ID: 1007581166

View in Genome Browser
Species Human (GRCh38)
Location 6:42960967-42960989
Sequence GCACTGGGTGAGCCCAGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 535}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581159_1007581166 3 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581166 6:42960967-42960989 GCACTGGGTGAGCCCAGGCCGGG 0: 1
1: 0
2: 4
3: 51
4: 535
1007581158_1007581166 15 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581166 6:42960967-42960989 GCACTGGGTGAGCCCAGGCCGGG 0: 1
1: 0
2: 4
3: 51
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581166 Original CRISPR GCACTGGGTGAGCCCAGGCC GGG Exonic
900140319 1:1137039-1137061 GAGCTGGGGGAGCCCAGGGCGGG + Intergenic
900197906 1:1386417-1386439 GCACTGGCTGTGCACACGCCTGG + Intronic
900261267 1:1730998-1731020 GCACTGTGGGAGGCCAGGCACGG + Intronic
900287075 1:1906934-1906956 GAACTAGTGGAGCCCAGGCCTGG - Intergenic
900482112 1:2904419-2904441 GCACTGCGGGCGCCAAGGCCAGG - Intergenic
900870558 1:5299250-5299272 GCTCTGGGTGATCCCCGTCCTGG + Intergenic
901390653 1:8943748-8943770 GGACTGGATGAGCCCAGGCGAGG - Intergenic
901465577 1:9418891-9418913 GCACTGGGCCAGGCCAGGGCAGG - Intergenic
901650861 1:10742490-10742512 GCAGGAGGTGAGGCCAGGCCAGG - Intronic
901791034 1:11653891-11653913 GGAATAGGTGAGGCCAGGCCTGG + Intronic
902597653 1:17520300-17520322 GCTCTGTGTGGGCCCAGCCCGGG + Intergenic
902879052 1:19358877-19358899 GCACTGGGTGGGTACAGGCTTGG + Intronic
902973408 1:20071560-20071582 GTACTGGGAGAGCTCAGGGCAGG + Intronic
903179402 1:21597805-21597827 TCACTGGCTGTGTCCAGGCCGGG + Intronic
903283360 1:22262767-22262789 GCCCTGGGTGGGGCCGGGCCTGG + Intergenic
903291280 1:22315824-22315846 GCACTGGCTGTTCCCTGGCCTGG - Intergenic
903749870 1:25615056-25615078 GACATGGGTGAGGCCAGGCCAGG + Intergenic
904266386 1:29320621-29320643 GCAGAGGCTCAGCCCAGGCCAGG + Intronic
904285379 1:29450294-29450316 CCTCTGGGGGAGCCCAGCCCAGG + Intergenic
904286416 1:29455533-29455555 GAACTGGGAGAGCCCAGCACTGG + Intergenic
904434560 1:30485822-30485844 GCACTGGGGAATCCCTGGCCTGG + Intergenic
904465249 1:30703842-30703864 GCACAGGGTCAGCCCAGCCAGGG - Intergenic
905008493 1:34730424-34730446 GTTCAGGGTGAGCCCAGGCCTGG - Intronic
905241558 1:36584608-36584630 GCACTGGGTGGGTGCAGGCTCGG + Intergenic
905355519 1:37381040-37381062 GCAGTGGGTGAGCCAAAGCAGGG - Intergenic
905478630 1:38246219-38246241 GCCCTGGATGTGCCCAGGCTGGG + Intergenic
905769496 1:40628364-40628386 GCTTGGGGTGAGCCCAGGCCAGG - Intronic
905863689 1:41365879-41365901 CCACTGGGAGCTCCCAGGCCAGG + Intronic
905889694 1:41511313-41511335 GCACATGGGGAGCCGAGGCCTGG + Intronic
905970465 1:42138050-42138072 GCCCTGGGTGAGCCCAGGCGGGG - Intergenic
906078289 1:43068012-43068034 GGACTGGGTGAGTCCATTCCCGG - Intergenic
906209749 1:44006002-44006024 GCCCTGGGTGGGCCCAGGGCTGG + Intronic
906606327 1:47174902-47174924 GGGCTGGGTGAGCCCAGGCTTGG - Intergenic
907032804 1:51188837-51188859 GGACTGCTTGAGCCCAGCCCTGG + Intergenic
907420273 1:54342444-54342466 GCAGTGGGTGGGGCCAGGGCAGG + Intronic
907848326 1:58229707-58229729 GCACTGGCTAAGCACAGGCCTGG + Intronic
907956829 1:59236842-59236864 TAACTGGGTGAGAGCAGGCCTGG - Intergenic
910361271 1:86415487-86415509 CCACTGGGTGAGCCCACAACAGG + Intergenic
910680625 1:89860511-89860533 GCACTTTGTGAGGCCAGGGCGGG + Intronic
911150296 1:94591739-94591761 GCACTTGGTGAGGCCAAGGCGGG - Intergenic
913316989 1:117561863-117561885 GCATTGGGTGAGACCAGCCTGGG - Intergenic
914340563 1:146756259-146756281 GCCCTGGAGGAGCCCAGGCATGG - Intergenic
914739920 1:150455896-150455918 GGACTGCTTGAGCCCAGGTCAGG - Intronic
915316120 1:155030048-155030070 GGACAGGGAGAGCCCAAGCCAGG - Intronic
915522428 1:156455532-156455554 GCACTCTGTGAGGCCAGGGCGGG - Intergenic
915563119 1:156699201-156699223 CCCATGGGTGACCCCAGGCCTGG - Intergenic
915570633 1:156743503-156743525 GCACTGGCTGGGGCAAGGCCAGG - Intronic
915626438 1:157116831-157116853 ACACTGGGTGAGTCCTGGCTGGG + Intergenic
915629101 1:157138187-157138209 GCACTGGGTGAGGCCCAGCTGGG + Intronic
915853295 1:159351648-159351670 TCATTGGGGTAGCCCAGGCCAGG - Intergenic
917438822 1:175047605-175047627 GCACTTTGGGAGCCCAGGGCAGG - Intergenic
918426889 1:184419769-184419791 GCACTGGCTGTTCCCTGGCCTGG - Intronic
918635395 1:186768126-186768148 GCACTTTGGGAGGCCAGGCCAGG + Intergenic
919539161 1:198827729-198827751 GCACAGGGTGAGCGCATGACAGG + Intergenic
919578206 1:199337598-199337620 GCACTGGGGGAGCCAAGGTCTGG - Intergenic
919786127 1:201259766-201259788 TCTCTGGGCGAGGCCAGGCCTGG - Intergenic
919880596 1:201898232-201898254 GCCATGGGAGAGTCCAGGCCTGG - Exonic
922221489 1:223611740-223611762 GCACTTTGTGAGCCAAGGGCAGG + Intronic
922233221 1:223704042-223704064 GCACTTTGTGAGGCCAGGGCAGG + Intronic
922721604 1:227902793-227902815 GCACTGAGGCAGCCCAGGCATGG - Intergenic
922804491 1:228378399-228378421 GCACTCTGTGCGCCCAGCCCTGG + Exonic
922958329 1:229624553-229624575 GGACTGCTTGAGCCCAGGCCTGG + Intronic
923270174 1:232348210-232348232 GCCCTGGGTGGGGCCAGGCATGG - Intergenic
924439902 1:244077506-244077528 GGGCTGGGAGAGCCCAGGTCCGG + Intergenic
924937952 1:248788331-248788353 GCGGTGGGTGATCCCAGGCTGGG - Intergenic
924954578 1:248914315-248914337 GAACTGGGTGAGGACAGGTCAGG + Intronic
1063141419 10:3259556-3259578 GCTCTGGGCGACCCCAGGGCTGG - Intergenic
1064856981 10:19779910-19779932 GCACTGGGTGAGTCCATGAGTGG - Intronic
1065296174 10:24277410-24277432 GCCCTGGGGGAGCCCAGGAATGG + Intronic
1065727069 10:28677222-28677244 GCGCCGGGGGAGCCCAGCCCCGG - Intergenic
1066118030 10:32257366-32257388 GCACTTGGGGAGGCCAGGGCAGG + Intergenic
1066434085 10:35380725-35380747 GGACTGGGAGACCCCAGGCAAGG - Intronic
1067064473 10:43096033-43096055 GTACAGGGTGGGCCCAGCCCTGG + Intronic
1067581736 10:47450686-47450708 GCACTGAGGGGACCCAGGCCTGG + Intergenic
1068524040 10:58107149-58107171 TAACTGGGTGAGCCCAGGCAGGG - Intergenic
1069612162 10:69781448-69781470 GGACTGGGAGAGTCCAGTCCTGG + Intergenic
1072154775 10:92714736-92714758 GCACTGGGAGAGGAGAGGCCAGG + Intergenic
1072935021 10:99703970-99703992 GCACTTTGGGAGGCCAGGCCAGG - Intronic
1073447886 10:103591992-103592014 AGGCTGGGAGAGCCCAGGCCAGG - Exonic
1074038878 10:109768501-109768523 CCACTTGGGGAGGCCAGGCCTGG - Intergenic
1074316949 10:112369715-112369737 GCACTGTGGGAGCCCCTGCCTGG + Intergenic
1075559888 10:123460662-123460684 GAGCGGGGAGAGCCCAGGCCTGG - Intergenic
1075639733 10:124056171-124056193 GGACTGTCTGAGGCCAGGCCTGG - Intronic
1075774353 10:124970506-124970528 GCACTGTGTGAGGCCAAGGCAGG - Intronic
1076278565 10:129225769-129225791 TCACTGGGGGAGCCCTGGGCAGG - Intergenic
1076352332 10:129825863-129825885 GCCCTGGCAGAGTCCAGGCCGGG + Intergenic
1076412467 10:130261932-130261954 GCAGTCAGTGAGCCCAGGCGGGG + Intergenic
1076652536 10:131999630-131999652 ACACTGAGGGGGCCCAGGCCAGG + Intergenic
1076756653 10:132576122-132576144 GCACAGGGAGGGCCCAGGGCTGG - Intronic
1076792362 10:132784310-132784332 CCACCGGCTGAGCCCAGGGCGGG + Intergenic
1077035192 11:491060-491082 GCCCTGGGTGCGCTGAGGCCTGG + Exonic
1077035658 11:493249-493271 GAAATGGGTGACGCCAGGCCTGG - Intergenic
1077106606 11:844968-844990 GCACGGGCTGAGCCCTGGCTGGG + Intronic
1077167924 11:1152128-1152150 GCAGAGTGTGAGCCCAGCCCAGG + Intergenic
1077224439 11:1433932-1433954 GATCTGGGTGAGCCCAGGCCGGG - Intronic
1077246061 11:1539183-1539205 GCACTGGGGGAGGCCAAGGCGGG + Intergenic
1077339084 11:2018069-2018091 CCGCAGGGTGAGCCAAGGCCAGG + Intergenic
1077411718 11:2406839-2406861 TCAGTGGCAGAGCCCAGGCCTGG + Intronic
1077434429 11:2531974-2531996 GGAGTGAGTGAGCCCAGGCTGGG - Intronic
1077517736 11:3012024-3012046 GCACCTGGTGGGTCCAGGCCCGG + Intronic
1077604918 11:3603135-3603157 GCACTGTGTGAGGCCAAGGCAGG + Intergenic
1077635817 11:3840878-3840900 GCACCAGGTGAGGCCCGGCCGGG - Exonic
1078076170 11:8162890-8162912 GCACTTGGGGAGCCCAAGGCAGG - Intronic
1078143665 11:8708993-8709015 GCACTGAGAGCTCCCAGGCCCGG + Intronic
1078438473 11:11344817-11344839 GCACTCGGTGAGGCCAGATCTGG - Intronic
1078544975 11:12240732-12240754 GCACTGCCAGAGCCCATGCCAGG - Intronic
1080089769 11:28332705-28332727 GCACTGTGGGAGGCCAAGCCAGG + Exonic
1080771865 11:35349165-35349187 GCACTGCGGGAGCCCGGGCAGGG + Intronic
1081604279 11:44517721-44517743 GCAGTGGGTGAGCCCTGGGCTGG + Intergenic
1083259678 11:61516282-61516304 GCGCTGGGGAAGCCCAAGCCTGG + Intronic
1083457762 11:62790482-62790504 GCACTGCTCGAGCCCAGGCTGGG - Exonic
1083614117 11:64018097-64018119 GAGCTGGGGGAGGCCAGGCCAGG + Intronic
1083621135 11:64049967-64049989 GCACAGAGCCAGCCCAGGCCTGG + Intronic
1083759390 11:64807404-64807426 GCCCTGGGAAAGGCCAGGCCAGG + Intronic
1084128744 11:67118378-67118400 GCAGTGGGTGAGGCGGGGCCAGG + Intergenic
1084428217 11:69097119-69097141 ACTATGGCTGAGCCCAGGCCTGG - Intergenic
1084562854 11:69914026-69914048 AGCCTGGGGGAGCCCAGGCCTGG - Intergenic
1086154676 11:83652616-83652638 GCACTGTGGGAGGCCAGGGCAGG - Intronic
1087124134 11:94606581-94606603 GCACTTTGGGAGGCCAGGCCGGG + Intronic
1088887335 11:114018186-114018208 GCACTCGGTGACCCCAGGTGTGG + Intergenic
1089150846 11:116363110-116363132 GCACTGGATGAGCCCATCACGGG - Intergenic
1089328483 11:117673736-117673758 CAACAGCGTGAGCCCAGGCCTGG - Intronic
1089527670 11:119107694-119107716 GCAGCGGGTGAGCCCCAGCCGGG + Exonic
1089666592 11:120024305-120024327 CCACTGGGTGAGCGGAGGCTGGG + Intergenic
1089868428 11:121651823-121651845 GCCCTGGGTCAGAGCAGGCCTGG + Intergenic
1090297061 11:125597965-125597987 GCACTGGGGGAGGCCAAGGCGGG + Intronic
1090350373 11:126104264-126104286 GAACTGGGTAAGTCCAGGCTGGG + Intergenic
1090440098 11:126718285-126718307 CCACTGAGTGAGCCCAGCCAGGG - Intronic
1090449777 11:126796322-126796344 GCCCTGGGTCAGCCCAGTCTGGG - Intronic
1090799195 11:130160054-130160076 GCACGAGGTGAGCGCGGGCCGGG + Exonic
1202822068 11_KI270721v1_random:73251-73273 CCGCAGGGTGAGCCAAGGCCAGG + Intergenic
1093030910 12:14287663-14287685 GCACTTGGGGAGGCCAGGGCAGG + Intergenic
1095145512 12:38721697-38721719 CCCCTGGGGGAGCCCAGACCTGG + Intronic
1095245827 12:39920061-39920083 TCCCTTGGTGAGCACAGGCCAGG - Intronic
1096868191 12:54577582-54577604 GAACAGGGTGGGCCCATGCCAGG + Intronic
1097181346 12:57173744-57173766 GCACTATGAGGGCCCAGGCCCGG - Intronic
1097810167 12:64010436-64010458 ACACTGGGTGGGCCCTGGCCAGG - Intronic
1100301134 12:93309152-93309174 GCACTGGGGGAGGCCAAGGCAGG - Intergenic
1100633513 12:96411883-96411905 GCACTTGGGGAGGCCAAGCCGGG - Intergenic
1101530720 12:105571001-105571023 GCCCTGGGTGAGAGCAGGCCGGG - Intergenic
1101696527 12:107132477-107132499 GCTCTGCCTGAACCCAGGCCAGG - Intergenic
1102569888 12:113820978-113821000 TCACTGTGTGAGCCCTGGCAGGG + Intronic
1103711769 12:122918073-122918095 GAGTGGGGTGAGCCCAGGCCTGG + Intergenic
1103723277 12:122985939-122985961 TCAGTGCGTGTGCCCAGGCCAGG + Exonic
1104825094 12:131702230-131702252 GCACTGCTTCAGCTCAGGCCTGG - Intergenic
1104910504 12:132238036-132238058 GCAGTGGGTGAGCCAAGGTCAGG + Intronic
1104995120 12:132649397-132649419 GCAGAGGGTGTGCTCAGGCCCGG - Exonic
1105227132 13:18446516-18446538 GCACTGTGGGAGGCCAAGCCTGG + Intergenic
1106585232 13:31051529-31051551 GCACTTTGGGAGCCCAAGCCAGG - Intergenic
1107139668 13:36984345-36984367 GCACTGTGGGAGGCCAGGGCAGG - Intronic
1107796686 13:44060468-44060490 ACGCTGGGAGAGCCAAGGCCTGG + Intergenic
1110554945 13:76849253-76849275 GCACTTGGGGAGGCCAGGGCGGG + Intergenic
1112449717 13:99497756-99497778 GCACTGGGGGAGACCAAGGCAGG + Intergenic
1113804658 13:113106234-113106256 GCACAGGGTGCTCCCAGGCTGGG + Intronic
1114455653 14:22851601-22851623 GGTCTGGGTGAGGCAAGGCCAGG + Intergenic
1114636105 14:24187774-24187796 GCACTGTGTGAGCCTCAGCCTGG - Exonic
1115761099 14:36580132-36580154 GCACCGGAGCAGCCCAGGCCGGG - Intergenic
1116662004 14:47722156-47722178 GCCCTGGGAGAGCCCAACCCTGG + Intergenic
1116837560 14:49785849-49785871 GCACTGGGTGACACCAGCCTGGG + Exonic
1117445403 14:55799410-55799432 GCACTGGGTGTCACCAAGCCTGG + Intergenic
1117635631 14:57740104-57740126 GCACTTTGTGAGGCCAGGGCAGG - Intronic
1118319889 14:64746918-64746940 GCACTGGGAGAGCTTAGCCCTGG + Exonic
1119112620 14:71989222-71989244 ACACTGGGTAAACCCATGCCTGG + Intronic
1119473271 14:74912244-74912266 GCACACAGTGAGCCAAGGCCCGG - Intronic
1119642691 14:76326988-76327010 GGGCTGGGAGAGCCTAGGCCTGG + Intronic
1119776074 14:77249573-77249595 TCACTGGGTGTGGCCAGGTCTGG - Intronic
1119949235 14:78727494-78727516 GCACTGTGGGAGGCCAGGGCAGG + Intronic
1120866657 14:89301047-89301069 GCACTTTGTGAGGCCAAGCCAGG - Intronic
1121376051 14:93411497-93411519 GCACTGGGTCAGCACAGCACTGG - Intronic
1122436695 14:101705941-101705963 GCACGGCGTGGGCCCAGGGCCGG - Intergenic
1122577925 14:102753374-102753396 GCACTGGGTGAGCACAGCGTAGG - Intergenic
1122780357 14:104140859-104140881 GCCCTGGCTGAGACCAGCCCGGG - Intronic
1123405773 15:20018703-20018725 GCACTGGCTGAGGACAGGCAGGG - Intergenic
1123450802 15:20357953-20357975 GCACTGGGTGTCCCAGGGCCAGG + Intergenic
1123515103 15:21025351-21025373 GCACTGGCTGAGGACAGGCAGGG - Intergenic
1124684378 15:31768410-31768432 GCACTTGGGGAGGCCAAGCCAGG + Intronic
1124684916 15:31774308-31774330 GCACAGGGTGATCGCAGGGCTGG - Intronic
1125925610 15:43560434-43560456 GAACTGGCTGCGCTCAGGCCAGG - Intronic
1125938755 15:43659985-43660007 GAACTGGCTGCGCTCAGGCCAGG - Intronic
1127910271 15:63410896-63410918 GGCCAGGGTGAGCCCAGGACGGG - Intergenic
1128659146 15:69485073-69485095 CCACTGGGTGTGCCCTGCCCAGG + Intergenic
1128802839 15:70507870-70507892 GCCCTGGGTGAGCCCTGCCTTGG - Intergenic
1129283719 15:74506583-74506605 GCACTGTGGGAGGCCAGGGCAGG + Intergenic
1129299782 15:74618913-74618935 GAACTGGGTGAGCCAGGGCCAGG - Intronic
1129724293 15:77893779-77893801 GCTCTGGGAGGGCCAAGGCCGGG - Intergenic
1130217890 15:81989413-81989435 GAACTGGGGCATCCCAGGCCTGG - Intergenic
1130276206 15:82477504-82477526 CCACTGGGTGAGCCAGGGGCTGG + Intergenic
1130468565 15:84204897-84204919 CCACTGGGTGAGCCAGGGGCTGG + Intergenic
1130485188 15:84394865-84394887 CCACTGGGTGAGCCAGGGGCTGG - Intergenic
1130590858 15:85209496-85209518 CCACTGGGTGAGCCAGGGGCTGG + Intergenic
1130933531 15:88449662-88449684 GCCATGCGTGAGCACAGGCCTGG + Intergenic
1131188504 15:90294717-90294739 CCACTGGGTGAGCCAGGGGCTGG - Exonic
1132576737 16:667869-667891 GCAGAGGCTGAGCTCAGGCCAGG - Intronic
1132606463 16:795657-795679 GCAGGGGGTGAGCCAAGGCCTGG - Intronic
1132607828 16:800860-800882 CCGCTGGGTGAGCCCAGGGGAGG - Intergenic
1132622481 16:874405-874427 GCAGGGGGTGAGCTCAGGTCTGG - Intronic
1132631101 16:917851-917873 GCTCTGGGTGACCACAGGCCAGG - Intronic
1132665943 16:1081361-1081383 GCCCAGGCTGAGGCCAGGCCTGG + Intergenic
1132681991 16:1146218-1146240 GGATGGGGTGAGCCCAGGCCGGG - Intergenic
1132873056 16:2124143-2124165 GCAGAGGGTGTGGCCAGGCCTGG + Intronic
1133020908 16:2966609-2966631 AGACTGGGTGACCCCAGGGCAGG - Intronic
1133140889 16:3743185-3743207 GCACTGAGTGGGCAGAGGCCAGG + Intronic
1133725992 16:8538050-8538072 GCACTTTGTGAGGCCAGGGCAGG + Intergenic
1133767882 16:8850430-8850452 GCAGTGGGTGAGTGCAGGGCAGG + Intergenic
1133835147 16:9361278-9361300 GCTCTGTGTGGGTCCAGGCCTGG - Intergenic
1133989462 16:10693339-10693361 GCACTTTGTGAGGCCAGGGCAGG - Intronic
1134552144 16:15143322-15143344 GCAGAGGGTGTGGCCAGGCCTGG + Intergenic
1136051062 16:27650328-27650350 GCACTGGGGCAGAACAGGCCTGG + Intronic
1136473687 16:30498650-30498672 GCACTTTGGGAGCCCAAGCCGGG + Intronic
1136629026 16:31478477-31478499 GCACTGTGGGAGGCCAGGGCGGG + Intergenic
1137396069 16:48116901-48116923 TCACTGGCTCTGCCCAGGCCAGG - Intronic
1137564234 16:49523402-49523424 CCACTGGCTGAGCCCAGAGCAGG - Intronic
1137819987 16:51435081-51435103 CAGCTGGGTGACCCCAGGCCAGG - Intergenic
1138017939 16:53447889-53447911 GCACTGTGGGAGGCCAGGGCAGG - Intronic
1138330944 16:56214837-56214859 GCAGTGAGGGGGCCCAGGCCAGG - Intronic
1139373048 16:66480248-66480270 GCACTGGGTGTGCAGAGGCTGGG - Intronic
1139802166 16:69531734-69531756 GCACTGTGGGAGACCAGGGCGGG - Intergenic
1139993722 16:70961147-70961169 GCCCTGGAGGAGCCCAGGCATGG + Intronic
1140476984 16:75243989-75244011 GCACGGGGTGAGACAAGGCCAGG + Intronic
1140892831 16:79299458-79299480 GCACAGTTTGCGCCCAGGCCTGG - Intergenic
1141112416 16:81281153-81281175 GCAATGGGTGAGGCCAGGCACGG + Intronic
1141461810 16:84182269-84182291 GCACTGGGGGCGCGCTGGCCTGG - Exonic
1142269224 16:89080449-89080471 GCATGTGGTGACCCCAGGCCTGG - Intergenic
1142353348 16:89589784-89589806 AGACTGGGGGTGCCCAGGCCTGG - Intronic
1142842771 17:2646939-2646961 ACACTGGGTGAGGCCAGGCATGG + Intronic
1144495471 17:15742488-15742510 GCACAGGGAGACCCCAGCCCTGG + Intronic
1144581410 17:16461480-16461502 GCCCTGGGGGAGCCTAGACCTGG + Intronic
1144638755 17:16926393-16926415 GCACAGGGAGACCCCAGCCCAGG - Intergenic
1144726634 17:17505664-17505686 GCACTGGGGCAGCCCACGCCGGG + Exonic
1145270227 17:21400967-21400989 GCCTGGGGTGAGCCCAGGCTCGG + Intronic
1145316971 17:21740839-21740861 GCTCCAGGGGAGCCCAGGCCAGG + Intergenic
1146456077 17:33010891-33010913 TCACTGTGTGACCCTAGGCCAGG + Intergenic
1146612680 17:34321537-34321559 GAACTTGGTGGGACCAGGCCAGG + Intergenic
1146655678 17:34633390-34633412 GCCCTTGGTGTGCCCAGGCTGGG - Intronic
1147920510 17:43913775-43913797 GCACAGGGTGAGCCCAGGGTAGG - Intergenic
1147968506 17:44207063-44207085 GGGCTGGAGGAGCCCAGGCCAGG - Exonic
1148547637 17:48529839-48529861 CCACTGGGCGAGCCCAGGCCTGG + Exonic
1148630459 17:49104241-49104263 GCACTGTGTGAGGCCAAGGCGGG + Intergenic
1148688915 17:49515554-49515576 GCCCTGGGAGCTCCCAGGCCTGG - Intergenic
1148807444 17:50271107-50271129 GAAGTGGGTGGTCCCAGGCCAGG - Intergenic
1151219004 17:72597872-72597894 GCAATGGAAGAGCCCAGGCAGGG - Intergenic
1151382173 17:73733472-73733494 GCACTGAGTGAGGCCGGTCCTGG + Intergenic
1151517157 17:74604075-74604097 GCTCTGGGTGAGAGAAGGCCAGG - Intergenic
1151518263 17:74611355-74611377 GCTCAGGATGAGCTCAGGCCTGG + Exonic
1151595239 17:75074426-75074448 GCACTGGGGAAGCCTGGGCCTGG - Intergenic
1151685080 17:75641482-75641504 GCACAGGGAGAGCAGAGGCCTGG - Intronic
1151694479 17:75707188-75707210 GGACTGGGGCAGCCCTGGCCAGG - Exonic
1152008330 17:77696021-77696043 GCACTAGGGGAGCCCAGGAAGGG - Intergenic
1152293789 17:79455100-79455122 CCACGGGGTGTGCACAGGCCCGG + Intronic
1152335380 17:79697572-79697594 GCACTTGGTGAGGCCGAGCCGGG + Intergenic
1152433450 17:80261486-80261508 GCCCTGGGGGAGTCCAGGGCGGG + Intronic
1152599965 17:81257340-81257362 GCACTGTGGGAGGCCAGGGCAGG - Intronic
1154358643 18:13641740-13641762 GCGCTGGGTCAGCCGAGGGCCGG + Intronic
1154526243 18:15292956-15292978 GCACTGTGGGAGGCCAAGCCTGG - Intergenic
1155648113 18:28106168-28106190 GCACTTGGGGAGCCCAAGGCTGG + Intronic
1156290760 18:35747337-35747359 GCACTGGGAGATCCCCAGCCTGG + Intergenic
1156293641 18:35771406-35771428 GCACTTGCTGAGCCCAGGACAGG - Intergenic
1157234786 18:45954172-45954194 TCACTGGGCCAGCCCATGCCTGG - Intronic
1157235119 18:45957886-45957908 TCACTGGGTCAGCCCGTGCCTGG - Intronic
1157334806 18:46729916-46729938 GAACTGGAGGAGGCCAGGCCAGG + Intronic
1157359544 18:46964729-46964751 GCCCTGGGTGGGCCCGGGGCTGG - Intronic
1157361138 18:47024248-47024270 GCCCTGGGTGGGCCCGGGGCTGG - Intronic
1157362128 18:47030163-47030185 GCCCTGGGTGGGCCCGGGGCTGG - Intronic
1157625938 18:49051285-49051307 TCACCAGGTGAGCCCAGGCTGGG + Intronic
1158470987 18:57736704-57736726 GCACTTTGGGAGCCCAAGCCTGG - Intronic
1158636214 18:59160672-59160694 GCACTGGCTGAGCCCCGTCAGGG - Intergenic
1159222441 18:65482154-65482176 GCACTTTGGGAGCCCAGGGCAGG + Intergenic
1159314085 18:66748603-66748625 GCACTTTGGGAGCCCAGGGCAGG + Intergenic
1159531588 18:69662224-69662246 GCACTGCGGGAGACCAGGGCAGG - Intronic
1159612717 18:70544570-70544592 GCACTTTGGGAGCCCAGGGCGGG - Intergenic
1160342905 18:78104597-78104619 GCACAGGGTGCCCCCAGGGCCGG + Intergenic
1160488149 18:79312156-79312178 GCACTGGTTGAACCCAAGCAGGG - Intronic
1160787905 19:909936-909958 GCACTTTGTGAGCCCAAGGCAGG + Intronic
1160867277 19:1261461-1261483 GCACGGCGTGTGCCAAGGCCCGG + Intronic
1160871256 19:1278888-1278910 GCACTGGGTGAGACCAGCCCCGG - Exonic
1161265313 19:3360968-3360990 GAACTGGGGGAGGCGAGGCCGGG - Intronic
1161277168 19:3425003-3425025 GCACTGGCCCAGCCCAGGACTGG + Intronic
1161301832 19:3546457-3546479 CCACTGGGTGCCCCCAAGCCTGG + Intronic
1161315085 19:3614011-3614033 GCGCTGGGAGGGCGCAGGCCTGG + Intronic
1161409346 19:4108188-4108210 GCATTGGGTGAGCCCTGACAGGG - Intronic
1161478293 19:4498266-4498288 GCACCGTGTGGGCCCAGGCAGGG - Intronic
1161572922 19:5040188-5040210 GGTGTGGGTCAGCCCAGGCCGGG - Intronic
1161688062 19:5713426-5713448 CCACTGGGGCAGCCCTGGCCTGG - Intronic
1161724265 19:5919271-5919293 CCACGGGGTGGGCCCAGGCCAGG - Intronic
1162071487 19:8154952-8154974 GCGCTGGGCCAGCCTAGGCCAGG + Intronic
1162238541 19:9327537-9327559 CCACTGGGTGAGGCCAGGCGCGG - Intronic
1162939607 19:14000846-14000868 GCACTTTGAGAGCCCAGGGCAGG + Intronic
1163105731 19:15122198-15122220 GAAGTGGCAGAGCCCAGGCCGGG - Intronic
1163497453 19:17655125-17655147 GCACTGGGCATGCCCAGGCTAGG + Intronic
1165138262 19:33684352-33684374 GGCCTGGGTGTGCCAAGGCCCGG + Intronic
1165351253 19:35277220-35277242 GCACTCGCTGAGCCCAGTGCAGG + Intronic
1165937001 19:39395468-39395490 GCCCTGGTGGAGCCCAGTCCAGG - Intronic
1166368141 19:42287464-42287486 CCACGGGGTGAGCACAGGACAGG - Intronic
1166423165 19:42653792-42653814 AGGCTGGGTGAGCCCAGCCCTGG - Intronic
1166774650 19:45304974-45304996 GCACTGGGGGAGCCATGGCAAGG + Intronic
1167001059 19:46746084-46746106 GCAGCGGGTGAGGCCGGGCCGGG + Exonic
1167611160 19:50508283-50508305 TCACTGGGGGAGCCCAGACAGGG - Intronic
1168508372 19:56955086-56955108 GGAATGGGTCAGCCCAGGCGAGG + Intergenic
1168689707 19:58369104-58369126 CCTCGGGGTGAGCCCCGGCCCGG - Exonic
1168719954 19:58549436-58549458 CCACTAGGTGAGGCCAGGCGGGG - Exonic
925874245 2:8298436-8298458 GCACTGGGTGAGACAATGACAGG + Intergenic
925905247 2:8536250-8536272 CTGCTGGGTGAGCCCAAGCCCGG - Intergenic
926112025 2:10189570-10189592 GGTCTGGGGGAGCTCAGGCCAGG + Intronic
926210086 2:10862968-10862990 CCACTGGGGGAGACCAAGCCAGG - Intergenic
926746168 2:16160121-16160143 GCAGTGGAAGAGCCCAGCCCTGG - Intergenic
927382930 2:22499737-22499759 GCCCTGGGTCAGCCAAGGCAGGG + Intergenic
927499523 2:23573468-23573490 GCTCTGGGTAGGCCCAGTCCAGG + Intronic
928600647 2:32900763-32900785 GGACAGGGTGAGCCGAGGCATGG + Intergenic
929760779 2:44804636-44804658 GGAATGGCTGAGCCCTGGCCTGG - Intergenic
929868237 2:45736373-45736395 GCTCTGGGTGAGAGCAGGGCTGG + Intronic
930311464 2:49745692-49745714 ACACTAGGTCAGCCCAGGCATGG - Intergenic
932104966 2:68933782-68933804 GCGCTGGGTGGGCCCAGGTCTGG + Intergenic
933612504 2:84451832-84451854 GGTCTGTATGAGCCCAGGCCTGG - Intronic
934694353 2:96388441-96388463 GCACTTTGTGAGGCCAGGGCGGG - Intergenic
934713143 2:96528437-96528459 GCACGGGGTGGGCCCAGGCTGGG - Intergenic
934900311 2:98154631-98154653 GCACTGGCTGACCCAAGCCCTGG - Intronic
935136179 2:100304875-100304897 GCACTTGGTGAGGCCAAGGCAGG - Intronic
935653314 2:105399768-105399790 GCACAGGTTGAGCCCATCCCTGG + Intronic
935664173 2:105495716-105495738 GCACTTGGTGAGGCCAAGACAGG - Intergenic
936099188 2:109560208-109560230 GCAGTGGTTGGGGCCAGGCCCGG - Intronic
936249946 2:110860545-110860567 GCAATGTCTCAGCCCAGGCCAGG - Intronic
937122466 2:119450370-119450392 GGACTCGGAGAGCCCAGCCCAGG - Intronic
937340280 2:121086761-121086783 GCACTGGCTGTGCCCAGGCTGGG - Intergenic
937667663 2:124504950-124504972 GCACTGTGAGAGCCCAAGGCGGG - Intronic
938364858 2:130726804-130726826 GCACTGGGTGACCCCACATCTGG + Intergenic
938711599 2:133980049-133980071 GCACGGGATGGGCCCAAGCCAGG - Intergenic
942892546 2:181008743-181008765 GCACTGGGTGTGCCTAAGTCAGG + Intronic
943988991 2:194661333-194661355 GCACTTTGGGAGGCCAGGCCGGG - Intergenic
944363227 2:198883866-198883888 GCTCTGGCTGAGCCAGGGCCTGG - Intergenic
944735255 2:202557082-202557104 GCACTTTGTGAGGCCAGGGCAGG + Intronic
945245654 2:207714382-207714404 GGACTGCTTGAGCCCAGGCCAGG - Intronic
945395254 2:209307922-209307944 GCAGTGGGCGAGGCAAGGCCGGG - Intergenic
946366686 2:219253208-219253230 GCACTGCGCGGGCCGAGGCCAGG - Intronic
946398176 2:219453893-219453915 GCAAGGGGTGGTCCCAGGCCTGG + Intronic
947992207 2:234496860-234496882 CCACAGAGCGAGCCCAGGCCTGG - Exonic
948202113 2:236136639-236136661 GCCCTGTGCGAGCCCAGGCTGGG - Intergenic
948467673 2:238159976-238159998 ACTCTGGGGGACCCCAGGCCTGG - Intronic
948482636 2:238259775-238259797 GCACTGGCTGAGTGCAGGACTGG + Intronic
948840676 2:240647325-240647347 GCATTGAGTGCGCCCAGGGCAGG - Intergenic
948846581 2:240685713-240685735 CCTCTGGCAGAGCCCAGGCCGGG + Intergenic
948847280 2:240689021-240689043 CCTCTGGCAGAGCCCAGGCCGGG - Intergenic
948862010 2:240757210-240757232 GCCCTGGGAGGGCCCGGGCCAGG + Intronic
948862803 2:240761053-240761075 GCAGTGAGGGAGCCCAGACCTGG - Intronic
1168769423 20:405737-405759 GCACTTGGGGAGGCCAAGCCAGG - Intergenic
1169120838 20:3094769-3094791 GAAGTGGGTGGTCCCAGGCCTGG + Intergenic
1169558777 20:6776379-6776401 GCTCTGGGTGGGCCCAGCCAGGG - Intronic
1170210956 20:13845970-13845992 GCACTTTGGGAGCCCAAGCCGGG + Intergenic
1170781277 20:19427693-19427715 TCTCTGGGTCAGCCCAGGACAGG - Intronic
1171492617 20:25532049-25532071 GCTCTGTGTGTGGCCAGGCCTGG + Intronic
1172620897 20:36317929-36317951 GCCCTGGGTGTGCCCAGCCTGGG + Intronic
1172795498 20:37534410-37534432 GCACTGTGGGAGCCCTGGCAGGG + Intergenic
1172915591 20:38441007-38441029 GCACTGGGGGAGGCCAAGGCAGG + Intergenic
1173805917 20:45925311-45925333 GCACAGCGTGTGCCAAGGCCTGG - Intergenic
1173965698 20:47110888-47110910 GCTCTAGGTGAGGCCAGGCTAGG - Intronic
1174612359 20:51808733-51808755 GGACTGCTTGAGCCCAGCCCAGG + Intergenic
1175238547 20:57529208-57529230 GCACTGGGGGAACCCATGGCTGG - Intergenic
1175812354 20:61865076-61865098 GCACAGGGAGAGGCCAGGCAGGG - Intronic
1176183945 20:63767790-63767812 GCACTGGCTGCCCCCAGGGCTGG + Intronic
1176194090 20:63829172-63829194 GCACTGGGTCAGCCTGGCCCTGG + Intronic
1176771181 21:13075538-13075560 GCACTGTGGGAGGCCAAGCCTGG + Intergenic
1178076417 21:29017115-29017137 GCACTTTGGGAGCCCAGGGCGGG - Intronic
1178966507 21:37124361-37124383 GCACTTTGGGAGCCCAGGGCAGG - Intronic
1179083063 21:38191390-38191412 TCTCTTGGTGAGCCCATGCCTGG + Intronic
1179532780 21:42031707-42031729 GACCTGGGTGAGCCCAGACCCGG + Intergenic
1179798228 21:43798136-43798158 GCACTGGCTCAGCCCAGGACAGG - Intronic
1179815690 21:43904633-43904655 TCACTGGGTGGGCCCAGGGTTGG + Intronic
1179903102 21:44405309-44405331 GCAGGGGATGAGCACAGGCCGGG + Intronic
1180723778 22:17929347-17929369 GCACTTGGAGAGACCAGGACAGG - Intronic
1181027116 22:20132624-20132646 GCCCTGGGTGTGGCCTGGCCTGG - Intronic
1181043517 22:20204021-20204043 GGACAGGGTGACTCCAGGCCTGG - Intergenic
1181053601 22:20249019-20249041 GCACTGGCTGTGCCCTGGGCTGG - Intronic
1181433803 22:22898885-22898907 TCAGTGGGGGATCCCAGGCCTGG - Intergenic
1181434745 22:22904254-22904276 TCAGTGGGGGATCCCAGGCCTGG - Intergenic
1181812230 22:25410445-25410467 ACACTGTGGGAGGCCAGGCCAGG - Intergenic
1182285283 22:29243483-29243505 CCACTGGGTAAGCTCTGGCCTGG + Exonic
1182349404 22:29690758-29690780 GCAGCGGGTCAGCCCATGCCTGG + Intronic
1182442541 22:30372693-30372715 GCAGAGGGTGAGCCAGGGCCCGG + Intronic
1182698355 22:32211561-32211583 TCAGTGGGGGATCCCAGGCCTGG - Intergenic
1182712815 22:32333219-32333241 GGACTGGGTGAGGGCAGGACTGG - Intergenic
1183061296 22:35337906-35337928 GCAGTGGGGGTGCCCAGGGCAGG - Intronic
1183313931 22:37127045-37127067 GCAGTGGGAGGTCCCAGGCCTGG + Exonic
1183404452 22:37623627-37623649 GCCTTAGGTGAGCCCAGGGCAGG + Exonic
1183585471 22:38750746-38750768 GCCCTGGGTGCGCCCCAGCCTGG - Intronic
1184239897 22:43206552-43206574 GCAAAGGGTGTGCCCAGGTCAGG + Intronic
1184458613 22:44625082-44625104 CCTCTGTGTGTGCCCAGGCCAGG - Intergenic
1185222838 22:49637498-49637520 GCCCCGGGTGAGGCCAGGCCTGG + Intronic
1185253908 22:49821198-49821220 GCTCTGGGAGAGGCCGGGCCTGG - Intronic
1185351499 22:50342037-50342059 GCACTGGCTGAGCACAGGAGGGG + Intergenic
950110113 3:10413341-10413363 CCACTGGGGGAGCCCAGGGATGG + Intronic
950479745 3:13236963-13236985 GCACTGGGTGGCCCCACACCTGG + Intergenic
950939925 3:16883348-16883370 GAGGTGGGTGGGCCCAGGCCTGG + Intronic
951559341 3:23949959-23949981 CCACTGGGTAAGCCCTAGCCTGG + Intronic
952006202 3:28845190-28845212 GGGCGGGGTGAGCCCAGGGCAGG - Intergenic
952931746 3:38365896-38365918 GCCCTGTGTGTTCCCAGGCCAGG + Intronic
953607367 3:44420600-44420622 TCACTCTGTGTGCCCAGGCCAGG + Intergenic
954559870 3:51547826-51547848 GCACTTGGTGAGGCCAAGGCGGG - Intronic
955239569 3:57166868-57166890 GCAGTGGCTGAGCTTAGGCCAGG - Intronic
956748657 3:72329396-72329418 GAACTGGCAGACCCCAGGCCTGG - Intergenic
958592505 3:96175684-96175706 GCACTGGCTCAGCCCACGCCTGG - Intergenic
958715882 3:97779618-97779640 GCACTTTGGGAGCCCAGGGCGGG + Intronic
961324705 3:126103306-126103328 GAGCTGGGTGAGCCCTGGACTGG - Intergenic
961371333 3:126433746-126433768 GCACTGGCTGTGCCCAGGCTGGG + Intronic
961378967 3:126484863-126484885 ACACTGGGAGTGCTCAGGCCTGG - Intronic
961827739 3:129607461-129607483 GCACCGGGGGAGCGAAGGCCTGG - Intergenic
962234063 3:133692947-133692969 GGGCTGGGTGTGCCCAGGCAGGG + Intergenic
962264935 3:133938061-133938083 GCAGCGGCTGAGCCCAGCCCTGG - Intronic
962986119 3:140537606-140537628 GCACTGGGTGAGCTCAGCCATGG - Intronic
963043308 3:141084542-141084564 ACACTTGGTGATCCCAGCCCGGG + Intronic
963501852 3:146137493-146137515 GCACTTGGGGAGCCCAAGGCAGG - Intronic
963921956 3:150914367-150914389 GCTCTGGGTCAACCCAGGCCTGG + Intronic
964441174 3:156711999-156712021 GCACTGTGGGAGGCCAAGCCAGG - Intergenic
965601446 3:170458572-170458594 TCAGTGGGCCAGCCCAGGCCTGG + Intronic
966853419 3:184178043-184178065 GGACTGGGCAAGCCAAGGCCAGG + Intronic
967997155 3:195175304-195175326 GCACTGGCTGAGCACCAGCCCGG + Intronic
968452000 4:680272-680294 GCCCAGGGTCAGCCCAGGCCTGG - Intronic
968564697 4:1305288-1305310 GCACTAGGTGAGCCCGGCCCTGG + Intronic
968778918 4:2564327-2564349 GCACTTGGTGAGGCCAAGGCAGG - Intronic
968923156 4:3532926-3532948 GCCGTGGGTAAGCCCAGGCCAGG + Intergenic
969474374 4:7412835-7412857 GCCCTGGGAGAGCCCAGGGGTGG - Intronic
969717985 4:8877633-8877655 ACAATGAGTGAGCCCAGGCAGGG - Intergenic
969744170 4:9056619-9056641 GCACTGTGTGAGGCCAAGGCGGG + Intergenic
974743009 4:66031997-66032019 GCACTTAGTGAGCCCAAGACAGG - Intergenic
975568320 4:75784566-75784588 GCACTTGGGGAGCCCAAGGCAGG + Intronic
975612222 4:76214022-76214044 GCGCTGGGAGCGGCCAGGCCGGG - Intronic
977554609 4:98476126-98476148 GCCCTGGGAGAGCCCTTGCCAGG - Intronic
978730277 4:112018404-112018426 GCACTGTGGGAGCCCAAGGCGGG + Intergenic
979636983 4:122967154-122967176 GCACTTTGGGAGGCCAGGCCAGG + Intronic
980944168 4:139302335-139302357 TCATTGGGTGACCCCGGGCCGGG - Intronic
983491716 4:168397763-168397785 GCAGTGGGAGAGGCAAGGCCAGG + Intronic
983871344 4:172828023-172828045 GCACTGTGGGAGGCCAAGCCAGG + Intronic
984261840 4:177452136-177452158 GCACTTTGTGAGGCCAGACCAGG + Intergenic
984795877 4:183659441-183659463 GGCCTGGGTGAGTCCGGGCCCGG + Exonic
984864692 4:184271705-184271727 GCCCTTGGTGAGGCCAGGCATGG + Intergenic
985556388 5:560418-560440 GCTCTGGGTGAGGCCTTGCCGGG - Intergenic
986070417 5:4277723-4277745 GCACTGGGTGGGCAGAGGCTGGG - Intergenic
986154866 5:5164611-5164633 GGACACGGTGAGCCCAGGGCTGG - Intronic
986541709 5:8851284-8851306 CCACTGGGTGGCCCCAGCCCTGG + Intergenic
986561071 5:9061402-9061424 GCCATGAGTGAGACCAGGCCAGG + Intronic
987098849 5:14574781-14574803 GCACTTGGTGAGGCCAAGGCAGG - Intergenic
987112524 5:14701076-14701098 GCCCTGGCTGAGCCCAGGAAGGG - Intergenic
988201835 5:28078084-28078106 GCACTGGGGGAGCCCCTTCCTGG - Intergenic
990047751 5:51455937-51455959 GCACTGGGCCAGCCCAGGCAGGG - Intergenic
990468928 5:56095403-56095425 GCAATGGGCAAGCCAAGGCCTGG - Intergenic
993502072 5:88675853-88675875 GCAGTAGCCGAGCCCAGGCCGGG - Intergenic
994892465 5:105654838-105654860 GCACTTGGGGAGGCCAGGGCAGG + Intergenic
995201258 5:109427324-109427346 GCACTTTGGGAGGCCAGGCCTGG + Intergenic
997332056 5:133071211-133071233 GCACTGTGGGAGGCCAGGGCAGG + Intronic
997612799 5:135226935-135226957 GCTGTGGGTGAGCCTAAGCCTGG - Intronic
997646391 5:135484880-135484902 GCCCTTGTGGAGCCCAGGCCTGG + Intergenic
998544182 5:143012047-143012069 CCAATGGGGAAGCCCAGGCCAGG + Intronic
998849329 5:146338780-146338802 GGACTGGGAGAGGCCAGGCCAGG + Intronic
999329095 5:150660674-150660696 GCTCTGGGAGAGCCCAGGGGAGG - Intergenic
1001962437 5:175887754-175887776 CCTCTGGGTGAGCTCAGGCAGGG + Intergenic
1002051794 5:176575586-176575608 GAACGGGGTGTCCCCAGGCCAGG + Intronic
1002299225 5:178248084-178248106 GCCCTGGGTTTGCTCAGGCCAGG + Intronic
1002326941 5:178415865-178415887 GTACTGGGTGAGGCCAGGGAGGG + Intronic
1002473246 5:179450097-179450119 GCAAGGGGAGGGCCCAGGCCGGG + Intergenic
1003053170 6:2797821-2797843 GCCTTGGGTGAGATCAGGCCAGG - Intergenic
1003918148 6:10806737-10806759 GCACTGTGGGAGGCCAGGACGGG - Intronic
1004294492 6:14397810-14397832 GCCCAGGATGAGCCCAGGTCGGG - Intergenic
1004697954 6:18051629-18051651 GCACTTGGGGAGGCCAGGGCGGG - Intergenic
1005370109 6:25123578-25123600 GCATTGGGTGAGGCCAGGCATGG - Intergenic
1005850489 6:29817176-29817198 ACCATGGGTCAGCCCAGGCCTGG + Intergenic
1005863095 6:29916436-29916458 ACCATGGGTCAGCCCAGGCCTGG + Intergenic
1005874675 6:30001946-30001968 ACCATGGGTCAGCCCAGGCCTGG + Intergenic
1006066318 6:31464823-31464845 CCCATGGGTCAGCCCAGGCCGGG - Intergenic
1006153565 6:32002056-32002078 GTGCAGGGTGAGCCCAGGCTGGG - Intronic
1006159873 6:32034793-32034815 GTGCAGGGTGAGCCCAGGCTGGG - Intronic
1006164108 6:32054371-32054393 TCCCTGGGAGACCCCAGGCCTGG + Intronic
1006164734 6:32057569-32057591 TCCCTGGGAGACCCCAGGCCTGG + Intronic
1006929793 6:37680816-37680838 GCAGCGGGTGAGCGCACGCCTGG + Intronic
1007502943 6:42312597-42312619 GCGCTGGGTGTGCCGAGGTCTGG + Intronic
1007576933 6:42931134-42931156 GCACTGTGGGAGCCCAAGGCAGG - Intronic
1007581166 6:42960967-42960989 GCACTGGGTGAGCCCAGGCCGGG + Exonic
1007748409 6:44057159-44057181 GCTCTGGTTGGGCCCAGGCAAGG - Intergenic
1007901808 6:45420342-45420364 CCACTCGCTGAGCCCACGCCCGG - Intronic
1014485418 6:121993542-121993564 GCACTGGCTCAGCCCATGGCTGG + Intergenic
1017452900 6:154570898-154570920 GCACTGTGGGAGGCCAAGCCAGG + Intergenic
1017774853 6:157672838-157672860 GCGCAGGGCGTGCCCAGGCCAGG - Exonic
1017810809 6:157982082-157982104 ACGCTGGGTGAGTCCGGGCCGGG + Exonic
1018250468 6:161864898-161864920 GCACTTTGTGAGGCCAGGGCAGG - Intronic
1018394206 6:163364918-163364940 GAGCAGGGTGAGCCCAAGCCTGG + Intergenic
1019017234 6:168888637-168888659 GGACAGGGAGATCCCAGGCCAGG + Intergenic
1019335526 7:480861-480883 GGACTGGGTGAGCTCAGCCTGGG - Intergenic
1019351040 7:554083-554105 GCACTGGCTCAGGCCAGACCCGG + Intronic
1019563338 7:1668399-1668421 GCACTTGGCCAGCACAGGCCTGG + Intergenic
1019666455 7:2254400-2254422 ACCCTGTGTGTGCCCAGGCCTGG - Exonic
1019701999 7:2478535-2478557 GGGCTGTGTGAGCCCAGTCCGGG + Intergenic
1019825378 7:3280000-3280022 GCACTAGGGGATCCCAGGACTGG - Intergenic
1019938861 7:4273666-4273688 GGAGTGAGAGAGCCCAGGCCAGG - Intergenic
1020091982 7:5346777-5346799 CCACTGGCTCAGCCAAGGCCGGG + Intronic
1021488617 7:21193985-21194007 GGACTGCTTCAGCCCAGGCCAGG + Intergenic
1022419809 7:30209849-30209871 GCAAAGGGTGAGCCCATGCATGG + Intergenic
1022426289 7:30271889-30271911 GCACTTTGGGAGGCCAGGCCAGG + Intergenic
1022530712 7:31065301-31065323 GCACTTGGTCAACCCAGGGCAGG + Intronic
1024627864 7:51223716-51223738 GCTATGTGTGTGCCCAGGCCTGG - Intronic
1024631827 7:51255558-51255580 TCCATGGGTGAACCCAGGCCTGG - Intronic
1025149994 7:56540256-56540278 GCAGAGGGAGATCCCAGGCCAGG - Intergenic
1025728175 7:64087223-64087245 GCCCTGGGTGAGGCCAGCCTAGG + Intronic
1025757293 7:64357114-64357136 GCCCTGGGTGAGGCCAGCCAAGG + Intergenic
1025938029 7:66052606-66052628 GCACTGTGGGAGGCCAGGGCGGG + Intergenic
1026776176 7:73232263-73232285 GCACTTTGGGAGCCCAGGGCAGG + Intergenic
1026806679 7:73433639-73433661 GCACGGGGTGGGGCCGGGCCTGG - Intergenic
1027017029 7:74785634-74785656 GCACTTTGGGAGCCCAGGACAGG + Intronic
1027070995 7:75160302-75160324 GCACTTTGGGAGCCCAGGACAGG - Intergenic
1027246512 7:76371255-76371277 GCACTTTGGGAGCCCAGGGCGGG - Intergenic
1027503603 7:78986631-78986653 GCACTCTGTGAGCCCAAGGCAGG - Intronic
1029133552 7:98351803-98351825 GCAGTGAGTGAGCCGATGCCAGG + Intronic
1029421474 7:100474121-100474143 GCAGTGGCTATGCCCAGGCCAGG + Intronic
1029813433 7:103071639-103071661 GCACTGTGAGAGCCCAAGGCAGG - Intronic
1029954386 7:104622193-104622215 GGACTGGCTGAGCCCAAGCCTGG - Intronic
1030038113 7:105425261-105425283 GCACTTTGGGAGGCCAGGCCAGG + Intergenic
1030038581 7:105429780-105429802 GCACTGTGTGAGGCCAAGGCAGG - Intergenic
1030293095 7:107891425-107891447 GCACTGGCTCAGCCCGGCCCTGG + Intronic
1032332117 7:130990349-130990371 GCACTTGGGGAGGCCAGGGCGGG - Intergenic
1033714613 7:143986715-143986737 CCACTGGTAGATCCCAGGCCAGG - Intergenic
1034986126 7:155516607-155516629 GCACTGGGTGTGCCCCAGGCTGG - Intronic
1035019761 7:155793997-155794019 CCACTGGGTGTGCCCAGCCAGGG + Intergenic
1035302476 7:157906524-157906546 CCACTGGGAGAGCCCAGTCCGGG - Intronic
1035679730 8:1479095-1479117 GAGCAGGGTGAGCCCAGGCAGGG + Intergenic
1035818954 8:2571050-2571072 GCACTGTGTGAGGCCAAGGCGGG - Intergenic
1036823453 8:11957725-11957747 GCACTGGGTGAGGCCGTCCCAGG - Intergenic
1037746247 8:21647175-21647197 ACTCTGTGAGAGCCCAGGCCAGG - Intergenic
1038646426 8:29365908-29365930 ACACTGGGTCTGCCCAGGCAGGG + Intergenic
1042141303 8:65681205-65681227 GAACTGCTTGAACCCAGGCCGGG - Intronic
1042203424 8:66304121-66304143 GAACTGAGTGAGCTCAGGCAGGG - Intergenic
1042615775 8:70647497-70647519 GCACTTTGTGAGGCCAGGGCAGG - Intronic
1044713461 8:95078395-95078417 GCACTTTGTGAGGCCAGGGCAGG + Intronic
1047477452 8:125247476-125247498 GCACTTGGGGAGCCCAAGGCCGG + Intronic
1047795728 8:128253512-128253534 GCACTTTGTGAGGCCAAGCCAGG - Intergenic
1048311229 8:133323810-133323832 GCATTGAGTCAGCTCAGGCCTGG + Intergenic
1048512407 8:135074828-135074850 GCACTGGTTGTGCCCAGGCAGGG + Intergenic
1048573992 8:135676735-135676757 ACACTGGGTGAGCTGAGGCCTGG + Intergenic
1049272549 8:141703646-141703668 GCAGTGAGTGTGCACAGGCCGGG - Intergenic
1049309689 8:141927104-141927126 GTTCTGGGGGAGCCAAGGCCAGG - Intergenic
1049379832 8:142306464-142306486 TCACTGGCTGAGCCCAAGCTGGG + Intronic
1049408442 8:142461911-142461933 TCCCGGGGTGAGCCCAGTCCTGG - Intronic
1049574924 8:143385571-143385593 GCATGGGGTGTGTCCAGGCCGGG - Intergenic
1049622180 8:143603513-143603535 GCACTAGGTGAGCTCAGCTCGGG - Intergenic
1049692818 8:143970020-143970042 GCACTGGGCAGGCCCAGGGCTGG - Intronic
1049710493 8:144060898-144060920 ACGCTAGGCGAGCCCAGGCCCGG - Intronic
1049766903 8:144359098-144359120 GAACTGGGGGAGCCCCGGGCAGG - Intronic
1049777442 8:144413221-144413243 GAGCTGGGTGAGCGCAGGCGGGG - Exonic
1049805423 8:144536631-144536653 GTCCTGGGTGAGGCCAGGCTGGG + Intronic
1049980662 9:901261-901283 GCACTGTGGGAGGCCAGGGCAGG - Intronic
1051018767 9:12514976-12514998 GCACTTTGTGAGGCCAAGCCGGG - Intergenic
1051331226 9:16026613-16026635 GCCCTGTGGGAGCCCAGGACTGG - Intronic
1051724785 9:20078012-20078034 GCACAGGGTGGGCACAGGGCTGG + Intergenic
1055050695 9:71977103-71977125 GAGGTGGGTGAGCCCAGGGCTGG - Intronic
1055799300 9:80015465-80015487 GCACTTGTTGAGCCCTGGCATGG - Intergenic
1056313687 9:85368488-85368510 GGATTGGGTCAGCCCAGACCAGG - Intergenic
1057220447 9:93254972-93254994 GCCCAGTGGGAGCCCAGGCCAGG - Intronic
1057480608 9:95442225-95442247 TCTGTGGGTGAGCCCAGGCCAGG - Intergenic
1057702916 9:97376537-97376559 TAGCTGGGTGACCCCAGGCCAGG + Intronic
1058785760 9:108385155-108385177 GCACTGGGTGACCAGACGCCTGG + Intergenic
1058842193 9:108920612-108920634 GCACTAGGAGAGCCCAGGCAGGG + Intronic
1059179488 9:112198368-112198390 GAACTGTGTGATCCTAGGCCAGG - Intergenic
1059812955 9:117876942-117876964 GCACTTGGGGAGGCCAAGCCGGG + Intergenic
1060827176 9:126693905-126693927 GGGCTGGGTGAGCCTGGGCCAGG + Intronic
1061092784 9:128435899-128435921 GCTCTAGGTGAGGCCAGGGCGGG + Exonic
1061379193 9:130243942-130243964 GCTCTGGGTGTGCCCGGGCTGGG - Intergenic
1061853870 9:133430904-133430926 GCACTTTGTGAGGCCAGGGCGGG - Intronic
1061877419 9:133551407-133551429 GCCCTGGGTGTGCCTAGTCCTGG + Intronic
1062083855 9:134638493-134638515 GGCCTGGGTGAGCCACGGCCTGG - Intergenic
1062147396 9:134997237-134997259 GCAGGGGCTGAGCTCAGGCCTGG + Intergenic
1062160260 9:135075908-135075930 GCACTTCGGGCGCCCAGGCCGGG - Intronic
1062261868 9:135666845-135666867 GCAGTGGCTGAGCCCAGGGAGGG - Intergenic
1062345595 9:136113175-136113197 GGATTGTTTGAGCCCAGGCCGGG - Intergenic
1062571182 9:137186105-137186127 GGCCTGGGTGGGCCCAGACCGGG - Intronic
1185480822 X:444941-444963 GGAGTGGGGGACCCCAGGCCAGG - Intergenic
1185948249 X:4401742-4401764 GCACTGGCTCAGCCCATGGCTGG - Intergenic
1186718674 X:12279693-12279715 GTCCTGGGTCAGCCCAGGCCTGG + Intronic
1187051477 X:15700792-15700814 GCACTCAGTGAGTCGAGGCCAGG - Intronic
1188846206 X:35075968-35075990 GCACTGGGTCACCCAAGGCCTGG + Intergenic
1189226892 X:39420545-39420567 GTCCTGGGAGAGCCCAGGGCAGG - Intergenic
1189543798 X:42020876-42020898 GCACTGTGTGAGGCCAAGGCAGG - Intergenic
1189725399 X:43963898-43963920 CCTCTGGGTCAGCCCAGGCTTGG - Intronic
1190304683 X:49075291-49075313 GCACTGGCTAAGCCCAGGTATGG + Intronic
1190739913 X:53281765-53281787 GCACTGAGGGAGCCCAGCCTGGG - Intronic
1190876554 X:54464377-54464399 GCACTTTGGGAGGCCAGGCCGGG - Intronic
1191843815 X:65531699-65531721 GCACTTTGGGAGCCCAGGGCAGG + Intronic
1191991192 X:67038806-67038828 GCAGTGAGTGCTCCCAGGCCTGG + Intergenic
1195324030 X:103743593-103743615 GCCCTGGGTGAGGCCGGGCGCGG - Intergenic
1197375889 X:125681806-125681828 GCACTGGCTGAGCCCAGCACAGG - Intergenic
1197775229 X:130114446-130114468 CTGCTGGGTGAGCCCAAGCCAGG + Intergenic
1198169430 X:134091199-134091221 GCACTTGGGGAGGCCAAGCCAGG - Intergenic
1198773007 X:140150732-140150754 GCATTGGCTGGCCCCAGGCCTGG + Intergenic
1199695171 X:150338818-150338840 ACACTGTGGGAGCCCAGGCAAGG - Intergenic
1201735604 Y:17257120-17257142 GCACTGGCTCAGCCCATGGCTGG - Intergenic
1202372927 Y:24210425-24210447 CCACTGGGTGAGCCAGGGGCTGG + Intergenic
1202497855 Y:25459695-25459717 CCACTGGGTGAGCCAGGGGCTGG - Intergenic