ID: 1007581165

View in Genome Browser
Species Human (GRCh38)
Location 6:42960966-42960988
Sequence GGCACTGGGTGAGCCCAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 9, 3: 72, 4: 508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581159_1007581165 2 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581165 6:42960966-42960988 GGCACTGGGTGAGCCCAGGCCGG 0: 1
1: 0
2: 9
3: 72
4: 508
1007581158_1007581165 14 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581165 6:42960966-42960988 GGCACTGGGTGAGCCCAGGCCGG 0: 1
1: 0
2: 9
3: 72
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581165 Original CRISPR GGCACTGGGTGAGCCCAGGC CGG Exonic
900094719 1:935695-935717 GGCACTCCCTGTGCCCAGGCTGG + Intronic
900321085 1:2084450-2084472 GGAACTGGCTGAGGCCAGGGAGG - Intronic
900539015 1:3193566-3193588 GGCTCTGGGGGACCCCAGGATGG + Intronic
900616327 1:3567274-3567296 TGGGCTGGGTGAGCCCTGGCGGG - Intronic
901392620 1:8956935-8956957 GGCACAGGGTGAGGTCAGGATGG - Intronic
901470412 1:9452109-9452131 AGCACTTTGGGAGCCCAGGCAGG + Intergenic
901769360 1:11522642-11522664 GGCTCTGGCTGGGCCCTGGCTGG - Intronic
901769386 1:11522708-11522730 GGCCCTGGCTGGGCCCTGGCTGG - Intronic
901769391 1:11522719-11522741 GGCCCTGGCTGGGCCCTGGCTGG - Intronic
901769411 1:11522774-11522796 GGCTCTGGCTGGGCCCTGGCTGG - Intronic
902297607 1:15478978-15479000 GGCACTGGGTTAGCCCGGGGGGG + Intronic
902597652 1:17520299-17520321 GGCTCTGTGTGGGCCCAGCCCGG + Intergenic
903179401 1:21597804-21597826 GTCACTGGCTGTGTCCAGGCCGG + Intronic
903281932 1:22255035-22255057 GGCACACGGTGAGCAAAGGCAGG + Intergenic
903422237 1:23226261-23226283 TGCAATGGGGGAGTCCAGGCAGG + Intergenic
904465250 1:30703843-30703865 GGCACAGGGTCAGCCCAGCCAGG - Intergenic
904559056 1:31384655-31384677 GGCACTGAGGGAGCCCTAGCAGG - Intergenic
904622973 1:31786560-31786582 GGCCCGGGGTGGGGCCAGGCAGG + Intergenic
904688323 1:32275825-32275847 GGTGCTGGGTGAGCCCAAGGTGG + Intronic
904690763 1:32292033-32292055 GGCTATAGGTGAGCCCAGGAGGG + Intergenic
905355520 1:37381041-37381063 TGCAGTGGGTGAGCCAAAGCAGG - Intergenic
905478629 1:38246218-38246240 GGCCCTGGATGTGCCCAGGCTGG + Intergenic
905792748 1:40798986-40799008 GGCATGGGGTGGGCCCTGGCTGG + Intronic
905970466 1:42138051-42138073 AGCCCTGGGTGAGCCCAGGCGGG - Intergenic
906255044 1:44342160-44342182 GACACTGTCAGAGCCCAGGCAGG + Intronic
906514201 1:46429280-46429302 GGCAAGGGATGAACCCAGGCTGG + Intergenic
907618913 1:55955505-55955527 GGCAGTGGGTGAGATCAGGTTGG + Intergenic
908477665 1:64505594-64505616 GGCATAGGGTGTGCCCAGGGAGG - Intronic
913316990 1:117561864-117561886 TGCATTGGGTGAGACCAGCCTGG - Intergenic
913972246 1:143423987-143424009 GACCCAGGGTCAGCCCAGGCAGG + Intergenic
914066627 1:144249600-144249622 GACCCAGGGTCAGCCCAGGCAGG + Intergenic
914112526 1:144716754-144716776 GACCCAGGGTCAGCCCAGGCAGG - Intergenic
915626437 1:157116830-157116852 GACACTGGGTGAGTCCTGGCTGG + Intergenic
915629100 1:157138186-157138208 CGCACTGGGTGAGGCCCAGCTGG + Intronic
915693751 1:157717046-157717068 GGCACTGGCTGAACCCAGCATGG + Intergenic
917426865 1:174923633-174923655 AGCACTTTGGGAGCCCAGGCGGG + Intronic
917442150 1:175077637-175077659 GGCCCTGGGGGAGGCCAGGGAGG + Exonic
917964218 1:180168271-180168293 GGCACTGGGAGGGCCCTCGCTGG + Intronic
919801866 1:201359140-201359162 GGAACTGGGGGAGTGCAGGCCGG + Exonic
920177632 1:204113022-204113044 GGCAGTGGCTGAGCCCTGGGGGG - Exonic
920542774 1:206791966-206791988 GGCCCTGGGTCTTCCCAGGCTGG + Intergenic
920735528 1:208529814-208529836 GGTCCTGGGGGAGCCCATGCTGG - Intergenic
920968643 1:210723139-210723161 GGCTATGGGTGAGGCCAGGCAGG - Intronic
922164638 1:223105082-223105104 AGCACTTTGGGAGCCCAGGCAGG + Intergenic
922476394 1:225909759-225909781 GGCACTGCTTGTGCCCAGGTAGG - Intronic
922642112 1:227244925-227244947 GCCACTGGCTGAGCCCAGCAGGG - Intronic
922701738 1:227765273-227765295 GGCACTGGTGCAGCGCAGGCTGG + Intronic
922705433 1:227788069-227788091 GGCTGTGGGTGTGGCCAGGCGGG + Intergenic
923358740 1:233186579-233186601 GGCACTGGGGGAGCCCCTTCTGG - Intronic
923886725 1:238165307-238165329 GGCACTGGCTGAGTCCAGCACGG + Intergenic
924937953 1:248788332-248788354 AGCGGTGGGTGATCCCAGGCTGG - Intergenic
1062990160 10:1807363-1807385 GGCATTGGGTGTACCCAGCCTGG - Intergenic
1063012546 10:2039153-2039175 GACACTGGGTGAGCCCAAAATGG + Intergenic
1064327430 10:14364172-14364194 GACACTGGGGCAGCCCTGGCTGG - Intronic
1065520402 10:26566499-26566521 AGCACTTTGGGAGCCCAGGCAGG - Intronic
1066141381 10:32506738-32506760 GGCACTCGGCGGGCCAAGGCAGG + Intronic
1067746465 10:48940147-48940169 GGCAAGGGCAGAGCCCAGGCTGG - Intronic
1067773542 10:49144829-49144851 GGCACTGGGAGGGCTCAGGTGGG - Intergenic
1068524041 10:58107150-58107172 GTAACTGGGTGAGCCCAGGCAGG - Intergenic
1069744980 10:70709256-70709278 GGCCCTGGGTGTGCACAGACAGG + Intronic
1069750319 10:70741211-70741233 GGGGCTGTGTGTGCCCAGGCAGG + Intronic
1070185657 10:74059914-74059936 GGCACTTTGTGAGGCAAGGCAGG + Intronic
1070918787 10:80171179-80171201 GAGGCTGGGAGAGCCCAGGCAGG + Intronic
1071302156 10:84264026-84264048 GGCACTGGGTGTTCCTGGGCTGG - Intergenic
1071475540 10:86022425-86022447 GCCACAGGGTGAGGCCAGGGAGG + Intronic
1073288768 10:102403128-102403150 GGCCCTGCCTGAGCCCGGGCCGG - Exonic
1074296229 10:112192040-112192062 GGCCCTGGGTCGGCTCAGGCTGG - Intronic
1074776440 10:116771210-116771232 GTCACTGGGGCAGCCCAGTCAGG - Intergenic
1075644210 10:124086935-124086957 GGCACTGGGTGGGGCAGGGCAGG - Intronic
1075660853 10:124194713-124194735 GGCACTGTGTGTGCCAAAGCAGG - Intergenic
1075708624 10:124518362-124518384 GGGACTGGGGGACCCCTGGCTGG - Intronic
1076149301 10:128149923-128149945 GGCACTGCGGGAACCCGGGCAGG - Intergenic
1076197382 10:128529035-128529057 GGGACTTGGTGTCCCCAGGCAGG - Intergenic
1076412466 10:130261931-130261953 AGCAGTCAGTGAGCCCAGGCGGG + Intergenic
1076600682 10:131655054-131655076 GTGTCAGGGTGAGCCCAGGCAGG + Intergenic
1077106605 11:844967-844989 AGCACGGGCTGAGCCCTGGCTGG + Intronic
1077224440 11:1433933-1433955 GGATCTGGGTGAGCCCAGGCCGG - Intronic
1077250684 11:1559369-1559391 GGCACGCGCTGGGCCCAGGCAGG + Intronic
1077358298 11:2128596-2128618 GGTACAGGCTGAGCCCTGGCAGG + Intergenic
1077434430 11:2531975-2531997 TGGAGTGAGTGAGCCCAGGCTGG - Intronic
1077634341 11:3831848-3831870 AGCACTGGGCTGGCCCAGGCAGG + Intronic
1077635818 11:3840879-3840901 GGCACCAGGTGAGGCCCGGCCGG - Exonic
1078701094 11:13683625-13683647 AGCACTTTGGGAGCCCAGGCAGG - Intronic
1078731940 11:13982961-13982983 GCCACTGAATAAGCCCAGGCAGG - Intronic
1079355338 11:19725937-19725959 GGCCATGGGCGAGGCCAGGCTGG + Intronic
1080641775 11:34162561-34162583 GGCACTGGGTGAGGCCTCACGGG - Exonic
1080771864 11:35349164-35349186 GGCACTGCGGGAGCCCGGGCAGG + Intronic
1082065904 11:47900081-47900103 GGTACTGGGTGAGTAGAGGCTGG + Intergenic
1082844946 11:57717589-57717611 GGCACTCGGTGGGCTGAGGCAGG + Intronic
1083448244 11:62725444-62725466 GGCACTTTGGGAGGCCAGGCGGG - Intronic
1083457763 11:62790483-62790505 AGCACTGCTCGAGCCCAGGCTGG - Exonic
1083486712 11:62987654-62987676 GTGGCTGGGTGGGCCCAGGCGGG - Intergenic
1083613720 11:64016325-64016347 AGCAGCGGGTGAGGCCAGGCAGG + Intronic
1083692618 11:64419557-64419579 GGCGCTGTGTGAGCCCGGGAAGG + Intergenic
1083765943 11:64841749-64841771 GGACCGGGGTGAGCCCAGCCCGG + Intronic
1083774925 11:64889848-64889870 AGGACTGTGTGAGCCCTGGCAGG + Intergenic
1084170164 11:67397128-67397150 GGGACTGGGGGAGCAGAGGCAGG - Intronic
1084370993 11:68743122-68743144 AGCACTTTGTGAGGCCAGGCCGG - Intronic
1084491334 11:69480219-69480241 GCCACACAGTGAGCCCAGGCCGG + Intergenic
1084690076 11:70719988-70720010 CCCAGTGGGTGACCCCAGGCAGG + Intronic
1085507879 11:77070382-77070404 GGCACTGGCTGAGCAGGGGCTGG - Intronic
1085508667 11:77074361-77074383 GGCACTGGGTGGGCGGAGCCTGG - Intronic
1086134077 11:83429557-83429579 GGCACTGGGTGAGATCAGAGAGG + Intergenic
1087887472 11:103497216-103497238 GGTACTGGTTGAGCCCAGCACGG - Intergenic
1087890427 11:103531674-103531696 TGCCCTGGGTGAGCCCAGGAGGG - Intergenic
1089150847 11:116363111-116363133 GGCACTGGATGAGCCCATCACGG - Intergenic
1089527669 11:119107693-119107715 GGCAGCGGGTGAGCCCCAGCCGG + Exonic
1089666590 11:120024304-120024326 CCCACTGGGTGAGCGGAGGCTGG + Intergenic
1089879102 11:121756314-121756336 AACACTGTGTGAGCCCATGCTGG + Intergenic
1090208049 11:124896571-124896593 GGCTCTGGGTGGCCCCAGGGCGG + Exonic
1090350372 11:126104263-126104285 GGAACTGGGTAAGTCCAGGCTGG + Intergenic
1090440100 11:126718286-126718308 CCCACTGAGTGAGCCCAGCCAGG - Intronic
1090449778 11:126796323-126796345 TGCCCTGGGTCAGCCCAGTCTGG - Intronic
1090799194 11:130160053-130160075 GGCACGAGGTGAGCGCGGGCCGG + Exonic
1092095266 12:5837038-5837060 GTCACTGGAGGAGCCCAGACTGG + Intronic
1092171424 12:6375944-6375966 GGCACTGAGTGAGTAGAGGCAGG + Intronic
1092770806 12:11894819-11894841 CACACAGGGTGAGCCCAGGCTGG - Exonic
1094048751 12:26196097-26196119 GGCACTGGGTTTTCCCGGGCGGG + Intronic
1094755311 12:33462568-33462590 GGGACTGGTTGAGCCGAAGCAGG + Intergenic
1095870164 12:47018166-47018188 GGTACTGGGTGAGGCCAGGAAGG - Intergenic
1095986807 12:48004602-48004624 GGCACTGGCAGGGCCCAGGCGGG - Intergenic
1097029565 12:56081200-56081222 GGCACAAGCTGAGCCCAGGAAGG - Intronic
1097198436 12:57258014-57258036 GGAACTGTGTGAGGACAGGCAGG + Exonic
1101530721 12:105571002-105571024 GGCCCTGGGTGAGAGCAGGCCGG - Intergenic
1101642941 12:106601609-106601631 GGCACTGGATGAGAACAGGGAGG - Intronic
1102433482 12:112901729-112901751 AGCACTGTGGGAGGCCAGGCAGG + Intergenic
1102569887 12:113820977-113820999 TTCACTGTGTGAGCCCTGGCAGG + Intronic
1102653849 12:114463325-114463347 AGCACTGGGTTAGCCCAGATTGG - Intergenic
1103015572 12:117492133-117492155 GGTACTGCCTGAGGCCAGGCTGG - Intronic
1103338790 12:120210227-120210249 GGCAGTTGGTGAGGACAGGCTGG - Intergenic
1103524744 12:121560299-121560321 GGAAATGGGTCAGTCCAGGCTGG - Intronic
1103972795 12:124682500-124682522 GGCACTGGGTGAGGCATGTCAGG + Intergenic
1104734925 12:131130834-131130856 GGCTCTGGCCGCGCCCAGGCTGG + Intronic
1107146977 13:37070068-37070090 GGAACAGGGAGAGGCCAGGCAGG - Intergenic
1107210761 13:37851897-37851919 GGCACTGGCTGAGTCCAGCAAGG - Intronic
1107958943 13:45542409-45542431 GGCACAGGGTCAGCCCACGTGGG - Intronic
1108116470 13:47134225-47134247 GGCACTGGATGAGCTAAGGTAGG + Intergenic
1112286295 13:98107396-98107418 GCAGCTGGGTGAGGCCAGGCTGG - Intergenic
1113633507 13:111904309-111904331 GGAACCTGGTGAGGCCAGGCTGG + Intergenic
1113694420 13:112333649-112333671 TGCACTGTGTGACCCCAGGATGG + Intergenic
1113708902 13:112451679-112451701 GGGACTGGCTGTGCCCAGCCTGG + Intergenic
1113782247 13:112983361-112983383 GGCACTGCGGAAACCCAGGCCGG + Intronic
1113804657 13:113106233-113106255 CGCACAGGGTGCTCCCAGGCTGG + Intronic
1114323092 14:21563448-21563470 CTCACTCTGTGAGCCCAGGCTGG + Intergenic
1114532823 14:23406012-23406034 GGCACAGGGTGTCCCCAGGATGG - Intronic
1114547415 14:23513059-23513081 GGAGCTGGGTCCGCCCAGGCTGG - Intergenic
1116085811 14:40236557-40236579 GGCACTGGCTGAGCCTAGCATGG + Intergenic
1116837559 14:49785848-49785870 TGCACTGGGTGACACCAGCCTGG + Exonic
1117276853 14:54202728-54202750 GGCACTGGGCAGGCCGAGGCAGG - Intergenic
1117459145 14:55927364-55927386 GGCCCCTGGTTAGCCCAGGCAGG - Intergenic
1120174359 14:81277477-81277499 GGCACTCTGCGAGCCCAGACAGG + Exonic
1121320401 14:92988539-92988561 AGCACCAGGTGAGCCTAGGCAGG + Intronic
1121533706 14:94676701-94676723 GGCACTGGGGTGGGCCAGGCAGG - Intergenic
1121582979 14:95044757-95044779 GACACAGGGAGAGCCTAGGCTGG - Intergenic
1122008059 14:98722139-98722161 GGGACTTGTGGAGCCCAGGCAGG - Intergenic
1122544153 14:102513056-102513078 GGGTCTGTGTGTGCCCAGGCAGG + Intergenic
1122598131 14:102907611-102907633 GCCACGGGGAGAGCCGAGGCAGG - Exonic
1122789534 14:104178511-104178533 GGCACAGGGTGAACAGAGGCGGG - Intronic
1122999450 14:105284677-105284699 GGCCGTGGGTCAGTCCAGGCAGG - Intronic
1123405774 15:20018704-20018726 AGCACTGGCTGAGGACAGGCAGG - Intergenic
1123515104 15:21025352-21025374 AGCACTGGCTGAGGACAGGCAGG - Intergenic
1123989632 15:25673849-25673871 GGCACTGAGGCAGCCCAGCCAGG - Intergenic
1123997607 15:25729730-25729752 GGCAGAAGCTGAGCCCAGGCCGG - Intronic
1124340597 15:28886996-28887018 GGGCCTCGGTGTGCCCAGGCGGG + Intronic
1125540576 15:40467545-40467567 GGCACTGGGTGAGGACAGCTGGG + Exonic
1126695383 15:51321357-51321379 GGAGCAGGGTGAGCACAGGCTGG - Intronic
1127863324 15:63012292-63012314 GGCACTGGGGAGGCCCAGCCAGG + Intergenic
1127910272 15:63410897-63410919 GGGCCAGGGTGAGCCCAGGACGG - Intergenic
1128278868 15:66377763-66377785 AGAACTGGTTGAGCCCAGGAGGG - Intronic
1128611134 15:69074458-69074480 GTCTCTGGGGAAGCCCAGGCAGG - Intergenic
1128788168 15:70413433-70413455 GGCTCCGGGTGAGCCCAATCTGG - Intergenic
1128814497 15:70597637-70597659 AGCACTTTGGGAGCCCAGGCTGG + Intergenic
1128999471 15:72320145-72320167 GGCTCTGGGAGAGCTCGGGCGGG - Exonic
1129271517 15:74421637-74421659 GGCGGTGCGGGAGCCCAGGCTGG - Intronic
1129351047 15:74956235-74956257 GACCCTGCGTGGGCCCAGGCGGG + Exonic
1129455527 15:75674515-75674537 CCCACTGGCTGAGGCCAGGCCGG + Exonic
1129493107 15:75948800-75948822 AGCACTTTGGGAGCCCAGGCAGG + Intronic
1129791013 15:78340586-78340608 GGAAGTTGGGGAGCCCAGGCAGG + Intronic
1129904641 15:79177876-79177898 GGCACTAGGTGAGCAGAGGAAGG + Intergenic
1130094393 15:80845182-80845204 GGCACTTTGGGAGCCAAGGCAGG + Intronic
1130169783 15:81499227-81499249 GGCACTCATTGATCCCAGGCAGG - Intergenic
1130901241 15:88208188-88208210 GGCACTCTGTGTGCCCAGGAAGG + Intronic
1131423638 15:92327707-92327729 TGCACAGGGAGAGCCCAGGGAGG - Intergenic
1132038863 15:98507869-98507891 AGCACTGAGTAAGCTCAGGCAGG + Intronic
1132681992 16:1146219-1146241 AGGATGGGGTGAGCCCAGGCCGG - Intergenic
1132915642 16:2341817-2341839 GGGACTGGGTCGCCCCAGGCAGG + Intergenic
1133013043 16:2925421-2925443 GGCACTGGGTGGGACCGGGTGGG - Intronic
1133200748 16:4203068-4203090 GGTACCGGGAGAGTCCAGGCCGG + Intronic
1134051568 16:11141300-11141322 GGCACTTGGTGTGCACTGGCTGG - Intronic
1134067920 16:11241105-11241127 GTCACTGGGGGCTCCCAGGCAGG + Intergenic
1134108129 16:11498635-11498657 GGCCCTGCATGAGCCCTGGCAGG - Intronic
1135575486 16:23582926-23582948 GGCACTGGGCAGGCCGAGGCAGG - Intronic
1135774924 16:25249317-25249339 GAGACAGAGTGAGCCCAGGCTGG + Intronic
1135992798 16:27228209-27228231 GGAGCTGGGTGAGCACAGGAAGG + Intronic
1136389290 16:29952214-29952236 GGCACTGGCTGAGTCCAGCATGG + Intronic
1136629025 16:31478476-31478498 GGCACTGTGGGAGGCCAGGGCGG + Intergenic
1136722689 16:32337692-32337714 GGCAAGGGCTGGGCCCAGGCTGG + Intergenic
1136841011 16:33543691-33543713 GGCAAGGGCTGGGCCCAGGCTGG + Intergenic
1137563044 16:49515250-49515272 GCTCCTGGGTGAGCCCAGGTGGG - Intronic
1137629374 16:49931428-49931450 CTCACTGTGTTAGCCCAGGCTGG + Intergenic
1138145915 16:54611784-54611806 GGCAGTGGGCTAGCCTAGGCTGG + Intergenic
1138395859 16:56704098-56704120 AGCACTTTGGGAGCCCAGGCAGG + Intronic
1138533361 16:57646899-57646921 GGCTCTGTGTGAGCAGAGGCAGG + Intronic
1139373049 16:66480249-66480271 CGCACTGGGTGTGCAGAGGCTGG - Intronic
1139635504 16:68255935-68255957 GTCACTGGGTGCGCCCTGGGGGG + Exonic
1141032879 16:80604668-80604690 GGGACTGGGAAGGCCCAGGCTGG - Intronic
1141197550 16:81872079-81872101 AGCACTTTGGGAGCCCAGGCGGG + Intronic
1141262162 16:82463789-82463811 GGCACTGGCAGGGGCCAGGCAGG + Intergenic
1141691678 16:85600287-85600309 GGCACAGGGTGATCACAGCCCGG - Intergenic
1142162557 16:88566059-88566081 AGCACTTTGGGAGCCCAGGCAGG + Intergenic
1142213804 16:88821260-88821282 GGCCCCAGGTGAGCCGAGGCTGG + Intronic
1142227454 16:88884575-88884597 GTCTCTGCGTGAGGCCAGGCTGG - Intronic
1142277997 16:89133028-89133050 GGCCCTGGGTGGGCCCTGGGTGG + Intronic
1203003742 16_KI270728v1_random:180072-180094 GGCAAGGGCTGGGCCCAGGCTGG - Intergenic
1203135350 16_KI270728v1_random:1716479-1716501 GGCAAGGGCTGGGCCCAGGCTGG - Intergenic
1203151176 16_KI270728v1_random:1843988-1844010 GGCAAGGGCTGGGCCCAGGCTGG + Intergenic
1142812508 17:2401824-2401846 GCCACTGGGCGAACCCAGGGTGG + Intergenic
1142869364 17:2810069-2810091 GGCTCTGGGTGAGGCTATGCTGG + Intronic
1143275276 17:5705612-5705634 GGGACTGGGTGATCCCAGCCAGG + Intergenic
1143378023 17:6478749-6478771 GGCCCAAGGTGAGCCCAGCCAGG + Intronic
1144726633 17:17505663-17505685 GGCACTGGGGCAGCCCACGCCGG + Exonic
1144730082 17:17521026-17521048 GGCACTGGGTGCACACAGGAAGG - Intronic
1144832244 17:18138257-18138279 GGCACTGTGTGAGCCTAGTCAGG + Intronic
1144950315 17:18990362-18990384 GGGTCTGGGAGATCCCAGGCAGG - Intronic
1145813035 17:27776168-27776190 GGCACTGCATGAGTCAAGGCAGG + Intronic
1146361075 17:32178301-32178323 GGCACTCGGTAGGCCGAGGCAGG - Intronic
1146655679 17:34633391-34633413 TGCCCTTGGTGTGCCCAGGCTGG - Intronic
1147585687 17:41652899-41652921 GGCCCAGGGTGGGCCCAGGGTGG - Intergenic
1147987132 17:44313089-44313111 GGCACAGGCTGAGCCAGGGCAGG - Exonic
1148346649 17:46907987-46908009 GGCACTGTGGGAGAGCAGGCTGG + Intergenic
1148355708 17:46974263-46974285 GGCACTGGGTGAGCAACGGATGG - Intronic
1148850026 17:50550122-50550144 GGCACTGGGTGTTCCCTGGAGGG + Intronic
1149533001 17:57410383-57410405 GGCCTTGCGTGAGCACAGGCCGG + Intronic
1150649146 17:66998659-66998681 GGCCCTGGGTGAGCTCAGCCAGG - Intronic
1151219005 17:72597873-72597895 GGCAATGGAAGAGCCCAGGCAGG - Intergenic
1151578159 17:74963160-74963182 GACAGGGGCTGAGCCCAGGCGGG + Intronic
1151628998 17:75297307-75297329 GAGACGGGGTGTGCCCAGGCTGG + Intergenic
1151803212 17:76389982-76390004 GGCACTAGGAGAGCCCCCGCCGG + Exonic
1152008331 17:77696022-77696044 TGCACTAGGGGAGCCCAGGAAGG - Intergenic
1152114250 17:78375201-78375223 GGCAGTGGGTGAGGGCAGGAGGG + Intergenic
1152321972 17:79612806-79612828 GGCAGTGGCTGGGCCCAGCCGGG - Intergenic
1152433449 17:80261485-80261507 GGCCCTGGGGGAGTCCAGGGCGG + Intronic
1152527273 17:80895519-80895541 GGCACTGGGTGTGGACAGGGTGG - Intronic
1152869405 17:82743939-82743961 AGGACTGGGCTAGCCCAGGCTGG + Intronic
1153213512 18:2794257-2794279 CGGACTGCTTGAGCCCAGGCTGG - Intronic
1153514117 18:5889625-5889647 GGCATTGGGTGAGCACAGTGGGG + Exonic
1153605613 18:6828237-6828259 GGCACTCGGCAGGCCCAGGCAGG + Intronic
1153925082 18:9828273-9828295 GGCAATGGGGAAGCCGAGGCGGG - Intronic
1154192568 18:12243031-12243053 GGCACTCGGTTAGCCGAGGCAGG - Intergenic
1155281962 18:24249667-24249689 GGTGCTGGGTGAGCCCAGCCTGG - Intronic
1155845022 18:30695246-30695268 GGCACTGGGTTGGCCAAGGCTGG + Intergenic
1157625937 18:49051284-49051306 ATCACCAGGTGAGCCCAGGCTGG + Intronic
1158449841 18:57554492-57554514 GGCAGTGCGTGTGCCCAGGGGGG - Intronic
1158539864 18:58343270-58343292 GGGAGTGGGTGGGCACAGGCTGG + Intronic
1158622094 18:59041532-59041554 AGCTCTGTGTGAGCCCAGGCAGG + Intergenic
1158636215 18:59160673-59160695 GGCACTGGCTGAGCCCCGTCAGG - Intergenic
1160309601 18:77777201-77777223 AGCCCTGCGTGAGCCCAGACAGG - Intergenic
1160488150 18:79312157-79312179 GGCACTGGTTGAACCCAAGCAGG - Intronic
1160735078 19:658712-658734 GCCACTGCCTCAGCCCAGGCTGG + Intronic
1160832455 19:1110140-1110162 GGTGCTGGGTGACCCCAAGCAGG + Intronic
1160922700 19:1528397-1528419 GGCACTGGGTGAGCAGCCGCTGG - Exonic
1160976104 19:1793464-1793486 GGGACTGGGGGAGCCCCAGCTGG - Intronic
1161027857 19:2044928-2044950 GGCACCAGGTGACCCCAGGGTGG + Intronic
1161265314 19:3360969-3360991 GGAACTGGGGGAGGCGAGGCCGG - Intronic
1161409347 19:4108189-4108211 AGCATTGGGTGAGCCCTGACAGG - Intronic
1161478294 19:4498267-4498289 AGCACCGTGTGGGCCCAGGCAGG - Intronic
1161983576 19:7642695-7642717 GGCCATGGGTGAGCCCACTCAGG - Intronic
1162339410 19:10083121-10083143 GGCACTTGGGAAGCCAAGGCAGG - Intergenic
1163439008 19:17312230-17312252 GGCCCTGTGTGAGCCCGGCCAGG + Intronic
1163647597 19:18498701-18498723 GGCACTTGGGAAGCCAAGGCGGG + Intronic
1163746043 19:19048097-19048119 AGCACTTTGGGAGCCCAGGCAGG + Intronic
1163828695 19:19537657-19537679 GTCCCTGGGTGATCCAAGGCGGG + Intergenic
1164016930 19:21261662-21261684 GGCACTGGGCAGGCCGAGGCAGG + Intronic
1164085679 19:21899948-21899970 GACAGTGGGTGAGCCGAAGCAGG - Intergenic
1164144738 19:22505072-22505094 GGCACTGGGAGAGAGCAGGCAGG + Intronic
1164748104 19:30630770-30630792 GGCTTTAGGTGAGGCCAGGCTGG + Intronic
1165024329 19:32948667-32948689 GGCATTGGGTGGTCCCTGGCAGG - Intronic
1165153129 19:33772426-33772448 GGCAGTGGACGAGGCCAGGCCGG - Exonic
1165742297 19:38211387-38211409 GGCACGGGGCGGGCACAGGCTGG + Intronic
1165861214 19:38910589-38910611 GCCAGAGGCTGAGCCCAGGCAGG - Exonic
1166175345 19:41064644-41064666 AGCACTTGGGGAGGCCAGGCAGG - Intergenic
1166266235 19:41686324-41686346 GGCCCTGGGGGTGACCAGGCTGG + Intronic
1166807157 19:45494330-45494352 GGCTCTGGGACACCCCAGGCCGG - Exonic
1167001058 19:46746083-46746105 GGCAGCGGGTGAGGCCGGGCCGG + Exonic
1167611161 19:50508284-50508306 TTCACTGGGGGAGCCCAGACAGG - Intronic
1168099111 19:54131582-54131604 GGTCCTGGGGGAGGCCAGGCCGG - Exonic
1168325302 19:55535968-55535990 GGGCCTGGGGTAGCCCAGGCTGG - Intronic
1168719956 19:58549437-58549459 GCCACTAGGTGAGGCCAGGCGGG - Exonic
925713381 2:6763287-6763309 GGCAGTGGCTGAGCCAAGGCGGG + Intergenic
925751243 2:7091759-7091781 GGTTCTCGGGGAGCCCAGGCTGG - Intergenic
926001956 2:9340366-9340388 GCCACTGTGTGAGCCCAGCAAGG - Intronic
927076971 2:19588494-19588516 GACAATGGATGACCCCAGGCTGG - Intergenic
927382929 2:22499736-22499758 TGCCCTGGGTCAGCCAAGGCAGG + Intergenic
928009634 2:27595015-27595037 GGCATTGGGCAGGCCCAGGCAGG + Intronic
928153378 2:28853587-28853609 AGCACTTTGGGAGCCCAGGCGGG + Intronic
929144281 2:38693039-38693061 GGCCCTGGGTGGCCCCAGGCTGG + Intronic
929517017 2:42612612-42612634 AGCACTTTGTGAGCCAAGGCAGG + Intronic
929561198 2:42957617-42957639 GGCACTGGGTCAGCCCAGGTGGG + Intergenic
929757690 2:44780990-44781012 GGTACTGGTAGAGTCCAGGCTGG - Intergenic
933648169 2:84828846-84828868 TGCACAGGATGAACCCAGGCTGG + Intronic
934176938 2:89584924-89584946 GACCCAGGGTCAGCCCAGGCAGG + Intergenic
934287245 2:91659284-91659306 GACCCAGGGTCAGCCCAGGCAGG + Intergenic
934713144 2:96528438-96528460 GGCACGGGGTGGGCCCAGGCTGG - Intergenic
935016092 2:99183320-99183342 AGCACTTTGGGAGCCCAGGCGGG + Intronic
936138386 2:109917096-109917118 GGGACTGCTTGAGCCCAGGAGGG - Intergenic
936206310 2:110454389-110454411 GGGACTGCTTGAGCCCAGGAGGG + Intronic
936428001 2:112435815-112435837 GGCACCGGGAGAGGCCTGGCCGG - Intergenic
936641535 2:114317286-114317308 GGCACTGGCTGATCCCAGTGTGG + Intergenic
937340281 2:121086762-121086784 GGCACTGGCTGTGCCCAGGCTGG - Intergenic
937624332 2:124026014-124026036 AGCACTGGCTGAGATCAGGCAGG - Intronic
938084555 2:128390327-128390349 GGCTCTGAGTGGGCCCTGGCTGG + Intergenic
939273500 2:139970392-139970414 GGCACTGGCTGATCCCAGCATGG - Intergenic
942084093 2:172428090-172428112 GGCGCTGGGTGCGCCTCGGCCGG - Intronic
942120325 2:172770325-172770347 GGCAGTGGGGTAGCCCAGCCTGG - Intronic
942412845 2:175729602-175729624 GGTGCTGGGAGAGCCCAGACAGG - Intergenic
944488101 2:200227859-200227881 GGGAATGGTTGAGGCCAGGCTGG - Intergenic
946007256 2:216535893-216535915 GGCACTGTGTGACCCTAGGCTGG + Intronic
946163192 2:217848328-217848350 GTCACTGGCTGTGGCCAGGCTGG + Exonic
946195792 2:218032542-218032564 GGCAGTGGGTGCGCCCTGGCAGG + Intergenic
947039340 2:225897783-225897805 GACACTGGCTGAGCCCAGCACGG - Intergenic
947633967 2:231670934-231670956 GGCTCTGGCTAAGACCAGGCTGG + Intergenic
947833565 2:233159198-233159220 GCCACTGGGGAAACCCAGGCTGG + Intronic
948202114 2:236136640-236136662 AGCCCTGTGCGAGCCCAGGCTGG - Intergenic
948443703 2:238015840-238015862 GCCACTTAGTGACCCCAGGCTGG + Intronic
948791800 2:240383096-240383118 GGCGGTGGGTGAGACCATGCGGG - Intergenic
948846579 2:240685712-240685734 GCCTCTGGCAGAGCCCAGGCCGG + Intergenic
948847282 2:240689022-240689044 GCCTCTGGCAGAGCCCAGGCCGG - Intergenic
948879735 2:240850616-240850638 GGCACTGGGAGCACCAAGGCTGG + Intergenic
1168968366 20:1913864-1913886 TGCACGGGGGGAGCCCAGACAGG - Intronic
1169558778 20:6776380-6776402 AGCTCTGGGTGGGCCCAGCCAGG - Intronic
1170398961 20:15959557-15959579 CGCACTGTGTCAACCCAGGCTGG + Intronic
1170582614 20:17710583-17710605 GTCCCGGGGTGAGCCCAGGCTGG + Intronic
1170668272 20:18405955-18405977 GGCACTGGCTGAGCCCAGCACGG - Intronic
1171293212 20:23994379-23994401 GGGTGTGGGTGAGCACAGGCAGG - Intergenic
1172120494 20:32595890-32595912 GGCACTGGGGGACACAAGGCTGG - Intronic
1172166068 20:32900115-32900137 GAGACTGGGTGAGGCCAGGGTGG + Intronic
1172199465 20:33115072-33115094 GGCACTGGGCGGGCTGAGGCAGG - Intergenic
1172620896 20:36317928-36317950 AGCCCTGGGTGTGCCCAGCCTGG + Intronic
1172795497 20:37534409-37534431 GGCACTGTGGGAGCCCTGGCAGG + Intergenic
1172946366 20:38692761-38692783 GGGACTGGCAGTGCCCAGGCTGG - Intergenic
1172978852 20:38926318-38926340 GCCAATGGGAGAGCCGAGGCGGG + Exonic
1173920287 20:46739562-46739584 GGAACTGGGAGAGGCCAGACCGG - Intergenic
1175451553 20:59072937-59072959 GGCAGTGGGTCAGCCTGGGCTGG + Intergenic
1175812355 20:61865077-61865099 AGCACAGGGAGAGGCCAGGCAGG - Intronic
1175942160 20:62542382-62542404 GGCTCTGGGTCAGCGCAGGGCGG - Intergenic
1175987852 20:62772828-62772850 GGCTCGGGGGGCGCCCAGGCAGG + Intergenic
1176080024 20:63267827-63267849 GCCTCTGTGTGAGCCCTGGCCGG + Intronic
1176110168 20:63407447-63407469 GGAAATGGGGGGGCCCAGGCTGG + Intronic
1176110207 20:63407559-63407581 GGAAATGGGGGGGCCCAGGCTGG + Intronic
1176151075 20:63590943-63590965 GACCCTGGGTCAGCACAGGCTGG - Intronic
1176374255 21:6079397-6079419 GGCACCGGGAGAGGCCTGGCCGG + Intergenic
1178623355 21:34195593-34195615 GTCACTGGGAGATACCAGGCAGG + Intergenic
1179552437 21:42151505-42151527 GGCCCTGGGTAGCCCCAGGCAGG - Intergenic
1179749221 21:43458848-43458870 GGCACCGGGAGAGGCCTGGCCGG - Intergenic
1179953308 21:44723873-44723895 GGCGCTGGGGGAGCACGGGCAGG - Intergenic
1180007645 21:45030318-45030340 GACGCTGTGGGAGCCCAGGCCGG + Intergenic
1180103870 21:45604832-45604854 GGCACTGCGTCAGCTCAGCCAGG + Intergenic
1180550185 22:16531796-16531818 GGCAAGGGCTGGGCCCAGGCTGG - Intergenic
1180798290 22:18618641-18618663 GGAGCTTGGTGAGCCCATGCTGG - Intergenic
1180824271 22:18852093-18852115 GGGTGTGGGTGAGCACAGGCAGG - Intronic
1180845339 22:18978235-18978257 GGGACTGGGCTAGCCCATGCTGG - Intergenic
1180846267 22:18984134-18984156 GGGACTGGGCTAGCCCATGCTGG + Intergenic
1181063249 22:20292002-20292024 GGCACCAGGTGAGCCCGGGCTGG - Intergenic
1181133919 22:20751195-20751217 GGGACTGGGTGAGCTCATGCAGG + Intronic
1181188463 22:21122455-21122477 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1181210735 22:21288038-21288060 GGGTGTGGGTGAGCACAGGCAGG - Intergenic
1181223428 22:21376624-21376646 GGAGCTTGGTGAGCCCATGCTGG + Intergenic
1181255312 22:21558998-21559020 GGAGCTTGGTGAGCCCATGCTGG - Intronic
1181398773 22:22638850-22638872 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1181501504 22:23318206-23318228 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1181650649 22:24257209-24257231 GGTTGTGGGTGAGCACAGGCAGG - Intergenic
1181672541 22:24432454-24432476 GGGACTGGGAGAGCCTGGGCAGG + Intronic
1181706733 22:24653529-24653551 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1181761993 22:25065070-25065092 GGCACTGCCTGAGCATAGGCAGG + Intronic
1183104842 22:35608404-35608426 GGCAGTGGCTGAACCAAGGCTGG + Intronic
1183273464 22:36876291-36876313 GGAACTGGTTGAGCTCACGCAGG + Intronic
1183548753 22:38469036-38469058 GGCACTGGGTGTGCAGAGGCAGG + Intronic
1183625185 22:38997447-38997469 GGAGGTGGGAGAGCCCAGGCGGG - Intergenic
1183684755 22:39355321-39355343 GGTACTGGGAGAGGACAGGCTGG - Intronic
1184197129 22:42937383-42937405 GGCTGTGGGTGAGCCCAGGCAGG + Intronic
1184296656 22:43529328-43529350 GCCTCAGGGTGCGCCCAGGCAGG + Intronic
1184478545 22:44734659-44734681 GACACTGGCTGACCCCACGCAGG - Intronic
1184504112 22:44890876-44890898 GGCATTGGAAGAGCACAGGCTGG - Intronic
1184520910 22:44993437-44993459 GGCTGTGGGAGAGCCCTGGCGGG - Intronic
1184782017 22:46654315-46654337 CCCACTGCGTGAGCCCGGGCTGG - Intronic
1184865960 22:47202073-47202095 GGTCCTCGATGAGCCCAGGCTGG + Intergenic
1184920213 22:47600639-47600661 GGCAGGGGGTGAGCAGAGGCTGG - Intergenic
1185351498 22:50342036-50342058 TGCACTGGCTGAGCACAGGAGGG + Intergenic
1203216212 22_KI270731v1_random:7392-7414 GGGTGTGGGTGAGCACAGGCAGG + Intergenic
1203274410 22_KI270734v1_random:77997-78019 GGGTGTGGGTGAGCACAGGCAGG - Intergenic
949470986 3:4396423-4396445 TCCACAGGATGAGCCCAGGCAGG + Intronic
950699393 3:14729790-14729812 AGCACTTTGGGAGCCCAGGCGGG - Intronic
951255058 3:20439120-20439142 GGCACTGGCTGAGCCCAGCATGG - Intergenic
951634277 3:24755887-24755909 GGCACTGCATCATCCCAGGCTGG + Intergenic
952446169 3:33383141-33383163 TGCACTGGCAGAGCCCAGACTGG - Intronic
953362502 3:42310209-42310231 GGCACTTGCTGAGCCCAGCATGG + Intergenic
953385711 3:42504627-42504649 AGGACTGGGTGAGGGCAGGCTGG + Intronic
953435583 3:42874853-42874875 GGTCCTGGGTGAGGCCAGGCTGG - Exonic
953569317 3:44058683-44058705 GGCACCAGGTGAGCCCAGCAGGG - Intergenic
954647196 3:52138820-52138842 GTCATGGGGTGAGCCCAGGCAGG - Intronic
954655540 3:52191925-52191947 GCCCCTGGGCTAGCCCAGGCAGG - Intergenic
954806553 3:53224170-53224192 GGGCCTGGGAGAGGCCAGGCAGG + Intergenic
956349628 3:68320607-68320629 GTCACAGGGAGAGCCCAGGCAGG - Intronic
958455738 3:94328526-94328548 GGCACTTTGGGAGGCCAGGCAGG - Intergenic
959053973 3:101550998-101551020 GGCACTGGGCAGGCCGAGGCAGG - Intergenic
959514642 3:107251115-107251137 AGCACTTGGGAAGCCCAGGCGGG - Intergenic
961125842 3:124416693-124416715 GGTAAGGGGTGAGCCCAGGTGGG + Intronic
961371332 3:126433745-126433767 GGCACTGGCTGTGCCCAGGCTGG + Intronic
961405664 3:126678139-126678161 GTCTCTGGGTGGTCCCAGGCTGG + Intergenic
962234062 3:133692946-133692968 GGGGCTGGGTGTGCCCAGGCAGG + Intergenic
962879692 3:139564583-139564605 GACTCTGGGTGAGCCCAAGGAGG + Intronic
965274407 3:166662813-166662835 GGCACTGGCTAAGCCCAGCATGG + Intergenic
965415294 3:168385094-168385116 GGCCCTGGCTGAGCCCAGCATGG + Intergenic
967359218 3:188610407-188610429 GGAAATGGGTGAGGCCAAGCAGG + Intronic
968053652 3:195674057-195674079 GAGACAGGGTCAGCCCAGGCTGG + Intergenic
968493124 4:901168-901190 GGCCCTGGGTGGGCTGAGGCAGG + Intronic
968515153 4:1012588-1012610 GGCGCTGGCGGAGGCCAGGCTGG - Intronic
968648590 4:1751593-1751615 GACACTGAGTGGGCCCAGGGTGG + Intergenic
968761210 4:2443465-2443487 GGCATGGAGGGAGCCCAGGCTGG - Intronic
969250214 4:5962770-5962792 GGGACTGGATGAGCCAATGCCGG + Intronic
969257424 4:6011712-6011734 GGGCCTGGGAGAGCCCAGTCAGG - Intergenic
969411259 4:7029881-7029903 GGCTCTGGGTGAGCTCAGGAAGG + Intronic
969703934 4:8781995-8782017 TGTGCTGGGTGGGCCCAGGCAGG + Intergenic
969712259 4:8850951-8850973 TGCCCTGGGGGAGCCCAGTCCGG - Intronic
969717986 4:8877634-8877656 GACAATGAGTGAGCCCAGGCAGG - Intergenic
972655624 4:41060838-41060860 GGCACAGGGTGTACCCTGGCAGG + Intronic
972700927 4:41492287-41492309 GGCACTGGGCAGGCCGAGGCAGG + Intronic
973214512 4:47654577-47654599 GGCACTGGCTGAGCTCTGCCTGG - Intronic
974906005 4:68058055-68058077 GAGTCTGGGTGAGCCTAGGCGGG + Intronic
975612223 4:76214023-76214045 GGCGCTGGGAGCGGCCAGGCCGG - Intronic
976981960 4:91243168-91243190 GGCACTGGCTAAGCCCAGCTTGG - Intronic
977257732 4:94758535-94758557 GGCCCAGGGCCAGCCCAGGCGGG + Intronic
977322039 4:95529477-95529499 AGCACTTTGGGAGCCCAGGCAGG + Intronic
980172521 4:129306549-129306571 GGCACTGGCTGAGCCCACCACGG + Intergenic
980944169 4:139302336-139302358 GTCATTGGGTGACCCCGGGCCGG - Intronic
982069976 4:151686487-151686509 GGGGCAGGGGGAGCCCAGGCTGG - Intronic
984529870 4:180902667-180902689 GGCACTGGCTGAGCCCAGAAGGG + Intergenic
985521811 5:377392-377414 GGCCCTGGGTGGTCCCAGGATGG + Intronic
985784174 5:1885596-1885618 GGGCCTGGGTGAGGCCGGGCGGG - Intronic
986070418 5:4277724-4277746 AGCACTGGGTGGGCAGAGGCTGG - Intergenic
987067650 5:14305210-14305232 GGAGCAGGGTTAGCCCAGGCAGG + Intronic
987112525 5:14701077-14701099 AGCCCTGGCTGAGCCCAGGAAGG - Intergenic
987192361 5:15491301-15491323 AGCACTGGGGAAGCCAAGGCAGG - Intergenic
988050535 5:26024048-26024070 GGCACTGATTGAGCCCAGCCAGG + Intergenic
990047752 5:51455938-51455960 TGCACTGGGCCAGCCCAGGCAGG - Intergenic
993502073 5:88675854-88675876 GGCAGTAGCCGAGCCCAGGCCGG - Intergenic
995254540 5:110031575-110031597 GGCACTGGGCCAGCTGAGGCTGG - Intergenic
995265189 5:110151908-110151930 GGCACTTGCTGAGCCCAGCACGG - Intergenic
996166509 5:120229758-120229780 GGCACTGGCTGAGCCAAGCATGG + Intergenic
997335609 5:133107087-133107109 GGCCCTGGGTAGGCCCTGGCAGG - Intergenic
997433698 5:133858722-133858744 GGCACTCGGCAGGCCCAGGCAGG + Intergenic
1000154139 5:158534272-158534294 GCCACACTGTGAGCCCAGGCTGG + Intergenic
1000195008 5:158948659-158948681 GGCTCTGGGAGAGCGCAGACCGG - Intronic
1000569613 5:162895712-162895734 GCCAGTGGGTGTGGCCAGGCAGG - Intergenic
1001962435 5:175887753-175887775 CCCTCTGGGTGAGCTCAGGCAGG + Intergenic
1001998043 5:176177750-176177772 GACACTGGGAGAGCCCATCCTGG + Intergenic
1002326940 5:178415864-178415886 GGTACTGGGTGAGGCCAGGGAGG + Intronic
1002420969 5:179148902-179148924 GGAACTGGCTGGGGCCAGGCAGG + Intronic
1003322453 6:5063767-5063789 GGGGCTGGGTGGGACCAGGCTGG - Intergenic
1003327622 6:5104744-5104766 GGCTCTGGCTGAGACCAGACAGG - Intronic
1004294493 6:14397811-14397833 GGCCCAGGATGAGCCCAGGTCGG - Intergenic
1005824530 6:29624828-29624850 GGCAGTGGGAGACCCAAGGCTGG - Intronic
1005893628 6:30160397-30160419 GGAACTGGGGGATCCCAGGGTGG - Intronic
1006153566 6:32002057-32002079 GGTGCAGGGTGAGCCCAGGCTGG - Intronic
1006159874 6:32034794-32034816 GGTGCAGGGTGAGCCCAGGCTGG - Intronic
1006446311 6:34081686-34081708 GGCACTTGGTGGGCCCATGTAGG + Intronic
1007228154 6:40329112-40329134 TGCAGTAGGTGAGCCCAGGAGGG + Intergenic
1007581165 6:42960966-42960988 GGCACTGGGTGAGCCCAGGCCGG + Exonic
1007629473 6:43264857-43264879 TGCCCTGGGAGAGCCCAGTCTGG + Intronic
1007633434 6:43285059-43285081 GGCCCAGGGCGAGCCCAAGCCGG + Exonic
1007833627 6:44657506-44657528 AGCAGTGTGTGAGCCCTGGCTGG - Intergenic
1008599392 6:53075771-53075793 GTCACTGTGTCACCCCAGGCTGG + Intronic
1009371058 6:62904633-62904655 AGCACTGGTTGAGCCCAGCATGG - Intergenic
1009893684 6:69721004-69721026 GGCACTAGCTGAGCCCAGTATGG - Intronic
1010280584 6:74018680-74018702 GGCACTGGCTGAGCCCAGCATGG - Intergenic
1013604069 6:111731841-111731863 CACCCTGGGTGAGCCCAGGGTGG + Intronic
1013795396 6:113882483-113882505 GGCACTGGGCGAGGCCACACAGG - Intergenic
1015052921 6:128863588-128863610 GGCACTGGCTGAGCCCAGTATGG + Intergenic
1015931197 6:138361715-138361737 GGTACTGGGGAAGCCGAGGCAGG - Intergenic
1018215073 6:161518633-161518655 GGGGCTGGGTGAGCGGAGGCTGG - Intronic
1019335527 7:480862-480884 GGGACTGGGTGAGCTCAGCCTGG - Intergenic
1019363091 7:616038-616060 GGCTGAGGCTGAGCCCAGGCAGG + Intronic
1019732575 7:2636032-2636054 GGCACTGTGCCAGCCCAGGCTGG + Intronic
1020422644 7:8026687-8026709 GGCACTGGCTGAGGCCAGCATGG - Intronic
1021995832 7:26177483-26177505 GGCACTGGGCGGGCCGAGGCAGG + Intronic
1023660047 7:42461734-42461756 GCCACAGTGTGAACCCAGGCTGG - Intergenic
1023882771 7:44329827-44329849 GGCACTGTCCCAGCCCAGGCAGG + Intronic
1024083397 7:45874157-45874179 GGCACTTTGGGAGGCCAGGCGGG - Intergenic
1024724487 7:52176942-52176964 GGCACTGGGTGAGGCAAAACAGG + Intergenic
1024974941 7:55104663-55104685 GGCACTGGATCAAGCCAGGCAGG - Intronic
1026857701 7:73765803-73765825 AGCACTTTGGGAGCCCAGGCAGG + Intergenic
1027710202 7:81591255-81591277 GGCACTGGGTGAGGGCAGGAAGG - Intergenic
1028354424 7:89888287-89888309 GGCACTAGCTGAGTCCAGGCTGG + Intergenic
1028601776 7:92608836-92608858 GGCAGTGGGCGAGGCCGGGCTGG - Exonic
1030284658 7:107813603-107813625 AGCACTTTGGGAGCCCAGGCAGG - Intergenic
1030653970 7:112145837-112145859 GGCACTGGGTGGGTCAAGGAGGG + Intronic
1031098371 7:117448261-117448283 GGCACTGGCTGAGCCCAGCATGG - Intergenic
1032034017 7:128508360-128508382 GCTACTGGGGGAGCCGAGGCAGG + Intergenic
1032266447 7:130373514-130373536 GGGCCTGTGTGAGGCCAGGCTGG + Intergenic
1034349917 7:150408914-150408936 GTCTCTGGGAGAGCCCAGCCCGG - Intronic
1034440736 7:151084590-151084612 GGCACTTTGGGAGCCAAGGCAGG + Intergenic
1034736129 7:153431073-153431095 GAAACTGGGTCAACCCAGGCTGG + Intergenic
1035019759 7:155793996-155794018 GCCACTGGGTGTGCCCAGCCAGG + Intergenic
1035245788 7:157561288-157561310 GGAAGTGGGAGAACCCAGGCAGG - Intronic
1035302478 7:157906525-157906547 ACCACTGGGAGAGCCCAGTCCGG - Intronic
1035430254 7:158814766-158814788 GGCACTGAGTATGGCCAGGCGGG + Intronic
1035679729 8:1479094-1479116 GGAGCAGGGTGAGCCCAGGCAGG + Intergenic
1035771012 8:2147069-2147091 GGCACTGGGGGAACCCAGCGAGG - Intronic
1037851382 8:22332277-22332299 CTCACTGTGTAAGCCCAGGCTGG - Intronic
1038425230 8:27460371-27460393 GGCTCTGGGAGAGACGAGGCAGG + Exonic
1038565840 8:28619502-28619524 GGCAGTGGGTCAGTCCAGGGAGG - Intronic
1038646425 8:29365907-29365929 TACACTGGGTCTGCCCAGGCAGG + Intergenic
1040416228 8:47198292-47198314 GGCGCTGAGTCAGCACAGGCTGG + Intergenic
1040452624 8:47563279-47563301 GCTACTTGGTGAGCCGAGGCAGG - Intronic
1040615216 8:49028970-49028992 GGGACTGTGGGAGCCCAGCCAGG - Intergenic
1041186363 8:55305061-55305083 GCCACTGGCTGAGCCCAATCTGG - Intronic
1041580008 8:59447604-59447626 AGCACTGGCTGAGCCCAGCATGG + Intergenic
1042149981 8:65771575-65771597 GCCACTGCGTGCGCCCAGCCAGG - Intronic
1042203425 8:66304122-66304144 AGAACTGAGTGAGCTCAGGCAGG - Intergenic
1042310003 8:67370292-67370314 GGCACTGCGTCCGGCCAGGCAGG - Intergenic
1042856535 8:73273337-73273359 GGAGCTGGGAGAGGCCAGGCAGG - Intergenic
1044930668 8:97248811-97248833 GGCCCTGGGAGAGGCCAGGGAGG - Intergenic
1045185642 8:99834804-99834826 GGCACTTTGGGAGCCAAGGCAGG - Intronic
1045248000 8:100460110-100460132 GGCAGCGTGGGAGCCCAGGCAGG + Intergenic
1045491926 8:102676553-102676575 AGCACTTGGTGGGCCCAGCCTGG - Intergenic
1045994802 8:108350981-108351003 GGCACTGGCTGAGCCCAGCATGG - Intronic
1047933536 8:129752900-129752922 GGCACTGATTGAGCCCAGCCTGG - Intronic
1048512406 8:135074827-135074849 AGCACTGGTTGTGCCCAGGCAGG + Intergenic
1048974556 8:139663780-139663802 GGGACTGGCTGGGCTCAGGCAGG - Intronic
1049108484 8:140628227-140628249 GGCAGTGGGTCAGGGCAGGCTGG - Intronic
1049219197 8:141421176-141421198 GGCCCTGGGTCAGTCCTGGCAGG + Intronic
1049379831 8:142306463-142306485 CTCACTGGCTGAGCCCAAGCTGG + Intronic
1049622181 8:143603514-143603536 GGCACTAGGTGAGCTCAGCTCGG - Intergenic
1049777443 8:144413222-144413244 CGAGCTGGGTGAGCGCAGGCGGG - Exonic
1049805422 8:144536630-144536652 GGTCCTGGGTGAGGCCAGGCTGG + Intronic
1050644404 9:7703226-7703248 GGCACTGGCTGAGCCCAGCATGG + Intergenic
1052258946 9:26492067-26492089 GGCACTGGGCAGGCCGAGGCAGG - Intergenic
1052941763 9:34136948-34136970 GGCACTCGGCAAGCCGAGGCAGG - Intergenic
1053239995 9:36487611-36487633 GGCGCTGGCTGGGCCCCGGCCGG + Intergenic
1053662104 9:40291261-40291283 GCCACTGTGTGACCTCAGGCAGG + Intronic
1053912553 9:42921429-42921451 GCCACTGTGTGACCTCAGGCAGG + Intergenic
1054374231 9:64437501-64437523 GCCACTGTGTGACCTCAGGCAGG + Intergenic
1054522506 9:66085023-66085045 GCCACTGTGTGACCTCAGGCAGG - Intergenic
1055009776 9:71552711-71552733 GGCAGTGGGAGAGCCTGGGCAGG + Intergenic
1056659200 9:88532526-88532548 GAGACTGGGGGAGCCCGGGCCGG + Intergenic
1057192177 9:93094411-93094433 GTGCCTGGGTGAGTCCAGGCTGG - Intergenic
1057251820 9:93509236-93509258 GCCACTGGGTGGGTCCAGGTGGG - Intronic
1057442517 9:95092311-95092333 GATGCTGGGTGGGCCCAGGCGGG - Intergenic
1057613428 9:96567132-96567154 GGCACTGGAGGAGCCCTGGTTGG - Intronic
1058368442 9:104235942-104235964 GGCACTCGGCAGGCCCAGGCAGG + Intergenic
1058522913 9:105829372-105829394 GGCACTGGCTGAGCTCTGCCTGG + Intergenic
1058842192 9:108920611-108920633 GGCACTAGGAGAGCCCAGGCAGG + Intronic
1059194249 9:112355862-112355884 AGCACTTTGTGAGCCCAAGCCGG - Intergenic
1059401076 9:114071007-114071029 GGCCCTTGCTGGGCCCAGGCTGG - Intronic
1059429615 9:114242025-114242047 TGCCCTGGGTGGGGCCAGGCAGG + Intronic
1059432118 9:114256568-114256590 GTCACTGGGTGACCCTAGGCAGG - Intronic
1059434366 9:114267310-114267332 GGCTGGGGGTGGGCCCAGGCTGG - Intronic
1060369808 9:123057939-123057961 GGCACTGGGCAGGCCGAGGCAGG + Intronic
1060947028 9:127575774-127575796 AGCACTGTGGGAGCCAAGGCGGG - Intronic
1061081044 9:128370532-128370554 GGCTCTGGGTGAGAACATGCTGG - Intergenic
1061379194 9:130243943-130243965 AGCTCTGGGTGTGCCCGGGCTGG - Intergenic
1061661404 9:132132582-132132604 GGGGATGGGTGAGCCCAGACTGG + Intergenic
1061669963 9:132183095-132183117 GGCTCTGAGAGAGCCGAGGCAGG - Intronic
1061715887 9:132518676-132518698 GGAACAGGGTGAACACAGGCAGG - Intronic
1061832829 9:133306625-133306647 GGCACTGGGGGGCCCCGGGCTGG - Intergenic
1062042074 9:134408789-134408811 GGCCCAGTCTGAGCCCAGGCAGG + Intronic
1062160261 9:135075909-135075931 GGCACTTCGGGCGCCCAGGCCGG - Intronic
1062261869 9:135666846-135666868 GGCAGTGGCTGAGCCCAGGGAGG - Intergenic
1062288771 9:135785433-135785455 GGCCCTGGGAAAGCCGAGGCAGG + Intronic
1203549323 Un_KI270743v1:155025-155047 GGAACTTGGGGAGTCCAGGCTGG - Intergenic
1185834362 X:3331151-3331173 AGCACTTTGGGAGCCCAGGCAGG - Intronic
1185891458 X:3825636-3825658 GGCACCAGGAGAGCCCAGGCTGG + Intronic
1185896564 X:3864050-3864072 GGCACCAGGAGAGCCCAGGCTGG + Intergenic
1185901682 X:3902476-3902498 GGCACCAGGAGAGCCCAGGCTGG + Intergenic
1187401750 X:18966661-18966683 GGCCCTGGGTTATCCCAGGAGGG + Intronic
1188004213 X:25005965-25005987 GGCGCTCGGTGAGCCCAGGTGGG - Intronic
1189884965 X:45533192-45533214 GGCACTGGCTGAGCCCAGCACGG - Intergenic
1190011788 X:46791491-46791513 AGCACTTTGGGAGCCCAGGCAGG + Intergenic
1190641729 X:52486791-52486813 GGAACTGGGTGAGCAGAGGGGGG + Intergenic
1190645943 X:52526074-52526096 GGAACTGGGTGAGCAGAGGGGGG - Intergenic
1190739914 X:53281766-53281788 TGCACTGAGGGAGCCCAGCCTGG - Intronic
1195165201 X:102213163-102213185 GGCACTGGCTGAGCCCAGCACGG + Intergenic
1195193657 X:102473928-102473950 GGCACTGGCTGAGCCCAGCACGG - Intergenic
1195800983 X:108709822-108709844 GGCACTTTGAGAGACCAGGCGGG - Intergenic
1198261572 X:134969497-134969519 AGCAATAGGTGAGGCCAGGCAGG - Intergenic
1198761884 X:140040864-140040886 GGTACTGGCTGAGCCCAGCATGG + Intergenic
1199676005 X:150189911-150189933 GGCAGTAGGTGAGCACAGGGTGG - Intergenic
1201294921 Y:12454345-12454367 GGCACTGGGCAGGCCGAGGCAGG + Intergenic
1201608506 Y:15814409-15814431 AGCACTTGGGGAGCCGAGGCGGG + Intergenic
1201718789 Y:17075114-17075136 GTCTCTGGCTTAGCCCAGGCTGG + Intergenic