ID: 1007581167

View in Genome Browser
Species Human (GRCh38)
Location 6:42960968-42960990
Sequence CACTGGGTGAGCCCAGGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581159_1007581167 4 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581167 6:42960968-42960990 CACTGGGTGAGCCCAGGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 269
1007581158_1007581167 16 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581167 6:42960968-42960990 CACTGGGTGAGCCCAGGCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581167 Original CRISPR CACTGGGTGAGCCCAGGCCG GGG Exonic
900140320 1:1137040-1137062 AGCTGGGGGAGCCCAGGGCGGGG + Intergenic
900229986 1:1551817-1551839 CATGGGGTGAGCACAGGCCTCGG - Intronic
901390652 1:8943747-8943769 GACTGGATGAGCCCAGGCGAGGG - Intergenic
901462529 1:9400196-9400218 CTCTGGCTAAGCCCAAGCCGAGG - Intergenic
902597654 1:17520301-17520323 CTCTGTGTGGGCCCAGCCCGGGG + Intergenic
903818765 1:26084805-26084827 CATTGGTTGAGCCCAGGAAGCGG + Intergenic
904285380 1:29450295-29450317 CTCTGGGGGAGCCCAGCCCAGGG + Intergenic
904501431 1:30915027-30915049 CATTGGCAGAGCCCAGGCCCAGG + Intergenic
905198979 1:36303826-36303848 AAGTGGGTGAGCCGGGGCCGGGG + Exonic
906209751 1:44006003-44006025 CCCTGGGTGGGCCCAGGGCTGGG + Intronic
906242541 1:44250889-44250911 CAGCGGGAGAGCCCAGGCTGAGG - Intronic
907466643 1:54642165-54642187 CCCTGGGTGAGGGCAGGCTGGGG - Intronic
910361272 1:86415488-86415510 CACTGGGTGAGCCCACAACAGGG + Intergenic
915148220 1:153808221-153808243 CACTGGGGGAGCCCAGACACTGG + Exonic
915359859 1:155279359-155279381 CTCTGGCTGAGCACAGGCAGAGG - Intronic
916642634 1:166747377-166747399 CAGTGGGTGAGCACATGCCATGG - Intergenic
917438637 1:175045762-175045784 CACTGGCGGAGCCCGGGCCATGG - Intergenic
919786126 1:201259765-201259787 CTCTGGGCGAGGCCAGGCCTGGG - Intergenic
920350816 1:205336798-205336820 CACTTGGACAGCCCAGGCCATGG - Exonic
920443482 1:205997894-205997916 CACTGGCTGAGCCCCTGCAGTGG + Intronic
922186262 1:223277521-223277543 CCCTGGGTGTGCCCAGGCATAGG + Intronic
922785791 1:228281703-228281725 CCCTGGGAGAGGCCAGGCCCTGG - Intronic
922958330 1:229624554-229624576 GACTGCTTGAGCCCAGGCCTGGG + Intronic
923149553 1:231220961-231220983 TACTGGGTGAGACCCAGCCGGGG + Intronic
924937951 1:248788330-248788352 CGGTGGGTGATCCCAGGCTGGGG - Intergenic
1064666471 10:17657116-17657138 GAGTGAGTGAGCCCAGGCAGGGG - Intronic
1065818885 10:29507023-29507045 CAGTGGCTCAGCCCAGGCTGGGG + Intronic
1069712723 10:70500310-70500332 CACTAGGTGGACACAGGCCGTGG + Intronic
1071470753 10:85982569-85982591 CCCATGGTGAGCCCAGCCCGTGG + Intronic
1073447885 10:103591991-103592013 GGCTGGGAGAGCCCAGGCCAGGG - Exonic
1074038877 10:109768500-109768522 CACTTGGGGAGGCCAGGCCTGGG - Intergenic
1074156666 10:110805980-110806002 AACTGCCTGAGGCCAGGCCGTGG + Intronic
1076352334 10:129825864-129825886 CCCTGGCAGAGTCCAGGCCGGGG + Intergenic
1077313221 11:1902370-1902392 CCCACGCTGAGCCCAGGCCGAGG - Intergenic
1077339085 11:2018070-2018092 CGCAGGGTGAGCCAAGGCCAGGG + Intergenic
1077413706 11:2414890-2414912 GCCATGGTGAGCCCAGGCCGCGG - Exonic
1077635816 11:3840877-3840899 CACCAGGTGAGGCCCGGCCGGGG - Exonic
1077778275 11:5294877-5294899 CAATGTGGGAGCCCAGGCAGAGG + Intronic
1078147322 11:8730665-8730687 CGCTGGGACAGCCCAGGCTGGGG + Exonic
1080771866 11:35349166-35349188 CACTGCGGGAGCCCGGGCAGGGG + Intronic
1081604280 11:44517722-44517744 CAGTGGGTGAGCCCTGGGCTGGG + Intergenic
1081741184 11:45441892-45441914 CACTTGGTCAGCACAGGCTGAGG + Intergenic
1082693068 11:56328594-56328616 TACTGGGGGAACCCAGGCCATGG + Intergenic
1082698832 11:56402407-56402429 CAATGTGGGAGCCCAGGCAGAGG + Intergenic
1083114597 11:60448059-60448081 GACTGGGTCACCCCAGGCCTTGG - Intronic
1083133348 11:60647442-60647464 CAATGGGAGAACCCAGGACGAGG - Intergenic
1083163080 11:60867578-60867600 CACAGGGTAACCCCAGGTCGTGG - Exonic
1084333253 11:68442170-68442192 CACTGGGGGAAACCAGGCAGAGG - Intronic
1084562853 11:69914025-69914047 GCCTGGGGGAGCCCAGGCCTGGG - Intergenic
1086401124 11:86461625-86461647 CACTGGGTGAGGCCAGGCCCTGG + Intronic
1087124135 11:94606582-94606604 CACTTTGGGAGGCCAGGCCGGGG + Intronic
1089328482 11:117673735-117673757 AACAGCGTGAGCCCAGGCCTGGG - Intronic
1090799196 11:130160055-130160077 CACGAGGTGAGCGCGGGCCGGGG + Exonic
1091159439 11:133406461-133406483 CACTGGGTCAGCCCTAGCTGTGG - Intronic
1091313673 11:134595606-134595628 CTCAGGGTGAGCACAGGGCGGGG + Intergenic
1202822069 11_KI270721v1_random:73252-73274 CGCAGGGTGAGCCAAGGCCAGGG + Intergenic
1091611684 12:2015645-2015667 CTCTGGATGAGCCCTGGCCATGG - Intronic
1095145514 12:38721698-38721720 CCCTGGGGGAGCCCAGACCTGGG + Intronic
1095478674 12:42611265-42611287 CAGAGTGGGAGCCCAGGCCGAGG + Intergenic
1096385229 12:51190817-51190839 TACTGACTGAGCCGAGGCCGTGG - Intronic
1097174685 12:57135914-57135936 CACCCGGTGACCTCAGGCCGTGG + Intronic
1097810166 12:64010435-64010457 CACTGGGTGGGCCCTGGCCAGGG - Intronic
1100633512 12:96411882-96411904 CACTTGGGGAGGCCAAGCCGGGG - Intergenic
1101842036 12:108334603-108334625 CCCTGGGGGAGCCCAGCCCAAGG + Intronic
1102569889 12:113820979-113821001 CACTGTGTGAGCCCTGGCAGGGG + Intronic
1102923913 12:116812464-116812486 CACTAGGTGAGGCCAGGAGGTGG + Intronic
1103155882 12:118684617-118684639 CACTGTGTGACCTTAGGCCGGGG + Intergenic
1104679570 12:130739992-130740014 CACTGGGAGCACCCAGACCGTGG - Intergenic
1104926667 12:132317391-132317413 CACAGTGTGTGCCCAGGCCCAGG + Intronic
1104961816 12:132491672-132491694 GACTGGGGGATCCCAGGCCATGG - Intronic
1108099254 13:46936542-46936564 CAAAGGGGGAGCCCAGGCAGAGG + Intergenic
1110497809 13:76190043-76190065 CACTGTGGGAGCCCAGGCTGAGG + Intergenic
1111590950 13:90348473-90348495 CAATGTGGGAGCCCAGGCAGAGG - Intergenic
1112580636 13:100674386-100674408 CGCCGGGTGCGCCCGGGCCGAGG + Intronic
1113804659 13:113106235-113106257 CACAGGGTGCTCCCAGGCTGGGG + Intronic
1114512728 14:23276020-23276042 CACTGAATGATCTCAGGCCGAGG + Exonic
1119112621 14:71989223-71989245 CACTGGGTAAACCCATGCCTGGG + Intronic
1121780259 14:96617679-96617701 CCCTGGATGAGCCCAGGGAGAGG + Intergenic
1122218271 14:100218635-100218657 CACTGGGTGCGCCCAGGACCAGG - Intergenic
1122359596 14:101151541-101151563 CGCCGGGTGAGGCCAGGGCGTGG + Intergenic
1122580212 14:102766993-102767015 CACTTGGTGAGGCCAGGGGGTGG + Intergenic
1122809596 14:104281457-104281479 CACTGGGTGGGCTCAGTCTGGGG - Intergenic
1123056678 14:105574179-105574201 CTCCGGCTGAGCCCAGGCAGTGG + Intergenic
1123081531 14:105697606-105697628 CTCCGGCTGAGCCCAGGCAGTGG - Intergenic
1124403079 15:29367383-29367405 CACTGGGTGAGCTCAGGGTCAGG - Intronic
1125953763 15:43775883-43775905 CCCTGAGTGAGCCCAGGCAGTGG + Exonic
1127834050 15:62775779-62775801 CACTGGGTCTACCCATGCCGTGG - Intronic
1129299781 15:74618912-74618934 AACTGGGTGAGCCAGGGCCAGGG - Intronic
1129333916 15:74841333-74841355 TGCTGAGTGAGCCCAGGCAGAGG + Intronic
1130555348 15:84918620-84918642 CTCTGGGAGAGCCCTGGCCATGG - Intronic
1132607827 16:800859-800881 CGCTGGGTGAGCCCAGGGGAGGG - Intergenic
1132631100 16:917850-917872 CTCTGGGTGACCACAGGCCAGGG - Intronic
1132800215 16:1748348-1748370 TACTGGCTCAGCCCAGGCCCTGG + Intronic
1132992633 16:2804881-2804903 GCATGGGTGAGCCCAGGCTGGGG - Intergenic
1133020907 16:2966608-2966630 GACTGGGTGACCCCAGGGCAGGG - Intronic
1135530023 16:23245318-23245340 AACTGGGTGAGTCCAGACTGCGG - Intergenic
1135859731 16:26044706-26044728 CACTGGATGGGGCCAGGCAGGGG + Intronic
1136476429 16:30516655-30516677 CACTGTGGGAGCCCAGGAGGGGG + Intronic
1137055873 16:35746495-35746517 CACTGGGAGGTCCCAGGCCGTGG - Intergenic
1137884405 16:52087036-52087058 CACTGGCTGAGCCCAGACCTAGG + Intergenic
1138180697 16:54938463-54938485 CACTAGGCGAGCCCAGGTTGTGG + Intergenic
1139559204 16:67730944-67730966 CACTGGGAGAGCTCTGGCCAAGG + Intronic
1139808697 16:69593395-69593417 CACTGCTTGAGCCCAGGAGGTGG - Intronic
1140476985 16:75243990-75244012 CACGGGGTGAGACAAGGCCAGGG + Intronic
1141463433 16:84191643-84191665 CACCAGGTGAGGCCGGGCCGGGG + Exonic
1141645832 16:85367060-85367082 CAGTGGGTGAGCAGAGGCCACGG - Intergenic
1142185403 16:88692478-88692500 CACTGGAAGAGCCCAAACCGCGG + Intergenic
1142930800 17:3282547-3282569 CACTGTGTGTGCTCAGGCCACGG + Intergenic
1142944602 17:3413926-3413948 CACTGTGTGTGCTCAGGCCACGG - Intergenic
1143510384 17:7392440-7392462 GAGTGTGTGAGCCCAGGCCCTGG - Intronic
1143785634 17:9253584-9253606 CTTAGGGTGAGCCCAGGCCCTGG - Intronic
1144726635 17:17505665-17505687 CACTGGGGCAGCCCACGCCGGGG + Exonic
1147931533 17:43984245-43984267 CACCGGGTTCGGCCAGGCCGAGG - Intronic
1148194620 17:45704425-45704447 AACTGGGTGATCCCAGGAGGAGG + Intergenic
1149497354 17:57127699-57127721 CACTTGATGAGCCCAGGGCATGG + Intergenic
1150926513 17:69538112-69538134 TACTTGGGGGGCCCAGGCCGGGG - Intronic
1151215872 17:72575989-72576011 CACTGTTGGAGCCCAGTCCGCGG + Intergenic
1151811377 17:76444448-76444470 CACTGCTTGAGCCCAGGAGGCGG + Intronic
1152008329 17:77696020-77696042 CACTAGGGGAGCCCAGGAAGGGG - Intergenic
1152224741 17:79087516-79087538 CACAGGATGACCCAAGGCCGTGG - Intronic
1152338539 17:79711549-79711571 CACAGGGTGGGCCCAGGCTGTGG + Intergenic
1152560060 17:81073373-81073395 CCCTGGCTGAGCCCAGGGTGAGG - Intronic
1152804627 17:82349371-82349393 CACTGGGGTAGCCGGGGCCGTGG + Intergenic
1152851014 17:82635836-82635858 CACTCTGGGAGGCCAGGCCGAGG + Intronic
1155236170 18:23821610-23821632 TATTGTGTGAGCCCAGGCCCTGG + Intronic
1155407112 18:25501340-25501362 CACAGGGAAAGCCCAGGCCCAGG + Intergenic
1156261042 18:35445255-35445277 CACTGGGGGAGCCCAGTGAGGGG + Intronic
1156446149 18:37238395-37238417 CAAGAGGTGAGCCCAGGCCTTGG - Intergenic
1156633263 18:38995777-38995799 CACAGGGTGATCCCTGGCTGTGG + Intergenic
1157625939 18:49051286-49051308 CACCAGGTGAGCCCAGGCTGGGG + Intronic
1158806913 18:60984798-60984820 CACTGGGAGAGCCGAGGAAGCGG - Intergenic
1159908056 18:74116576-74116598 TACTGGGAGGGTCCAGGCCGAGG - Intronic
1160735081 19:658714-658736 CACTGCCTCAGCCCAGGCTGGGG + Intronic
1160846075 19:1166554-1166576 GACTGCGTGAGCCCAGGAGGTGG + Intronic
1160871255 19:1278887-1278909 CACTGGGTGAGACCAGCCCCGGG - Exonic
1161006882 19:1941462-1941484 CACTGGGGGCGCCCAGGGCCAGG - Intronic
1161704456 19:5812617-5812639 CATGGGGTGGGCCCAGGCCCTGG + Intergenic
1162106925 19:8375633-8375655 CACAGTGGGAGCCCAGGCAGAGG - Intronic
1162563798 19:11433971-11433993 CACTTTGGGAGCCAAGGCCGTGG + Intronic
1162738037 19:12757496-12757518 CACAGGGTGAGGCCAGGCTCTGG + Intronic
1163157924 19:15449386-15449408 CACTGGGTGGGCACTGCCCGCGG + Intronic
1163392166 19:17037338-17037360 TACAGGGTGAGCACAGGCGGAGG + Intergenic
1167264190 19:48475284-48475306 CACTGCGTTAACCCAGCCCGAGG + Intronic
1168689706 19:58369103-58369125 CTCGGGGTGAGCCCCGGCCCGGG - Exonic
925905246 2:8536249-8536271 TGCTGGGTGAGCCCAAGCCCGGG - Intergenic
925932596 2:8721733-8721755 CACTGGCTGGGCCCAGACCCTGG + Intergenic
927312665 2:21648442-21648464 CACTGGGTGATGCCAGGCCTTGG - Intergenic
927518802 2:23687246-23687268 CCCTGGGTGAGCCCTGCCAGGGG + Intronic
927851675 2:26503642-26503664 CACTGGGTGGGGCCTGGCCCTGG + Intronic
932664485 2:73685897-73685919 CAGTGGATGAGGCCAGGCCTTGG - Intergenic
933793743 2:85903967-85903989 CTGTGTGTGAGCCCAGTCCGTGG - Intergenic
934713142 2:96528436-96528458 CACGGGGTGGGCCCAGGCTGGGG - Intergenic
936602492 2:113911667-113911689 AACTGAGTGTGCCAAGGCCGAGG - Intronic
937306871 2:120877053-120877075 CACCGGCTGACCCAAGGCCGAGG - Intronic
940006069 2:149010493-149010515 CACAGGGTGAGCACAGGGTGCGG - Intronic
940471335 2:154104371-154104393 CTCTGTGTGAGCACAGGCAGCGG + Intronic
941240006 2:163026143-163026165 CAAAGTGGGAGCCCAGGCCGAGG - Intergenic
941398009 2:164995244-164995266 CAAAGTGGGAGCCCAGGCCGAGG + Intergenic
945741833 2:213672943-213672965 CAATGGGTGAACCCAGGAGGCGG - Intronic
947341933 2:229149796-229149818 CACATGGTGAGCACAGGCCTAGG + Intronic
947549686 2:231037515-231037537 CAGCGGGTGCGCCCGGGCCGCGG + Exonic
947992206 2:234496859-234496881 CACAGAGCGAGCCCAGGCCTGGG - Exonic
948202111 2:236136638-236136660 CCCTGTGCGAGCCCAGGCTGGGG - Intergenic
948214734 2:236220284-236220306 CAGTGGGAGAGCCCAGGCTGAGG - Intronic
948641747 2:239379544-239379566 CACTGGGCCAGCTCAGGCCGAGG - Intronic
1172166070 20:32900117-32900139 GACTGGGTGAGGCCAGGGTGGGG + Intronic
1172842374 20:37909686-37909708 CAGTGGGTGGGCCCAGGCTCTGG + Intronic
1174364853 20:50050513-50050535 CACTGGGTGACCCAAGTCAGAGG + Intergenic
1175172864 20:57092298-57092320 AACTGTGAGAGCGCAGGCCGGGG - Intergenic
1175812353 20:61865075-61865097 CACAGGGAGAGGCCAGGCAGGGG - Intronic
1176232510 20:64039431-64039453 CAGTCTCTGAGCCCAGGCCGTGG - Intronic
1176415664 21:6473299-6473321 AGCTGGGTGAGACCAGGCGGCGG + Intergenic
1177565903 21:22819327-22819349 CAAAGGGAGAGCCCAGGCAGAGG + Intergenic
1179532781 21:42031708-42031730 ACCTGGGTGAGCCCAGACCCGGG + Intergenic
1179691164 21:43081631-43081653 AGCTGGGTGAGACCAGGCGGCGG + Intergenic
1179815691 21:43904634-43904656 CACTGGGTGGGCCCAGGGTTGGG + Intronic
1180068084 21:45422700-45422722 CACTGGGTGAGGCGGGGCTGTGG + Intronic
1180077840 21:45472185-45472207 CACTGGGGCAGCCCGGGCGGGGG - Intronic
1180147499 21:45929441-45929463 CACAGGGTGAGACCAGGGCGAGG + Intronic
1181169074 22:20998243-20998265 GACTGGGTGACCCCAGGTGGAGG - Exonic
1181433802 22:22898884-22898906 CAGTGGGGGATCCCAGGCCTGGG - Intergenic
1181434744 22:22904253-22904275 CAGTGGGGGATCCCAGGCCTGGG - Intergenic
1182436860 22:30336496-30336518 CATTGGGGGAGCAGAGGCCGGGG + Intronic
1182698354 22:32211560-32211582 CAGTGGGGGATCCCAGGCCTGGG - Intergenic
1183707096 22:39480818-39480840 CACTGGGTGGCCCCAGGCACTGG - Intronic
1183870649 22:40739407-40739429 CATTGGTTGAGCCCAGGAGGTGG + Intergenic
1184296659 22:43529330-43529352 CTCAGGGTGCGCCCAGGCAGGGG + Intronic
1184859774 22:47166737-47166759 CACTGGGTGACCACATGCCCAGG - Intronic
1185107908 22:48884871-48884893 GACTGGGCCAGGCCAGGCCGGGG - Intergenic
1185206323 22:49541240-49541262 GACAGGGTGTGCCCAGGGCGCGG + Intronic
949473407 3:4419646-4419668 CACTGTGGAAGCCCAGGCCTTGG - Intronic
950482219 3:13251137-13251159 CACTGGCTGAGCCCTGGGCCAGG + Intergenic
950673228 3:14539633-14539655 AATAGGGTGAGCCCAGGCTGAGG + Intronic
951559342 3:23949960-23949982 CACTGGGTAAGCCCTAGCCTGGG + Intronic
954447609 3:50555124-50555146 CCCTGGGTGAGGCCAGGGAGGGG + Intergenic
954673404 3:52302737-52302759 CACTGGATGACCCCAGGGAGGGG + Intergenic
958592504 3:96175683-96175705 CACTGGCTCAGCCCACGCCTGGG - Intergenic
960868651 3:122227663-122227685 CACAGTGGGAGCCAAGGCCGAGG + Intronic
960974470 3:123161272-123161294 CACAGGGTGTCCCCAGGCTGAGG - Intronic
960987575 3:123290715-123290737 CACTGGGTTGTCCCAGGCCCTGG + Intronic
961378966 3:126484862-126484884 CACTGGGAGTGCTCAGGCCTGGG - Intronic
961382712 3:126506031-126506053 CACTGGCTGAGCCCTGGGCTTGG - Intronic
962278998 3:134036237-134036259 TACTGGGTGAGACCAGGAAGTGG - Intronic
962986118 3:140537605-140537627 CACTGGGTGAGCTCAGCCATGGG - Intronic
963921957 3:150914368-150914390 CTCTGGGTCAACCCAGGCCTGGG + Intronic
966098963 3:176242940-176242962 CACTGCTTGAGCCCAGGAGGTGG - Intergenic
968092624 3:195908563-195908585 CACTGCCTGAGGGCAGGCCGCGG - Intronic
968427451 4:533270-533292 CACTGGGGGAGCACAGCCCCTGG - Intronic
968648592 4:1751595-1751617 CACTGAGTGGGCCCAGGGTGGGG + Intergenic
968816714 4:2825191-2825213 CACCAGGTGAGCCCGGGCCCAGG + Exonic
971370523 4:26015310-26015332 CACAGGGTAAGCCAAGACCGGGG - Intergenic
980061740 4:128137879-128137901 CACTGCTTGAGCCCAGGAGGCGG - Intronic
985648005 5:1094065-1094087 CCCTGGGGGCCCCCAGGCCGGGG - Intronic
985685940 5:1281497-1281519 GCCTGGCTGAGCCCAGGCCATGG - Intronic
985761406 5:1751143-1751165 CACTGGGTGTCCCGAGGCCATGG - Intergenic
986070416 5:4277722-4277744 CACTGGGTGGGCAGAGGCTGGGG - Intergenic
986541710 5:8851285-8851307 CACTGGGTGGCCCCAGCCCTGGG + Intergenic
986860205 5:11918650-11918672 CACTGGCCGCGCCCAGGCCTTGG + Intergenic
988577887 5:32444436-32444458 CCCTGGCGGGGCCCAGGCCGCGG + Intronic
988698711 5:33650626-33650648 CACTGGGTCAGCCCTGGCAATGG - Intronic
993502071 5:88675852-88675874 CAGTAGCCGAGCCCAGGCCGGGG - Intergenic
997654886 5:135547322-135547344 CACTGGGAGTGCCCAGGGCCAGG + Intergenic
1002074519 5:176700184-176700206 CTCTGGGCGAGCCGAGGCTGCGG + Intergenic
1002600545 5:180352202-180352224 CCCGCGGTGAGCCCTGGCCGAGG - Intronic
1006153564 6:32002055-32002077 TGCAGGGTGAGCCCAGGCTGGGG - Intronic
1006159872 6:32034792-32034814 TGCAGGGTGAGCCCAGGCTGGGG - Intronic
1006793687 6:36719273-36719295 AACAGGGCCAGCCCAGGCCGTGG - Intronic
1007581167 6:42960968-42960990 CACTGGGTGAGCCCAGGCCGGGG + Exonic
1007901807 6:45420341-45420363 CACTCGCTGAGCCCACGCCCGGG - Intronic
1012997862 6:105991955-105991977 CTCTGGATGAGCCCAGCCAGCGG - Intergenic
1013231453 6:108165173-108165195 CGCTGGGAGAGCGCATGCCGAGG - Intronic
1013526424 6:110978362-110978384 CACTGTTTGAGCCCAGGTCAAGG + Intergenic
1017310120 6:152966415-152966437 CACAGTGGGAGCCCAGGCAGAGG + Intergenic
1017743394 6:157426602-157426624 CACTGGGGAAGCCCTGGCTGTGG + Intronic
1017810810 6:157982083-157982105 CGCTGGGTGAGTCCGGGCCGGGG + Exonic
1018326289 6:162673470-162673492 CACGGTGTGAGCCCAGGAAGTGG - Intronic
1018840013 6:167509780-167509802 CACTGGGTCAGGCCTGGCAGAGG + Intergenic
1019015644 6:168877943-168877965 CACAGAGTGAGCCCAGAGCGAGG - Intergenic
1019200815 6:170313372-170313394 CACTGGGAGAGCCTGGGCCCAGG + Intronic
1019335525 7:480860-480882 GACTGGGTGAGCTCAGCCTGGGG - Intergenic
1019346275 7:532252-532274 CAGGGGGTGAGGCCAGGCGGGGG + Intergenic
1019597192 7:1863628-1863650 CACAGGCTGAGCCCAGCGCGTGG - Intronic
1020091983 7:5346778-5346800 CACTGGCTCAGCCAAGGCCGGGG + Intronic
1020206518 7:6121749-6121771 CACTGCTTGAGCCCAGGAGGTGG - Intronic
1022812109 7:33880061-33880083 CACAGGGACAGCCCAGGCCCAGG - Intergenic
1023071048 7:36434432-36434454 CAATGGTTGAGCCCAGGCTGAGG - Intronic
1023984264 7:45085919-45085941 CCCTGGGTCCGCCCAGGCCGAGG + Exonic
1024259335 7:47562174-47562196 CACTGGGTCAGTCCAGGGAGGGG - Intronic
1029954385 7:104622192-104622214 GACTGGCTGAGCCCAAGCCTGGG - Intronic
1032237781 7:130140180-130140202 TGCAGGGTGAGCCCAGGCAGAGG - Intergenic
1032368686 7:131325443-131325465 CACTTTGGGAGGCCAGGCCGAGG + Intronic
1033711460 7:143950672-143950694 CACTTTGGGAGGCCAGGCCGAGG - Intergenic
1034541374 7:151760482-151760504 CACTTTGGGAGGCCAGGCCGAGG - Intronic
1035198558 7:157243557-157243579 CCCTGGGAGGGGCCAGGCCGTGG - Intronic
1035326200 7:158067765-158067787 CACCGGGTCAGGCCGGGCCGCGG + Intronic
1035679731 8:1479096-1479118 AGCAGGGTGAGCCCAGGCAGGGG + Intergenic
1037837135 8:22221003-22221025 CCCTGGGAGAGCCCAGGAGGTGG + Exonic
1038493827 8:27987952-27987974 CACTGGGTGGGGCCAGGAGGAGG + Intronic
1039608451 8:38901293-38901315 CACTGGGGGAGACCAGAGCGAGG + Exonic
1040905877 8:52469651-52469673 CAATGGCTGGGCCCAGGCTGTGG - Intergenic
1042641151 8:70936374-70936396 CACTGGAAGAGCCCAGGCAGAGG + Intergenic
1044613633 8:94118350-94118372 CACTGTGTGAGCCCAAGTCCTGG - Intergenic
1048512408 8:135074829-135074851 CACTGGTTGTGCCCAGGCAGGGG + Intergenic
1049446300 8:142633058-142633080 CACTGGCTGAGCCCAGGGACTGG - Intergenic
1052970915 9:34376776-34376798 CAATGGGTGAGCCCAGCGGGAGG - Exonic
1053662107 9:40291263-40291285 CACTGTGTGACCTCAGGCAGGGG + Intronic
1053912556 9:42921431-42921453 CACTGTGTGACCTCAGGCAGGGG + Intergenic
1054374234 9:64437503-64437525 CACTGTGTGACCTCAGGCAGGGG + Intergenic
1054522503 9:66085021-66085043 CACTGTGTGACCTCAGGCAGGGG - Intergenic
1056991928 9:91421269-91421291 CTCTGGGTTCGCCCGGGCCGCGG - Intronic
1057192806 9:93096655-93096677 CAGTGGCTGAGCCCAGACCGCGG - Intronic
1057219996 9:93252289-93252311 CTCTGGGGGAGCTCAGGCCATGG + Intronic
1057442515 9:95092309-95092331 TGCTGGGTGGGCCCAGGCGGGGG - Intergenic
1057931576 9:99198073-99198095 GATTGGCTGAGCCCAGGCCACGG - Intergenic
1060723382 9:125992630-125992652 GCCTGGGAGAGCCCTGGCCGGGG - Intergenic
1062160259 9:135075907-135075929 CACTTCGGGCGCCCAGGCCGGGG - Intronic
1062261867 9:135666844-135666866 CAGTGGCTGAGCCCAGGGAGGGG - Intergenic
1062345594 9:136113174-136113196 GATTGTTTGAGCCCAGGCCGGGG - Intergenic
1062501075 9:136852286-136852308 CACTGGGTGGGGCCGGGCCGAGG + Intronic
1062622962 9:137430865-137430887 AGCTGGGTGAGGCCAGGCAGGGG - Intronic
1187112942 X:16320171-16320193 CACTGGGAGAGCCCAGTGGGAGG - Intergenic
1187420299 X:19128115-19128137 CAGTGAGTGAGCCCAGGGCTTGG + Intergenic
1188167025 X:26874147-26874169 CAAAGTGTGAGCCCAGGCAGAGG + Intergenic
1190739912 X:53281764-53281786 CACTGAGGGAGCCCAGCCTGGGG - Intronic
1190876553 X:54464376-54464398 CACTTTGGGAGGCCAGGCCGGGG - Intronic
1192151275 X:68714068-68714090 CACTGGGTCACACCAGGCTGTGG - Intronic
1192181791 X:68920770-68920792 CATCAGCTGAGCCCAGGCCGGGG + Intergenic
1193016460 X:76739117-76739139 CTCTGGATGAACCCAGGCTGGGG + Intergenic
1195996195 X:110733819-110733841 CATTGGTTGAGCCCAGGAGGCGG + Intronic
1196080397 X:111624415-111624437 CACTGGGTGACCGCCCGCCGTGG + Intergenic
1196775425 X:119333469-119333491 CACAGTGGGAGCCCAGGCAGAGG - Intergenic
1198111065 X:133503012-133503034 CACTTGGTTAGCTCAGGCTGTGG + Intergenic
1198799540 X:140434563-140434585 CACTGGGTGATCCCAGCCCCTGG + Intergenic
1198972668 X:142298733-142298755 CAAAGTGGGAGCCCAGGCCGAGG + Intergenic
1199695170 X:150338817-150338839 CACTGTGGGAGCCCAGGCAAGGG - Intergenic
1199752356 X:150832371-150832393 CACTGTGGGAGGCCAGGCCAAGG + Intronic
1200224897 X:154411951-154411973 CAGTGAGTGGGCCCAGGCCGAGG + Exonic