG - Intergenic
1181005564 22:20011896-20011918 CTGTGGCACATGGTGACTCCGGG - Intronic
1181038837 22:20182416-20182438 CTGGGGCATTGGGAGAGGCCTGG + Intergenic
1181063250 22:20292006-20292028 GTCTGGCACCAGGTGAGCCCGGG - Intergenic
1181303872 22:21903065-21903087 CAGTGGCACTGGGGGAGTTCGGG - Intergenic
1181550852 22:23638403-23638425 GTGTGGCACTGGGGGAATCCTGG - Intergenic
1181633036 22:24161420-24161442 CTGTGGAACTGGGAGAGGCGAGG + Intronic
1182148190 22:28010458-28010480 CTGTGGCGCTGGGGAAGCACTGG + Intronic
1182424561 22:30265285-30265307 GTGTGGCACGGTGTGTGCCCAGG + Intronic
1182427688 22:30283564-30283586 CTGAGGCCCTTGGTGAGCCGGGG + Intergenic
1182503040 22:30762447-30762469 CTGAGGCAGGGGGTGAACCCAGG + Intronic
1182620439 22:31615706-31615728 CTGTGGCAACCGCTGAGCCCAGG - Intronic
1183279597 22:36924796-36924818 CGGGGGCACTGGGTGAGCTGTGG - Intronic
1184179541 22:42810997-42811019 CTGTGGAAGTGAGAGAGCCCAGG - Intronic
1184326264 22:43789350-43789372 CAGCAGCACTGGGTGAGCCAAGG + Intronic
1184556113 22:45233982-45234004 CTGTGGGATTGGGGAAGCCCTGG - Intronic
1184839134 22:47042341-47042363 CTGTGGCAGTGGGGGCGCCATGG + Intronic
1185153537 22:49179916-49179938 CTGTGTCCCTGGGGGTGCCCTGG + Intergenic
1185294611 22:50046949-50046971 CTGTGTCTCTGGGTGAATCCGGG - Intronic
1185351496 22:50342032-50342054 CAGTTGCACTGGCTGAGCACAGG + Intergenic
950163421 3:10776491-10776513 CTGAGGCACTGGCTGAGCCAGGG - Intergenic
950482217 3:13251131-13251153 CCTTTGCACTGGCTGAGCCCTGG + Intergenic
952331052 3:32364859-32364881 CTCTGCCACTGGGTGGGCCCTGG + Intronic
952814456 3:37435069-37435091 CTCTGGCACTGGCTGGGCCGGGG + Exonic
952926023 3:38319722-38319744 CTATGGCACTAGGTGATTCCTGG - Intergenic
954692243 3:52401804-52401826 CTGGGGGCCTGGGTGGGCCCTGG - Exonic
956349629 3:68320611-68320633 CTGGGTCACAGGGAGAGCCCAGG - Intronic
961367438 3:126409014-126409036 CTGAAGCACTGATTGAGCCCAGG - Intronic
961382715 3:126506037-126506059 GCCTGGCACTGGCTGAGCCCTGG - Intronic
961648628 3:128406134-128406156 CTGTGGGAGTGGGTGGGCCCAGG - Intronic
961771419 3:129252823-129252845 CTCTGGCCCTTGGTGAGCCCGGG + Intronic
962276122 3:134014806-134014828 ATGTGGCATTGGATGAGCCTTGG + Intronic
962463916 3:135639362-135639384 CTGTGGAACTGCTTCAGCCCAGG - Intergenic
966320861 3:178699601-178699623 CTGGGGCCCTGGGAGAGGCCAGG + Intronic
967321858 3:188202285-188202307 CTGTGGTTCTGGGAGGGCCCTGG + Intronic
968519766 4:1030080-1030102 CTGGGGCACTGTGTGGGCCCCGG + Intergenic
968652730 4:1766639-1766661 CTGTGGCTGTGGCTGAGCGCGGG - Intergenic
969327838 4:6453936-6453958 CGGTGGCCCTGGGTGTGCACCGG - Intronic
969474377 4:7412840-7412862 CGGAGGCCCTGGGAGAGCCCAGG - Intronic
971079643 4:23195334-23195356 CAGTGGCACTGGGGGAGCTCAGG - Intergenic
972053264 4:34767480-34767502 CTGTAGCACATGGAGAGCCCAGG - Intergenic
976481826 4:85555629-85555651 CTGCAGCCCTGGGTGAGCTCAGG + Intronic
976774615 4:88694178-88694200 CTGCAGCACTAGGTGAGCCGGGG - Intronic
976854870 4:89591431-89591453 TTCTGGCCCTGGGTGACCCCAGG + Intergenic
977817495 4:101431817-101431839 ATGTTGCACTGGCAGAGCCCAGG + Intronic
980061742 4:128137885-128137907 CTGAAGCACTGCTTGAGCCCAGG - Intronic
980950074 4:139366699-139366721 TTGGGGGACTGGCTGAGCCCAGG - Intronic
981337748 4:143586052-143586074 CTTTGGCCCTGTGTGAGCCTGGG + Intronic
985587878 5:750362-750384 CTGTGGCTCCGGGCGACCCCGGG + Intronic
985681127 5:1256509-1256531 CTCAGGCAGTGGGTGAGGCCAGG - Intronic
985701533 5:1376110-1376132 TGGTGGCCCTGGGTGTGCCCTGG + Intergenic
985707128 5:1407950-1407972 CTGTGGTGCTGCGTGAGCCCCGG - Intronic
985974266 5:3403073-3403095 AAGTGGCTCTGGGTGAGTCCGGG - Intergenic
986594924 5:9411550-9411572 TTCTGGCAGTGGGTGAGACCTGG - Intronic
988555533 5:32232818-32232840 CTGGGGACCTGGGTGAGCCACGG - Intronic
988698712 5:33650632-33650654 CTGCTTCACTGGGTCAGCCCTGG - Intronic
988868164 5:35358296-35358318 CTGAGGCACTAGGGGAGCCAAGG - Intergenic
992734750 5:79707772-79707794 CTAAGGCACTGTGTGAGCTCAGG - Intronic
997358683 5:133280679-133280701 CTGTGGCTCTGAGTGGGCCTTGG - Intronic
998160566 5:139810717-139810739 CTGTGGCACTGGGTGTGCCATGG + Intronic
998160980 5:139812934-139812956 CTGTGGCACTGGGTGTTCCATGG + Intronic
999153747 5:149443399-149443421 GTGTGGAAATGGGTGAGCTCTGG - Intergenic
999188722 5:149731165-149731187 CCCAGGCACTGGCTGAGCCCGGG + Intronic
1000777628 5:165440088-165440110 TTGTGGCACTGTGCCAGCCCAGG + Intergenic
1001457386 5:171874851-171874873 CTGGGGGACTGCTTGAGCCCAGG + Intronic
1002105345 5:176877149-176877171 CTTTGGCAGTGGGTAAGCCCTGG + Intronic
1002133293 5:177094158-177094180 CGGTGCCACCAGGTGAGCCCTGG + Intronic
1002158602 5:177302032-177302054 CTGGGTCACTGGGAGATCCCAGG - Intronic
1002694151 5:181072882-181072904 CAGGGGCCCTGGGGGAGCCCTGG + Intergenic
1002913872 6:1512864-1512886 CTGTGTCACTCGCTTAGCCCTGG - Intergenic
1003161241 6:3636369-3636391 CTGAGACGCAGGGTGAGCCCAGG - Intergenic
1003360782 6:5423215-5423237 CTGTGGCTCTGCCTGAGGCCGGG + Intronic
1004202962 6:13566603-13566625 CTGTGGACCTGGGTGAGGCCAGG + Intergenic
1004422966 6:15488022-15488044 CTGTGGAACTGGGTGTGGCTGGG + Intronic
1006635873 6:35460749-35460771 CTGAGACAGTGGGAGAGCCCTGG + Intronic
1007581164 6:42960962-42960984 CTGTGGCACTGGGTGAGCCCAGG + Exonic
1007601533 6:43085171-43085193 CTGTGGAAATGGGTGACCCCTGG + Intronic
1008770315 6:54970726-54970748 CTTAGGCACTGGGTAAGCCAGGG + Intergenic
1011089793 6:83584561-83584583 GCCTGGCACTTGGTGAGCCCTGG - Intronic
1011260240 6:85462617-85462639 CTGTGACACCAGGTGAGCTCTGG + Intronic
1012316847 6:97791409-97791431 CGGTGGGGCTGGGTCAGCCCAGG - Intergenic
1013464034 6:110401030-110401052 CTGTGCCACTGTGTGCACCCCGG + Intronic
1013571151 6:111427452-111427474 CTGTGGCAGTGAGTGAAGCCAGG - Intronic
1015640395 6:135325888-135325910 CTGTGTCACTGTGTGAACCTCGG + Intronic
1016557137 6:145351492-145351514 GTGTGGCAGTGGGTGGGCTCAGG - Intergenic
1017130771 6:151106650-151106672 CTGTGGCCCTGTGTGAGCTACGG - Intergenic
1017716682 6:157218090-157218112 GTGGGGCACTGGGAGAGGCCAGG + Intergenic
1018179558 6:161209314-161209336 CTGTGACACTGTATGAGCCATGG + Intronic
1019508546 7:1405532-1405554 CCGTGGCCCAGGGTGACCCCTGG + Intergenic
1019923879 7:4179871-4179893 CTGTGGCATCGGGGGAGCACAGG + Intronic
1020119010 7:5492337-5492359 CTGTGGGACTGGGCAAGACCTGG + Intronic
1023832596 7:44048582-44048604 CAGTGGCACTGGCAAAGCCCTGG + Intronic
1024505479 7:50158423-50158445 CTTTGCCTCTGGGTGAGGCCCGG + Intronic
1024811918 7:53222106-53222128 CTGTTGCAGTGGGTGGACCCAGG + Intergenic
1024962736 7:54994589-54994611 CTGTAGGCCTGGGAGAGCCCTGG - Intergenic
1025004231 7:55342743-55342765 CTGGGGAACTGGGTGTGGCCGGG - Intergenic
1025064145 7:55838668-55838690 CTGTGGGATTGCTTGAGCCCAGG - Intronic
1026233400 7:68505239-68505261 CTGAGGCACGGGGTGAGGCTGGG - Intergenic
1026445911 7:70484576-70484598 CAGTGGCACTGGGAGCCCCCTGG - Intronic
1028941517 7:96526995-96527017 CTGTGGCACTGGTTGAGGGATGG - Intronic
1035263032 7:157673835-157673857 CTGTGACCCTAGGGGAGCCCTGG - Intronic
1037731227 8:21525471-21525493 CTGGGGGACTGGAAGAGCCCAGG - Intergenic
1038021161 8:23552789-23552811 GTCTGGCAGTGGGGGAGCCCGGG + Intronic
1038581537 8:28752884-28752906 CAGTGGGACTCGGTGAGCCGGGG + Exonic
1038642654 8:29340148-29340170 CTGTGGCACTGGGGGGAACCGGG + Exonic
1039585884 8:38706647-38706669 CTGTGCCCCTAGGTGCGCCCTGG + Intergenic
1039828051 8:41191586-41191608 CTGTGGCACTAGGTGGCCCTGGG - Intergenic
1040386466 8:46918018-46918040 CTGTGGCCGAGGGTGAACCCCGG + Intergenic
1040415902 8:47195901-47195923 CTGTGGCATTGGCTGGGCCAAGG - Intergenic
1041601208 8:59719064-59719086 CTGGTGCACTGTGTGAGCCCTGG - Intergenic
1044562636 8:93627931-93627953 CAGGGGCACTGCTTGAGCCCAGG + Intergenic
1045490178 8:102662215-102662237 CTGAGGCATTGCTTGAGCCCAGG + Intergenic
1046712985 8:117534113-117534135 CAGAGGCACCAGGTGAGCCCTGG - Intronic
1047516078 8:125556116-125556138 GTGTGGCACTGGGGGATCCAGGG + Intergenic
1047711150 8:127553728-127553750 CTGTGGCAGTGGGAGTGGCCAGG + Intergenic
1049229759 8:141475807-141475829 CTGAGACACTGGGTGAGCAGTGG - Intergenic
1049518914 8:143078328-143078350 CTGAGGAACTTGGTCAGCCCTGG + Intergenic
1049692820 8:143970025-143970047 CAGTGGCACTGGGCAGGCCCAGG - Intronic
1049766905 8:144359103-144359125 CAGGGGAACTGGGGGAGCCCCGG - Intronic
1050260734 9:3838364-3838386 CTGTGGGACTGGCTCATCCCTGG + Intronic
1050429983 9:5552484-5552506 CTGCAGCACTGGGATAGCCCTGG + Intronic
1050941995 9:11471785-11471807 CTGTGTGTCTGGCTGAGCCCAGG - Intergenic
1053200645 9:36149524-36149546 CTGTGGCCCTCGATGGGCCCCGG + Intronic
1055308972 9:74958710-74958732 CTCTGGCCCTGTGTGGGCCCTGG + Intergenic
1056737869 9:89225206-89225228 ATGTGGCACTGGTCCAGCCCTGG - Intergenic
1056999368 9:91493273-91493295 CTGTGGCTCTGGGTCAACCCTGG - Intergenic
1057194301 9:93108240-93108262 CTGTGGCACTGGGGTGGGCCGGG - Intronic
1057254028 9:93528835-93528857 CTGTGGCATGGAGTCAGCCCTGG + Intronic
1057353418 9:94318104-94318126 CTGAGGAACTGGGAGAGGCCAGG - Intergenic
1057440155 9:95077232-95077254 CTGTGGCTCTGGGGGAGCCTGGG + Intronic
1057502397 9:95605963-95605985 CCCTGGCTCTGGGTGGGCCCTGG + Intergenic
1057654333 9:96939488-96939510 CTGAGGAACTGGGAGAGGCCAGG + Intronic
1060749991 9:126162714-126162736 CTGGGGCTCTGTGTGACCCCTGG + Intergenic
1061324847 9:129857567-129857589 CTGGGGCACTGGGTCAGTACTGG + Intronic
1061379195 9:130243947-130243969 CTGCAGCTCTGGGTGTGCCCGGG - Intergenic
1061761542 9:132855189-132855211 CTGAGGCTCTGAGGGAGCCCTGG - Intronic
1061974653 9:134062112-134062134 CTGTAGCCCTGGAGGAGCCCTGG + Intronic
1062015026 9:134287079-134287101 CTGTGGCTCTGTGTGGACCCTGG + Intergenic
1062247125 9:135574977-135574999 CTGTGGCCCTGTGTCAGCTCCGG - Intergenic
1062410128 9:136419380-136419402 CTGAGCCACTGGGTGAGTCGTGG + Intronic
1203623136 Un_KI270749v1:139339-139361 CTGTGGCTCTGGTTCTGCCCTGG + Intergenic
1187707381 X:22021959-22021981 CTGTGGCCCTGGATAAACCCAGG + Intergenic
1189274853 X:39778260-39778282 CCTTGGCACTGACTGAGCCCAGG + Intergenic
1190500732 X:51075534-51075556 CTGGGTCACTGTGTGGGCCCCGG - Intergenic
1190817057 X:53938306-53938328 CTGTGGCTGTGGCTGGGCCCTGG - Exonic
1191714138 X:64182564-64182586 CTGTGGCCCTGGTGGAGTCCAGG - Intergenic
1192151276 X:68714074-68714096 CTGTGACACTGGGTCACACCAGG - Intronic
1197347648 X:125344426-125344448 CTGAGGCTTTGGGTGTGCCCTGG - Intergenic
1199867379 X:151864326-151864348 CTTTAGCAGTGGGTGAGCACAGG - Intergenic