ID: 1007581168

View in Genome Browser
Species Human (GRCh38)
Location 6:42960972-42960994
Sequence GGGTGAGCCCAGGCCGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 809
Summary {0: 1, 1: 0, 2: 6, 3: 95, 4: 707}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581159_1007581168 8 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581168 6:42960972-42960994 GGGTGAGCCCAGGCCGGGGCCGG 0: 1
1: 0
2: 6
3: 95
4: 707
1007581158_1007581168 20 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581168 6:42960972-42960994 GGGTGAGCCCAGGCCGGGGCCGG 0: 1
1: 0
2: 6
3: 95
4: 707

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581168 Original CRISPR GGGTGAGCCCAGGCCGGGGC CGG Exonic
900103532 1:972790-972812 CGGTGGGTCCAGGCAGGGGCGGG + Intronic
900127036 1:1073267-1073289 GGGAGGGCCCAGGCAGGGGCAGG + Intronic
900140322 1:1137044-1137066 GGGGGAGCCCAGGGCGGGGAGGG + Intergenic
900226520 1:1535832-1535854 GGGGAAGGCCAGGCCGGGGGTGG - Intronic
900227427 1:1539851-1539873 TGGGGAGCGCAGGCCGGGGTCGG + Intronic
900227466 1:1539970-1539992 AGGGGAGCGCAGGCCGGGGTGGG + Intronic
900227475 1:1539991-1540013 GGGGGAGCGCAGGCCCGGGAGGG + Intronic
900227495 1:1540031-1540053 GGGGAAGCGCAGGCCGGGGTGGG + Intronic
900227531 1:1540128-1540150 GGGGGAGCGCAGGCCGGGGAGGG + Intronic
900227539 1:1540147-1540169 AGGGGAGCGCAGGCCGGGGAGGG + Intronic
900227547 1:1540166-1540188 AGGGGAGCGCAGGCCGGGGAGGG + Intronic
900344204 1:2203387-2203409 AGCTGTGCCCAGGCCTGGGCAGG - Intronic
900413001 1:2521515-2521537 GGGGGAGCACAGGCGGGCGCAGG + Intronic
900604655 1:3518566-3518588 GGCTGCGCCGAGGCAGGGGCTGG + Intronic
900965190 1:5952648-5952670 GGGTGGGGCCAGGCAGGGGTGGG - Intronic
901026697 1:6282170-6282192 GATGGAGCCCAGGCCGGGGAGGG - Intronic
901251444 1:7783516-7783538 GGAGGAGCCCAGGGTGGGGCGGG - Intergenic
902504678 1:16931396-16931418 AGGTGAGGCCTGGCCGGGGACGG + Exonic
902817846 1:18926323-18926345 GGGAGAGGCCAGGCCAGGCCAGG + Intronic
902896951 1:19485595-19485617 GGGCGGGCCCGGGCCGGGCCGGG - Intergenic
903043739 1:20551401-20551423 GAGTGAACCCAGGTCTGGGCTGG - Intergenic
903150114 1:21401538-21401560 GGTTGAGACCAGGCCGGGCGTGG + Intergenic
903537694 1:24077816-24077838 AGGTTGGCCCAGGCCAGGGCGGG - Intronic
903693719 1:25192562-25192584 GGGTGAGCCCAGCAATGGGCAGG - Intergenic
903784121 1:25846127-25846149 GGGTGCTCCCAGGCCGGGTGCGG + Intronic
904673703 1:32184457-32184479 GTGTGAGCCCAGGCCTGGAGGGG + Intronic
904690766 1:32292039-32292061 AGGTGAGCCCAGGAGGGGACGGG + Intergenic
904744516 1:32702773-32702795 GGGCGCGCCCGGCCCGGGGCCGG - Exonic
904828986 1:33294787-33294809 GAGTGAGCCCAGGCAAGAGCTGG - Intronic
905179202 1:36156159-36156181 GGTTGGGCCGAGGCCGGGACTGG + Intronic
905395005 1:37661273-37661295 GGGAGAGGTGAGGCCGGGGCCGG - Intergenic
905528802 1:38660267-38660289 GGGGGAGCCCAGGGCGGAGTAGG + Intergenic
905819807 1:40980287-40980309 GGCTGAGCCCGCGCCGAGGCCGG - Intronic
906090286 1:43172658-43172680 GGGCGAGTCCGGGCCGGGGGCGG + Intronic
906199100 1:43947748-43947770 GGCAGAGCTCAGGCCTGGGCTGG + Intronic
906480932 1:46198432-46198454 GGGGCGGGCCAGGCCGGGGCGGG - Intronic
906526740 1:46497982-46498004 GACTGAGCCCAGGCAGGGCCCGG + Intergenic
906607403 1:47181699-47181721 AGGTGAGCCCAGGCAGAAGCAGG + Intergenic
906642573 1:47450197-47450219 GGGTCAGCGCAGAGCGGGGCGGG - Intergenic
907160583 1:52366108-52366130 GCGGGAGCCCAGGGCGGTGCCGG - Exonic
907277662 1:53326267-53326289 GGGTGTGGCCGGGGCGGGGCCGG + Intronic
907300702 1:53484839-53484861 TGGTGAGGCCATGCCGGGCCTGG + Intergenic
908477661 1:64505588-64505610 GGGTGTGCCCAGGGAGGGGGAGG - Intronic
909594204 1:77386833-77386855 GGGTGAGCGCAGGCAGGGAGAGG - Intronic
910806262 1:91192221-91192243 AGGTGAGCCCAGAGCGGGGTGGG - Intergenic
914919658 1:151838634-151838656 GGGAGTCCCCCGGCCGGGGCAGG + Exonic
915270931 1:154752881-154752903 GGGTGACCACAGGCCGAGGGAGG - Intronic
915348341 1:155209185-155209207 GGGCGGGCCCAGGCAGGGGAGGG + Exonic
915362675 1:155295359-155295381 GGTTGGGCCCAGGCGTGGGCAGG - Intronic
915835425 1:159171890-159171912 GAGTGACCCGAGGCGGGGGCTGG + Intronic
915835733 1:159173210-159173232 GGATGGGCACAGGGCGGGGCGGG + Intronic
915865605 1:159495017-159495039 GGGCCAGCCAAGGCCGGAGCTGG - Intergenic
916714770 1:167439536-167439558 GGCTGAGCCCTTGCAGGGGCCGG + Intronic
916745029 1:167678599-167678621 GGGTGAGCAGAGGCAGGTGCTGG - Intronic
917423779 1:174892216-174892238 GGCTGAGCCCAGGCGGGAGAGGG - Intronic
917915131 1:179694202-179694224 GGGTGAGCCGAAGCAGGGGAGGG + Intergenic
918044759 1:180935217-180935239 CGGTGGGCACAGGCCGAGGCGGG + Exonic
919878666 1:201888608-201888630 GATTGGGCCCAGGCCGGGGGCGG + Intergenic
919914194 1:202129973-202129995 GGGTGGGGGCAGGCCAGGGCAGG - Exonic
920076941 1:203344118-203344140 GGCAGAGCCTAGACCGGGGCTGG + Intronic
920308708 1:205035324-205035346 GGGAGAGCCCAGAGCGGGCCTGG + Intergenic
920364354 1:205440249-205440271 GGGTGGGTCAGGGCCGGGGCTGG + Intronic
921277824 1:213536880-213536902 GGGAGAGCCCAGTGGGGGGCGGG + Intergenic
922621041 1:226988366-226988388 GTGAGAGCCCTGGCTGGGGCTGG - Intergenic
922705437 1:227788075-227788097 GGGTGTGGCCAGGCGGGGGCGGG + Intergenic
923097713 1:230788708-230788730 GGCTGAGCGCAGCCCTGGGCGGG + Intronic
923193499 1:231642317-231642339 GGGTTGGCCAAGGCCGGAGCCGG - Intronic
923684147 1:236142409-236142431 GGGGGCGCGCGGGCCGGGGCGGG + Intergenic
924309206 1:242722410-242722432 TGAGGAGCCAAGGCCGGGGCAGG - Intergenic
1063141168 10:3257770-3257792 AGGTGAGTCCAGGCCGGGCCAGG - Intergenic
1063462155 10:6221744-6221766 AGGTGAGCGCAGGCTGGGGCGGG + Exonic
1065390339 10:25175757-25175779 GGGTGCGCGCTGGCCAGGGCTGG - Exonic
1065491566 10:26287561-26287583 GGGTGATGCCAGTCCGAGGCTGG + Intronic
1065605587 10:27414214-27414236 GCCCAAGCCCAGGCCGGGGCCGG - Exonic
1066615113 10:37285578-37285600 GGGTTAGCCAAGGCTGGAGCTGG - Intronic
1067068639 10:43117345-43117367 AGGTGAACCCAGTCTGGGGCTGG - Intronic
1067069157 10:43119772-43119794 GGGTGTGGCCTGGCCGGGGCTGG - Intronic
1067103825 10:43351624-43351646 GGGTGGGCCCAGCGCTGGGCAGG - Intergenic
1068237580 10:54259290-54259312 AGGTGACCCCAGACAGGGGCCGG - Intronic
1069907543 10:71740644-71740666 GGGAGAGCCCAGGGCTGGCCGGG + Intronic
1069907550 10:71740664-71740686 GGGAGAGCCCAGGGCTGGCCAGG + Intronic
1070255988 10:74813583-74813605 GGGTGAGGCCGGGCGGGAGCGGG + Intergenic
1070328193 10:75401276-75401298 GGACGAGCCTGGGCCGGGGCCGG + Exonic
1070447632 10:76523229-76523251 GCGTGAGCTCAGGTCGGGGCTGG - Intronic
1070669520 10:78368275-78368297 GAGTCTGCCCAGGCTGGGGCTGG + Intergenic
1070954457 10:80454851-80454873 GGGTGGGCGTAGGCCGGGGCGGG + Intronic
1071265182 10:83958305-83958327 GGGTGAGCGAAGGGCAGGGCTGG + Intergenic
1072436188 10:95416428-95416450 GGCTGAGCCCAGCCCGTAGCAGG + Intronic
1072607555 10:96997468-96997490 GGGTAAGGCCAGGCCTGGGCAGG - Intergenic
1073207230 10:101775709-101775731 GGGTGCGCGGAGGCGGGGGCCGG - Intronic
1073447884 10:103591987-103592009 GGGAGAGCCCAGGCCAGGGCAGG - Exonic
1073509963 10:104036693-104036715 AGGGGAGCCCAGGCTGTGGCTGG - Intronic
1074695348 10:116045521-116045543 GGGTGACCCCAAGCTGGGGCTGG + Intergenic
1075048634 10:119165712-119165734 GGGTGCGCGCGGCCCGGGGCGGG - Intergenic
1075071340 10:119321786-119321808 AAGTGAGCCCAGGCCGTAGCTGG + Intronic
1075495525 10:122915757-122915779 GGGAGAGCCCAGGGTGGGGGTGG + Intergenic
1075559886 10:123460657-123460679 GGGAGAGCCCAGGCCTGGGAAGG - Intergenic
1075561410 10:123471373-123471395 GGGTGAGGCAAGGCTGGGGTAGG - Intergenic
1075802309 10:125160806-125160828 GGGTGAGCGCGGCGCGGGGCGGG - Intronic
1076352337 10:129825868-129825890 GGCAGAGTCCAGGCCGGGGAGGG + Intergenic
1076426384 10:130370236-130370258 GGGAGAGCCCTGGCAGGGGAGGG + Intergenic
1076599825 10:131650341-131650363 GGCAGAGGCCAGGCCGGGCCAGG + Intergenic
1076652159 10:131997213-131997235 GGCAGAGCCCAGGCTGGAGCAGG + Intergenic
1076686600 10:132200982-132201004 TGGTGAGCACAGGCCTGGCCGGG + Exonic
1076852770 10:133101204-133101226 GGGTGTGACAAGGGCGGGGCAGG - Intronic
1076913126 10:133402244-133402266 TGGTGAGCCGGGGCTGGGGCTGG + Exonic
1076916167 10:133423988-133424010 GGGGGCGTCCAGGCCCGGGCGGG + Intronic
1076936275 10:133568783-133568805 GGGGGCGTCCAGGCCCGGGCGGG + Intronic
1077115059 11:880395-880417 GCGGGAGCCCAGGCCTGTGCTGG + Intronic
1077224436 11:1433927-1433949 GGGTGAGCCCAGGCCGGGTGGGG - Intronic
1077302700 11:1854612-1854634 GGCTAAGCAGAGGCCGGGGCTGG + Intronic
1077306036 11:1869072-1869094 GGGTGACCCCTGGATGGGGCGGG + Intronic
1077356886 11:2122817-2122839 AGGTGCGGCCAGGCCAGGGCTGG - Intergenic
1077414368 11:2417962-2417984 GGGTGGTCCCAGGCCGGGCCCGG - Intronic
1077434428 11:2531969-2531991 GAGTGAGCCCAGGCTGGGTGAGG - Intronic
1077535537 11:3122327-3122349 AGGTGAGCCCGGGCCCGGGGAGG - Exonic
1077553622 11:3215406-3215428 GGGTGTGCCAAGGTCAGGGCGGG + Intergenic
1077635814 11:3840873-3840895 AGGTGAGGCCCGGCCGGGGCTGG - Exonic
1078110037 11:8385001-8385023 GGGGAAGGCCAGGCCTGGGCTGG - Intergenic
1078130753 11:8612305-8612327 GGGGGAGTCCAGACCAGGGCAGG - Exonic
1078672640 11:13378378-13378400 GGGGGAACCCGGGCTGGGGCAGG + Exonic
1079773655 11:24496867-24496889 GGGTGAGCACTGGCCAGGGGCGG - Intergenic
1081422019 11:42881332-42881354 GGGCTAGCCAAGGCCGGAGCCGG + Intergenic
1081611314 11:44565187-44565209 CGCTGAGCCCAGGCTGGTGCGGG + Intronic
1081641735 11:44760333-44760355 GGGTGAGCCCAGCCAGGGACTGG + Intronic
1081995347 11:47360066-47360088 GGGTGAGCTCAGGGTTGGGCAGG + Intronic
1082119784 11:48366229-48366251 GGGGGAGTCCAGGGCTGGGCTGG + Exonic
1083330065 11:61893313-61893335 GGCTGAGACCAGGCCAGGGCTGG - Intergenic
1083408914 11:62478306-62478328 GGGTGAGCCCTGTCAGGGGCTGG - Intronic
1083571270 11:63763350-63763372 GGGCGAGCACAGGGCGGGGCGGG + Exonic
1083640187 11:64141261-64141283 GGATGAGTCCTGGCCGGGCCTGG - Intronic
1083684541 11:64368604-64368626 GGGAGGGCCCAGGCGCGGGCAGG + Intronic
1083743057 11:64721338-64721360 GATTCAGCCCAGGCCTGGGCTGG + Intronic
1083776031 11:64894726-64894748 GTGTGGGCCCAGGTCGGGGGAGG + Exonic
1083955206 11:65979040-65979062 GGTTGAGGCAGGGCCGGGGCGGG - Exonic
1084024797 11:66441145-66441167 GGGCTGGCCAAGGCCGGGGCCGG - Intronic
1084070011 11:66728025-66728047 GGGTGAGCCGGGGCGGGAGCAGG - Intronic
1084156761 11:67317493-67317515 GGCTCAGCCCAGGCTGGGGCGGG + Intergenic
1084219239 11:67667438-67667460 GAGTGGGCCCCGGCAGGGGCTGG - Intronic
1084304215 11:68271455-68271477 GGGCAAGCCCAGGACGGGACTGG - Intronic
1084393866 11:68896348-68896370 GGGGGCGCCCACGGCGGGGCTGG - Intronic
1084411549 11:69008984-69009006 GGCAGAGCCCAGGGTGGGGCCGG - Intronic
1084660765 11:70545058-70545080 GCAAGAGCCCAGGCCAGGGCAGG + Intronic
1085197901 11:74683401-74683423 GGGGGTGCCCAGCCCGGGGAGGG - Intergenic
1085297983 11:75441620-75441642 GGAGGAGCCCAGGGCAGGGCAGG + Intronic
1085392344 11:76188940-76188962 GGGAGAGGCCAGGCCTGAGCCGG + Intronic
1086401126 11:86461629-86461651 GGGTGAGGCCAGGCCCTGGTGGG + Intronic
1086552451 11:88068999-88069021 GGGTGGGCCAAGGCTGGAGCTGG + Intergenic
1087014691 11:93543474-93543496 GCGGGAGCCGAGGCCCGGGCGGG - Exonic
1089527671 11:119107699-119107721 GGGTGAGCCCCAGCCGGGACCGG + Exonic
1089543564 11:119205989-119206011 GGGCGGGGCCAGGCTGGGGCGGG - Intergenic
1089567853 11:119381526-119381548 GGGTGAGTCCCGGCTGGCGCTGG + Exonic
1089615217 11:119691317-119691339 GGGTGACCCCAAGCTGGGGCTGG - Intronic
1090778328 11:129984507-129984529 GGGTGGGCCGAGGCCGAGGCAGG - Intronic
1091140275 11:133228629-133228651 GGGGCAGCCCAAGCGGGGGCAGG - Intronic
1091304359 11:134528076-134528098 GGGTCAGGCCAGGCAGGAGCGGG - Intergenic
1092143595 12:6200254-6200276 GGGTGCGGCCCGGGCGGGGCCGG + Intronic
1092246631 12:6867701-6867723 GGGTCTGGCCGGGCCGGGGCCGG + Intronic
1092350572 12:7752472-7752494 GGGTTGGCCAAGGCCGGAGCCGG - Intergenic
1094124966 12:27014183-27014205 GGCTGGGCCCACGCCAGGGCTGG + Exonic
1095646911 12:44558506-44558528 GGGCGAGCCAAAGCCAGGGCTGG + Intronic
1095888043 12:47209096-47209118 GGGTGAGCAAAGACCAGGGCAGG + Intronic
1096062798 12:48716368-48716390 GGGAGAGCCCACGATGGGGCGGG - Intronic
1097029186 12:56079547-56079569 GGGAGAGGCCCGGCCGGCGCCGG + Intergenic
1097191419 12:57221303-57221325 GGGACAGTCCAGGCCTGGGCTGG - Intronic
1097778449 12:63675212-63675234 GGGGGAGACCAGGTTGGGGCTGG - Intergenic
1097889074 12:64759292-64759314 GGGTGACCCCGGGACGGGACGGG + Exonic
1101761158 12:107660180-107660202 GGTTGGGCCCAGGCTGGGTCAGG - Intergenic
1102865523 12:116371069-116371091 GAGTGAGCCCGGGCTGGGGCTGG - Intergenic
1103008409 12:117439511-117439533 GGGTGAGGCCTTGCCGGAGCTGG - Intronic
1103497509 12:121374413-121374435 GGGCTAGCCAAGGCCGGAGCCGG + Intronic
1103614733 12:122145028-122145050 GGGAGACCCCAGAGCGGGGCAGG + Exonic
1103915648 12:124374364-124374386 GGGTAGGGCCGGGCCGGGGCGGG - Intronic
1104386731 12:128357404-128357426 GAGGGAGCCCAGGCCGGGCACGG + Intronic
1104760272 12:131293967-131293989 GGGTGAGCACAGCCAGGGGCTGG - Intergenic
1104764506 12:131317861-131317883 GTTTGAGCCCAGGCTGGGGAGGG - Intergenic
1104819494 12:131666679-131666701 GGGTGAGCACAGCCAGGGCCTGG + Intergenic
1104850718 12:131872248-131872270 GGCTGAGTCAGGGCCGGGGCAGG - Intergenic
1104964484 12:132502814-132502836 GGGTGAGGACAGGAGGGGGCGGG - Intronic
1104964496 12:132502846-132502868 GGGTGAGAACAGGAGGGGGCGGG - Intronic
1105295520 13:19085549-19085571 GGGGGAGGCCATGCTGGGGCTGG + Intergenic
1105355021 13:19652277-19652299 GGGTGAGCCAAAGCAGGGTCGGG + Intronic
1105472271 13:20704357-20704379 GGGTGGGGCCGGGCCGAGGCCGG + Intronic
1105851264 13:24338847-24338869 GGCTGCCCCTAGGCCGGGGCCGG + Intergenic
1105964525 13:25372316-25372338 GGGTGGGCCCGGGGCGGGGGCGG + Intronic
1107146976 13:37070062-37070084 GGGAGAGGCCAGGCAGGAGCAGG - Intergenic
1107528990 13:41263774-41263796 GCGTGAGCCCAGAGCGGGGATGG + Intergenic
1108588429 13:51891544-51891566 GAATGAGCCCAGGCTGGGGGAGG + Intergenic
1108872856 13:55007911-55007933 GAGTGAGCCCTGGTCGTGGCTGG + Intergenic
1110941941 13:81362381-81362403 GGGTGAGCCGAAGCAGGGTCGGG + Intergenic
1112502408 13:99953243-99953265 GGGTGAGTCCTGGCCGCTGCTGG - Intergenic
1112567498 13:100563897-100563919 GCGTGAGCCCAGGCGTGTGCAGG + Intronic
1113528361 13:111000487-111000509 GGGTGAACCCTGGGCTGGGCAGG - Intergenic
1113888702 13:113725264-113725286 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888721 13:113725327-113725349 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888739 13:113725390-113725412 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888759 13:113725453-113725475 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888795 13:113725579-113725601 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888813 13:113725642-113725664 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888833 13:113725705-113725727 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888851 13:113725768-113725790 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888871 13:113725831-113725853 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888891 13:113725894-113725916 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888910 13:113725957-113725979 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888929 13:113726020-113726042 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888948 13:113726083-113726105 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888966 13:113726146-113726168 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113888984 13:113726209-113726231 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113889004 13:113726272-113726294 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113889024 13:113726335-113726357 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113889044 13:113726398-113726420 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1113889064 13:113726461-113726483 GGGCGTGCACAGGGCGGGGCCGG + Intronic
1114528085 14:23378740-23378762 GGGTCAAGCCAGGCCAGGGCTGG - Intronic
1115664754 14:35534494-35534516 GGGTGAGCCCGGGGACGGGCGGG + Exonic
1116463970 14:45211365-45211387 GGTTGAGCCCAGGATGGTGCTGG + Intronic
1117029174 14:51651694-51651716 GGTTGGGTCCAGGGCGGGGCGGG + Intronic
1117842063 14:59870477-59870499 TGGGGAGCCCAGCCCGGGGTTGG - Exonic
1118602688 14:67481731-67481753 GGGTGGGTGGAGGCCGGGGCAGG - Intronic
1119642693 14:76326993-76327015 GGGAGAGCCTAGGCCTGGGCCGG + Intronic
1120834487 14:89027541-89027563 GGATGAGCCCCGGGCGTGGCTGG - Intergenic
1121042691 14:90761855-90761877 GGCTGAACCAAGGCAGGGGCAGG - Intronic
1121281882 14:92704992-92705014 GGGAGATCCCAGGCCATGGCGGG - Intronic
1121338237 14:93090094-93090116 GGGTGAGTCTGGGCAGGGGCTGG - Intronic
1121433933 14:93906514-93906536 GGGAGAGGCCAGGCCAGGGGAGG - Intergenic
1121450614 14:94004781-94004803 GAGTGAGCCAGGGCAGGGGCAGG + Intergenic
1121755727 14:96400549-96400571 GGCAGAGCCCAGGAAGGGGCAGG - Intronic
1121877813 14:97469935-97469957 GGGTGCGCTGAGGCCAGGGCTGG + Intergenic
1122114997 14:99523183-99523205 GGGGAGGCCCAGGCTGGGGCTGG + Intronic
1122267699 14:100554356-100554378 GGCTGTGCCCAGGGCGTGGCGGG - Intronic
1122268040 14:100555835-100555857 GGGATTGCCCAGGCCTGGGCGGG - Intronic
1122302342 14:100738395-100738417 GGGTGTGCACAGGCCCGGGCGGG - Intergenic
1122400919 14:101466905-101466927 AGGTGAGACGAGGCCAGGGCAGG + Intergenic
1122660871 14:103293966-103293988 GGGAGAGGGGAGGCCGGGGCGGG - Intergenic
1122866262 14:104605309-104605331 GGGTGAGGCCAGGTGTGGGCAGG + Intronic
1122922601 14:104886155-104886177 GAGTCGGGCCAGGCCGGGGCGGG + Intronic
1123002068 14:105301022-105301044 CGGTGAGCGCAGCCCGGGACTGG + Exonic
1123684415 15:22786906-22786928 GGGGGCGCCCGGGTCGGGGCAGG + Intronic
1123737890 15:23202641-23202663 GGGTGAGCACAGGCCGGGCGCGG - Intergenic
1123866691 15:24526637-24526659 GGGTGAGACCAGGCAGGAGCAGG + Intergenic
1124289098 15:28431310-28431332 GGGTGAGCACAGGCCGGGCGCGG - Intergenic
1124294124 15:28486000-28486022 GGGTGAGCACAGGCCGGGCGCGG + Intergenic
1125485608 15:40108818-40108840 CGGCGGGCACAGGCCGGGGCGGG + Exonic
1125541146 15:40470924-40470946 GGGCGGGCCCACGCCGGGGGCGG - Intergenic
1125672868 15:41486316-41486338 GGTGGCGCCCAGGCCGGTGCGGG - Intergenic
1125730442 15:41890030-41890052 AGGTGAGGCCAGGGCTGGGCTGG + Intronic
1125903651 15:43370990-43371012 TGGAGAGCCGGGGCCGGGGCCGG - Intronic
1125929504 15:43590151-43590173 GGGTGAGTGAAGGCCGGGGGCGG - Exonic
1125942671 15:43689983-43690005 GGGTGAGTGAAGGCCGGGGGCGG - Intergenic
1126088941 15:45034783-45034805 GGGTTGGCCAAGGCCGGAGCCGG + Intronic
1128099844 15:64989745-64989767 GGCTGGGCCCGGGTCGGGGCGGG + Exonic
1128314968 15:66654679-66654701 GGGAGAGCCCAGCCCTGAGCTGG - Intronic
1128330626 15:66753269-66753291 GGGTGTGCCCAGGGAGGGGTGGG + Intronic
1128482921 15:68054863-68054885 GGGAAAGCCGAGTCCGGGGCGGG - Intronic
1128509806 15:68306477-68306499 GGGTGAGCACAGGCCCGGAGGGG - Intronic
1128788163 15:70413427-70413449 GGGTGAGCCCAATCTGGGGAGGG - Intergenic
1129271514 15:74421631-74421653 GCGGGAGCCCAGGCTGGGGCTGG - Intronic
1129330876 15:74826546-74826568 GGGCGGGCCCGGGCGGGGGCGGG + Exonic
1129333918 15:74841337-74841359 GAGTGAGCCCAGGCAGAGGGAGG + Intronic
1129691826 15:77718104-77718126 ATGTGAGCTCAGGCCTGGGCTGG - Intronic
1129717752 15:77862053-77862075 GTGGGAGCCCAGGCTGGGGTAGG + Intergenic
1129851848 15:78798035-78798057 GGGCGTGGCCAGGCCGGGCCGGG + Exonic
1130353418 15:83110000-83110022 GGGTGAGCTATAGCCGGGGCAGG - Intronic
1130461012 15:84158192-84158214 GTGGGAGCCCAGGCTGGGGTAGG - Intergenic
1130648516 15:85748882-85748904 GGGGAAGCTCAGGCCGGGGAAGG - Intronic
1131272893 15:90957502-90957524 AGGTGAGCGGAGGCGGGGGCAGG + Exonic
1131472876 15:92711429-92711451 GGGCTAGCCAAGGCCGGAGCCGG - Intronic
1131511049 15:93049731-93049753 GGGTCAGGCCAGGCAGGGGCTGG + Intronic
1132031833 15:98444831-98444853 AGGCGAGGCCAGGCCAGGGCTGG - Intronic
1132576260 16:665809-665831 GGGAGTGCCCGGGCCGGGGGCGG + Intronic
1132679132 16:1132593-1132615 GGCGGAGGCCAGGCTGGGGCCGG + Intergenic
1132839583 16:1972497-1972519 GGCTGAGCCTAGGTCGGGGCTGG + Intronic
1132865593 16:2091337-2091359 GGGTGAGACGCTGCCGGGGCGGG + Intronic
1132897742 16:2236960-2236982 GGTGGGGCCCGGGCCGGGGCGGG + Exonic
1132952581 16:2572163-2572185 GGGTGACTCCAGGCCGGGCGCGG + Intronic
1132961770 16:2628007-2628029 GGGTGACTCCAGGCCGGGCGCGG - Intergenic
1133036525 16:3036792-3036814 GGGGGAGCCGGGGCGGGGGCAGG - Intronic
1133106137 16:3510913-3510935 GGGAAAGCCCAGGCTGGAGCTGG + Intronic
1134102257 16:11460686-11460708 GGCTGAGGCCAGGCTGGGCCGGG - Intronic
1134684738 16:16150547-16150569 CTGTGAGGTCAGGCCGGGGCGGG + Intronic
1136267588 16:29130526-29130548 GGAGGGGCCCAGGCCTGGGCGGG - Intergenic
1136363892 16:29799601-29799623 GGGTGAGACCAGGCAGTGGGTGG - Intronic
1136460418 16:30407259-30407281 GGAGAGGCCCAGGCCGGGGCGGG + Intergenic
1136535057 16:30894198-30894220 GGGCGGGCCCGGGTCGGGGCGGG - Exonic
1136610318 16:31362032-31362054 GGCTGAGCAGAGGCCGGAGCAGG - Intronic
1136709478 16:32224321-32224343 GCGTGAGCACAGGCCGGGCGCGG + Intergenic
1136758431 16:32705098-32705120 GCGTGAGCACAGGCCGGGCGCGG - Intergenic
1136809677 16:33165281-33165303 GCGTGAGCACAGGCCGGGCGCGG + Intergenic
1136816153 16:33275361-33275383 GCGTGAGCACAGGCCGGGCGCGG + Intronic
1137442460 16:48508651-48508673 GGGTTGGCCAAGGCCGGAGCTGG + Intergenic
1137945656 16:52731367-52731389 GGGTTGGCCAAGGCCGGAGCCGG + Intergenic
1139483282 16:67242501-67242523 GGGTGACCCCAGGAAGGGGCCGG - Intronic
1139661783 16:68425753-68425775 GGGCCAGCCCAGGCTGGGGCTGG + Intronic
1139774909 16:69311144-69311166 GGGTGGGACAAGGCCGGGGCGGG - Intronic
1141645831 16:85367056-85367078 GGGTGAGCAGAGGCCACGGCAGG - Intergenic
1141764305 16:86048480-86048502 GGCAGAGGCCAGGCCGGGGCAGG - Intergenic
1142030520 16:87836189-87836211 TGGTGAGCCCCGGCAGGGGCGGG - Intronic
1142264035 16:89055418-89055440 GGTGGAGCCCAGGTGGGGGCTGG - Intergenic
1142367564 16:89657994-89658016 GCGCGGGCCCAGGGCGGGGCTGG + Intronic
1142378812 16:89720742-89720764 GGGTGAGGCGGGGCGGGGGCGGG - Exonic
1142429746 16:90019569-90019591 GGGCGCGCGCGGGCCGGGGCGGG - Intronic
1203060585 16_KI270728v1_random:965432-965454 GCGTGAGCACAGGCCGGGCGCGG - Intergenic
1142811405 17:2397167-2397189 GGGCGATGCCAGGCCGGTGCAGG + Intronic
1142967629 17:3591134-3591156 GGGTCAGGGCAGGCCAGGGCTGG + Intronic
1143118411 17:4593218-4593240 GGGAGAGGGAAGGCCGGGGCTGG + Intronic
1143119653 17:4598942-4598964 TGGTGGGCCAGGGCCGGGGCTGG - Intronic
1143400764 17:6640616-6640638 AGGTGGGCTCGGGCCGGGGCTGG - Exonic
1143542581 17:7578503-7578525 GATTGAGCCCTGGCTGGGGCTGG - Exonic
1143543551 17:7583226-7583248 AGGCGAGCCCAGGTCGGGGAAGG - Intergenic
1144547884 17:16215092-16215114 GGCTGTGGCCGGGCCGGGGCTGG - Intronic
1144789002 17:17847258-17847280 AGGTGAGCACAGGGCGGGGCCGG + Exonic
1144942108 17:18948870-18948892 AGGGGAGCCCAGGCAGGGTCGGG + Intergenic
1145248561 17:21285122-21285144 GTGAGGGCCCAGGCGGGGGCTGG - Intronic
1145901175 17:28491404-28491426 GGGAGAGCCCAGGTGGGGGCAGG - Intronic
1145976271 17:28986082-28986104 GGGAGGGCCCAGGCGGCGGCGGG - Intronic
1146842620 17:36166330-36166352 GGGTGTGCCCAGCCCGGCCCTGG - Exonic
1146854932 17:36254289-36254311 GGGTGTGCCCAGCCCGGCCCTGG - Exonic
1146865688 17:36334087-36334109 GGGTGTGCCCAGCCCGGCCCTGG + Exonic
1146870832 17:36378181-36378203 GGGTGTGCCCAGCCCGGCCCTGG - Exonic
1146878191 17:36429263-36429285 GGGTGTGCCCAGCCCGGCCCTGG - Exonic
1146882140 17:36450409-36450431 GGGTGTGCCCAGCCCGGCCCTGG - Intergenic
1146957133 17:36942387-36942409 GGGCGCGGCCAGGTCGGGGCGGG + Intronic
1147068557 17:37934699-37934721 GGGTGTGCCCAGCCCGGCCCTGG + Exonic
1147073716 17:37978805-37978827 GGGTGTGCCCAGCCCGGCCCTGG - Intronic
1147080080 17:38014236-38014258 GGGTGTGCCCAGCCCGGCCCTGG + Intronic
1147085237 17:38058343-38058365 GGGTGTGCCCAGCCCGGCCCTGG - Exonic
1147096029 17:38138196-38138218 GGGTGTGCCCAGCCCGGCCCTGG + Intergenic
1147101184 17:38182309-38182331 GGGTGTGCCCAGCCCGGCCCTGG - Intergenic
1147122500 17:38343827-38343849 AGGAGAGCCCAGGCAGAGGCTGG + Intronic
1147720248 17:42535597-42535619 ATGTGAGCCCAGGCCGGCGGTGG - Intergenic
1147914192 17:43877025-43877047 GGCTCAGCCCAGGTAGGGGCAGG - Intronic
1147935133 17:44006746-44006768 GAGTGAGTACTGGCCGGGGCTGG + Intronic
1147971167 17:44219716-44219738 GTGCGAGCTGAGGCCGGGGCCGG - Intronic
1148194621 17:45704429-45704451 GGGTGATCCCAGGAGGAGGCTGG + Intergenic
1148717881 17:49728725-49728747 GGCTGGGCCCAGGCCAGGGTGGG - Intronic
1148896079 17:50839993-50840015 AGGTGATCTCAGGCCGGGGCCGG - Exonic
1148930078 17:51120757-51120779 GCTGGAGCCCGGGCCGGGGCTGG + Exonic
1149647296 17:58249694-58249716 TGGTGAGGGCAGGCCGGGCCGGG + Exonic
1149772437 17:59332079-59332101 GCGGGACCCCCGGCCGGGGCGGG + Intronic
1149845782 17:60008815-60008837 GGGTGTGCCCAGCCCGGCCCTGG - Intergenic
1150084130 17:62265395-62265417 GGGTGTGCCCAGCCCGGCCCTGG - Intergenic
1150108536 17:62478951-62478973 AGGAGGGCCCAGGCCGGGCCAGG - Intronic
1150108670 17:62479297-62479319 GGCTGAGCCCCGGGCGGGGGAGG + Intronic
1150249891 17:63699639-63699661 GGGTGAGGGGAGGTCGGGGCCGG + Intronic
1151259286 17:72904140-72904162 CGGTGAGCCCAAGCCGGGCGCGG + Intronic
1151549009 17:74810660-74810682 GGGTCAGCCCATTCCTGGGCTGG + Intronic
1151666156 17:75546198-75546220 GGGGGAGCCCAGGCCAGGAGTGG + Intronic
1151763655 17:76121563-76121585 AGGCGAGCCCGGGCCGGGCCGGG + Intronic
1151906491 17:77052737-77052759 GGGTGAGCCCCGGCAGGTGCAGG + Intergenic
1151978916 17:77497839-77497861 GTGTGGGCCCTGGCCTGGGCAGG + Intronic
1152032761 17:77854219-77854241 GAGTGAGCCTTGGCCAGGGCAGG - Intergenic
1152184150 17:78843654-78843676 GCGGCAGCCCAGGCCCGGGCAGG + Intergenic
1152197291 17:78925174-78925196 GGCTGAGCCGGGGCCGAGGCGGG + Exonic
1152241026 17:79161238-79161260 GAGTGAGCCAAGGAAGGGGCCGG + Intronic
1152313070 17:79562699-79562721 GGGTGGGCCCCGGCCCCGGCTGG + Intergenic
1152423219 17:80205111-80205133 CGAGGAGCACAGGCCGGGGCCGG - Exonic
1152461477 17:80444544-80444566 GGGTGAGCCCAGCATGGGGCAGG - Intergenic
1152574070 17:81132558-81132580 GGGTGGGGCCAGGCCGGGGCTGG - Intronic
1152626120 17:81388654-81388676 GGGTGAGGCCTGGCAGGGTCTGG + Intergenic
1152721916 17:81927541-81927563 CGGCGGGCCGAGGCCGGGGCGGG + Exonic
1152735830 17:81996342-81996364 GGGTGAGCCTGGGCCGGGAGAGG + Intronic
1152794643 17:82301111-82301133 GGGTCAGGGCAGGCCGGGGCTGG + Intergenic
1152805043 17:82351714-82351736 GGGTGGGCTGAGGCCGGGCCAGG - Intergenic
1154156525 18:11948104-11948126 GTGTGAGCTCAGGACGGCGCTGG - Intergenic
1154377944 18:13824171-13824193 GGGAGAGGCCCGTCCGGGGCTGG + Intronic
1154414622 18:14170498-14170520 GGGTGGGGCCAGGGCAGGGCAGG + Intergenic
1154954854 18:21243141-21243163 AGGTGCGCCCTGGCCGGGGAGGG + Intronic
1157604157 18:48915154-48915176 TGCTGAGTCCAGGCCAGGGCAGG - Intergenic
1159101523 18:63964043-63964065 GGGTGTGGGCAGGCTGGGGCTGG - Intronic
1160033205 18:75279776-75279798 GGCAGGGCCCAGCCCGGGGCAGG - Intronic
1160044375 18:75373099-75373121 AGGTGAGCCCAGGCCTGCTCAGG + Intergenic
1160157645 18:76445775-76445797 GGAGGAGCCCAGGCCTGGTCAGG + Intronic
1160415396 18:78706394-78706416 GAGAGAGCCCAGGCTGGTGCTGG + Intergenic
1160415411 18:78706437-78706459 GGGAGAGCCCAGGCTGGTGCTGG + Intergenic
1160415426 18:78706480-78706502 GGGAGAGCCCAGGCTGGTGCTGG + Intergenic
1160415441 18:78706523-78706545 GGGAGAGCCCAGGCTGGTGCTGG + Intergenic
1160415456 18:78706566-78706588 GGGAGAGCCCAGGCTGGTGCTGG + Intergenic
1160736073 19:662979-663001 GCCTGAGGCAAGGCCGGGGCCGG - Intronic
1160739639 19:680008-680030 CGGTGCGCGCGGGCCGGGGCGGG - Intronic
1160765584 19:806170-806192 AGATGAGCCCAGGCCCGGCCCGG + Intronic
1160770187 19:827682-827704 GGGGGAGCCCAGGCTGGCCCAGG + Intronic
1160775423 19:853090-853112 GGGTGGGGGGAGGCCGGGGCCGG + Intronic
1160800035 19:963508-963530 GGGAGAGCCCTGGAGGGGGCAGG + Intronic
1160806501 19:994425-994447 AGGAGAGTCCAGGCCTGGGCTGG - Exonic
1160829947 19:1099168-1099190 GGCTGAGCCCAAGCCAGGGGCGG + Intergenic
1160842821 19:1154154-1154176 GGGTGGGCCGGGGCCGGGGGTGG + Intronic
1160851605 19:1195478-1195500 GCTTGAGCCCTGGGCGGGGCTGG + Intronic
1160852029 19:1197292-1197314 GCTTGAGCCCTGGGCGGGGCTGG + Intronic
1160894795 19:1397333-1397355 GGGTGTGGCCGGGCCGGGGTGGG + Intronic
1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG + Intronic
1161208889 19:3056230-3056252 GGGGGTGCCCAAGGCGGGGCTGG + Intronic
1161265071 19:3360075-3360097 GGGGGAGCCCGGGCCAGGGAGGG + Intronic
1161312903 19:3604573-3604595 GGGTGGGCTCAGGCCGTGACAGG - Intronic
1161337563 19:3722562-3722584 GGGTGCGCCGTGGCGGGGGCGGG + Intronic
1161400351 19:4064511-4064533 CGGGGAGGCCAGGCTGGGGCAGG - Intronic
1161408351 19:4102753-4102775 GGGCCAGCCCAAGCCGCGGCCGG + Intronic
1161461494 19:4400303-4400325 AGGTGAGCGCAGGCCCAGGCGGG - Exonic
1161497888 19:4597593-4597615 AGGGGAGCCCAGCCCGGGACTGG + Intergenic
1161572921 19:5040183-5040205 GGGTCAGCCCAGGCCGGGAGAGG - Intronic
1161605817 19:5214339-5214361 GGTGGGGCCCAGGCTGGGGCTGG - Exonic
1161663702 19:5562315-5562337 AGGTGAGCCCTGGCAGGGGCAGG - Intergenic
1161668303 19:5590249-5590271 GGGTGAGCCCCAGCCGGGTGGGG - Intronic
1161977163 19:7613127-7613149 GGGGGAGCCCCGGGTGGGGCTGG + Exonic
1162148934 19:8631370-8631392 GGGTCAGCCCAGGCAGGGCTGGG + Intergenic
1162470758 19:10871106-10871128 GGGCGTGTCCAGGTCGGGGCAGG + Intergenic
1162743118 19:12784145-12784167 GGGTCAGCCCCTCCCGGGGCAGG + Intronic
1162744139 19:12789730-12789752 GGGTTGGGCCAGGCCGGGCCTGG + Intronic
1162932480 19:13963837-13963859 AGGTGAGCGCGGGGCGGGGCGGG - Exonic
1162948890 19:14058996-14059018 TGGGGAGCCCTGGGCGGGGCTGG + Intronic
1162951112 19:14072659-14072681 GGGCGGGGCCAGGGCGGGGCGGG + Intronic
1163105730 19:15122193-15122215 GGCAGAGCCCAGGCCGGGTGCGG - Intronic
1163517937 19:17776066-17776088 GCTGGAGCCCGGGCCGGGGCAGG - Exonic
1163566040 19:18051971-18051993 GGGTCAGCCCAGGGCGGGGACGG + Intergenic
1163575715 19:18109904-18109926 GGCAGAGGCCGGGCCGGGGCGGG + Intronic
1163662821 19:18588899-18588921 GGGTGAGCCCAGGCCCAAGCGGG + Exonic
1163676849 19:18659739-18659761 AGATGAGGCCAGCCCGGGGCCGG + Intronic
1163679275 19:18671380-18671402 GGGGGAGCTCAGGTCGGGGGTGG - Exonic
1164577896 19:29416893-29416915 CGGGGAGGCCAGCCCGGGGCTGG - Intergenic
1164615316 19:29664051-29664073 GGGGTGGCTCAGGCCGGGGCAGG - Intergenic
1164836419 19:31357785-31357807 GTGGGAGCCTAGGCAGGGGCAGG + Intergenic
1165013297 19:32863980-32864002 GTGAGAGCCCAGGCAGGGCCTGG - Intronic
1165101165 19:33439470-33439492 GCGTGGGCCTAGGCCAGGGCGGG + Intronic
1165145708 19:33728728-33728750 AGGGGAGCCCAGGCCAGGGAAGG + Intronic
1165227475 19:34365129-34365151 GGGTGGGGCCGGGCCGGGCCGGG + Intronic
1165394808 19:35558325-35558347 GGGCGGGCCCAGGCCGTGGGCGG + Intronic
1165660785 19:37578642-37578664 TGGGGAGCTCAGGCGGGGGCAGG - Intronic
1165845165 19:38813232-38813254 GGGTGAGACCAGGCAGGGCAGGG + Exonic
1165861212 19:38910583-38910605 GGCTGAGCCCAGGCAGGAGAAGG - Exonic
1165925478 19:39323458-39323480 GGGTGAGGGTAGGCCTGGGCTGG + Intergenic
1166102746 19:40580781-40580803 GGGCCAGTCCAGGCGGGGGCTGG - Exonic
1166524969 19:43504914-43504936 GGGTGGGGCCGGGCCGGGGCCGG - Exonic
1166547046 19:43639894-43639916 CGGGGCGCCGAGGCCGGGGCGGG + Intergenic
1166705646 19:44906523-44906545 GGGTGAGGCCGGGTTGGGGCCGG + Intronic
1166846336 19:45730826-45730848 GTGAGAGCCCAGGCGCGGGCCGG - Intronic
1166986165 19:46661020-46661042 CGGTGAGCCCTGAGCGGGGCCGG - Exonic
1167001061 19:46746089-46746111 GGGTGAGGCCGGGCCGGGCCGGG + Exonic
1167032928 19:46975409-46975431 GGGAGGGCCCAGCCTGGGGCTGG + Intronic
1167254646 19:48419819-48419841 GTGTGGGCCCAGGGCTGGGCTGG + Intronic
1167299931 19:48672447-48672469 CAGTGAGGCCAGGCTGGGGCAGG - Intronic
1167921556 19:52786788-52786810 GACTGAAGCCAGGCCGGGGCAGG + Intronic
1168237988 19:55075756-55075778 GAGTGACCCCGGGGCGGGGCTGG - Intronic
1168294991 19:55373920-55373942 GGGTCTGCCCAGGCCAGGGTGGG + Intergenic
1168317074 19:55489090-55489112 GGGTGAGGCCAGGCCTGGATGGG - Intronic
1168645909 19:58059336-58059358 AGGGGAGGCCAGGCCGGGCCGGG + Intronic
925015835 2:523576-523598 GGCTGAGCAGAGGCCGGGGCAGG + Intergenic
925234850 2:2269070-2269092 GGGTGCACCCAGGCCTGGGCTGG + Intronic
927518804 2:23687250-23687272 GGGTGAGCCCTGCCAGGGGCAGG + Intronic
927878580 2:26674908-26674930 GGGTGAGCTCTGGCCGAAGCAGG + Intergenic
927981139 2:27375868-27375890 CGAGCAGCCCAGGCCGGGGCCGG + Exonic
928090091 2:28368569-28368591 GGGTGAGCCCAGCTCTGGCCAGG - Intergenic
928173276 2:29017234-29017256 GGAGGAGCCCAGGACAGGGCAGG + Exonic
930136011 2:47905315-47905337 GTGTCAGCCCGGGCCGGGCCCGG - Intronic
932758817 2:74426406-74426428 GGGTGGGTCCAGTCTGGGGCTGG + Exonic
932776265 2:74530009-74530031 GGCTGCGCCGAGGGCGGGGCGGG + Exonic
932798106 2:74715404-74715426 GGCTCAGGGCAGGCCGGGGCGGG + Intergenic
933847457 2:86337408-86337430 GGGCGCGCGCAGCCCGGGGCCGG + Intronic
933971419 2:87472956-87472978 GGCTGAGCACAGGCCAGGCCAGG + Intergenic
934561329 2:95315013-95315035 GGGTGGGCACAGGACGGGGACGG + Intronic
934638295 2:96010485-96010507 GGGCGGGCCCAGTGCGGGGCGGG - Intergenic
934795358 2:97094925-97094947 GGGCGGGCCCAGTGCGGGGCGGG + Intergenic
935164973 2:100562597-100562619 CTGTGATCCCAGGCCGAGGCGGG - Intergenic
935292966 2:101625401-101625423 TGGGCAGCACAGGCCGGGGCTGG + Intergenic
935342128 2:102067848-102067870 GGGTGAGGCCAGGCCGGGCACGG + Intronic
935350834 2:102150716-102150738 GGGTGACCCAAGGCCTAGGCTGG - Intronic
935692758 2:105745288-105745310 GGGGGCGCCCAGGCCGCGGCAGG - Intronic
936322311 2:111477243-111477265 GGCTGAGCACAGGCCAGGCCAGG - Intergenic
936512147 2:113157304-113157326 GGCTGAGGCCGGGCCGGGGTTGG - Intronic
937288072 2:120765550-120765572 GTCTGTACCCAGGCCGGGGCTGG + Intronic
937869358 2:126776698-126776720 GGGCGGGGCCAGGGCGGGGCCGG - Intergenic
938467553 2:131533259-131533281 AGGTGGGCTCAGGCTGGGGCGGG - Exonic
939281703 2:140073745-140073767 GGGTTGGCCAAGGCCGGAGCCGG + Intergenic
940361991 2:152805227-152805249 GGGCTAGCCAAGGCCGGAGCCGG - Intergenic
942451647 2:176112060-176112082 TGGTGTGCCCAGGCCGGGCTGGG + Intronic
944743561 2:202635036-202635058 GGGGGAGACCGGGCCGGGGCAGG - Intergenic
944901903 2:204223860-204223882 GGGAGAGGCCAGGCAGCGGCAGG + Intergenic
945664192 2:212721149-212721171 GTGGGAGCCCACGACGGGGCGGG + Intergenic
946382488 2:219358518-219358540 GGAAGAGCCCAGTCCTGGGCCGG - Intergenic
946396007 2:219444109-219444131 GGGTGAGGAGAGGCCGGGGCCGG - Intronic
946400636 2:219466666-219466688 GGCTGAGCCCTGGCCCTGGCAGG + Intronic
946422205 2:219571289-219571311 GGGCGAGCCGAGGCCCGGGGCGG + Exonic
946434310 2:219641789-219641811 GGCAGAGCCCAGCCCTGGGCTGG + Exonic
946692382 2:222319415-222319437 CGGGGCGCGCAGGCCGGGGCGGG + Intergenic
947581373 2:231321289-231321311 GAGAGAGCCAAGGCCAGGGCTGG + Intronic
947716575 2:232342773-232342795 GTGTGAGCCCAGGCTGGGCTGGG + Intronic
947749263 2:232524228-232524250 GGGTGGGGCCGGGCCAGGGCTGG - Intronic
947992204 2:234496855-234496877 GAGCGAGCCCAGGCCTGGGGAGG - Exonic
948046833 2:234951881-234951903 GGGTGGTCCCGCGCCGGGGCGGG - Intergenic
948066862 2:235087516-235087538 GGGAGAGCCCAGCCCGGAGCAGG - Intergenic
948192490 2:236070754-236070776 GGGTGGCCCTGGGCCGGGGCAGG + Intronic
948459088 2:238120566-238120588 GGGGGCGCCCAGGCGCGGGCAGG - Intronic
948531729 2:238612862-238612884 AGGTGAGCACAGGCAGGAGCTGG - Intergenic
948697374 2:239738326-239738348 GGCTGGGCCTGGGCCGGGGCTGG - Intergenic
948717393 2:239874213-239874235 GGGAGGGCCCAGGCAGAGGCAGG - Intergenic
948793084 2:240389115-240389137 AGGTGTCCCCAGGCCGGGCCAGG + Intergenic
948934079 2:241150782-241150804 GCGCGAGGCCAGGCCGGGGGTGG + Intronic
948991740 2:241559091-241559113 GGGCGGCCCCGGGCCGGGGCGGG + Intronic
949002929 2:241627825-241627847 AGGTGAGGCCAGGCCACGGCTGG - Intronic
949059303 2:241947554-241947576 CGGTAAGCCCAGGTCTGGGCAGG - Intergenic
1168790302 20:571883-571905 GGGTGGGGCGAGGGCGGGGCGGG - Intergenic
1170781276 20:19427688-19427710 GGGTCAGCCCAGGACAGGCCTGG - Intronic
1171289721 20:23975367-23975389 GGGTGGTCCCAGGCAGGGGTGGG + Intergenic
1171409361 20:24935710-24935732 GGCTGATTCCAGGCCAGGGCAGG - Intergenic
1171494887 20:25548690-25548712 GGGTCAGCCCCGGGTGGGGCTGG - Intronic
1172166071 20:32900121-32900143 GGGTGAGGCCAGGGTGGGGTTGG + Intronic
1172429351 20:34876822-34876844 GGGTGAGGCCCGGCCCGGGCGGG + Exonic
1172622944 20:36331522-36331544 GAGTGAGTCCAGGCTGAGGCTGG - Intronic
1173723532 20:45280609-45280631 GTGGGAGCCCAGGCTGGGGCAGG - Intergenic
1174040122 20:47693756-47693778 GGGAGGGCTCAGGCCGGGGCAGG + Intronic
1174204157 20:48827424-48827446 GGGAGAGCCCCGGTCGGAGCAGG + Intronic
1174423522 20:50416207-50416229 GGGAGACCCCAGACCTGGGCTGG + Intergenic
1174500621 20:50981366-50981388 GGGTGGGCACAGTGCGGGGCTGG + Intergenic
1174569717 20:51492830-51492852 AAGTGAGCGCCGGCCGGGGCTGG + Intronic
1174571920 20:51508279-51508301 GGGTGCGCCAGGGTCGGGGCTGG - Intronic
1175173400 20:57094755-57094777 GGGTGAGGACAGGATGGGGCAGG + Intergenic
1175400778 20:58698796-58698818 GGGTGGGACCAGGCTGGGGTGGG + Intronic
1175412209 20:58777753-58777775 GAGGGAGCCCAGGGCAGGGCAGG - Intergenic
1175706386 20:61180883-61180905 GTGTGAGCCCAGGCTGGGCTGGG - Intergenic
1175794662 20:61764199-61764221 GGGAGAGCACAGGCCGCCGCAGG + Intronic
1175808528 20:61845019-61845041 GGGTGGGCCCAGGGTGGGCCTGG + Intronic
1175812352 20:61865071-61865093 GGGAGAGGCCAGGCAGGGGTCGG - Intronic
1175931467 20:62495806-62495828 CCGGGAGCCCGGGCCGGGGCTGG - Intergenic
1176063487 20:63182422-63182444 GGTGGGGCCCAGCCCGGGGCTGG + Intergenic
1176161848 20:63652499-63652521 GGGCGGGCGCAGGCCCGGGCGGG - Intronic
1176178108 20:63738059-63738081 GGGTGAGCAGAGGGCGGGGCGGG + Exonic
1176182555 20:63757827-63757849 GTGTGAGCCCTGGACGGGGCGGG - Intronic
1176182581 20:63757918-63757940 GTGTGAGCTCTGGACGGGGCGGG - Intronic
1176182590 20:63757949-63757971 GTGTGAGCTCTGGACGGGGCGGG - Intronic
1176182650 20:63758161-63758183 GTGTGAGCTCTGGACGGGGCGGG - Intronic
1176182661 20:63758192-63758214 GTGTGAGCTCTGGACGGGGCGGG - Intronic
1176260464 20:64176816-64176838 GAGTGTGCCCAGCCCAGGGCAGG - Intronic
1176858403 21:13987756-13987778 GGGTGGGGCCAGGGCAGGGCGGG - Intergenic
1178060476 21:28848908-28848930 GGCAGAGCGCAGGCAGGGGCAGG - Intergenic
1178537120 21:33419828-33419850 GGCTGAGCCCCGGCAGTGGCAGG + Intronic
1179511511 21:41877040-41877062 GGATGAGCCCAGGATGGGACAGG - Intronic
1179824505 21:43956690-43956712 AGGTGAGCTGAGGCCAGGGCTGG + Intronic
1179882650 21:44299997-44300019 GGGCGGGCCCGGGGCGGGGCGGG + Intergenic
1179885291 21:44311670-44311692 GGGGGAGCCCTGGCTGAGGCTGG + Intronic
1179981233 21:44897031-44897053 GGGTCAGCGCAGGGCAGGGCTGG - Intronic
1179986046 21:44920743-44920765 GGGTCACTCCAGGCTGGGGCAGG + Intronic
1180159914 21:45994389-45994411 GGGTGAGGCGCGGCCTGGGCCGG + Intronic
1180229012 21:46415041-46415063 GGGTGAGCCCAGGTCTCAGCAGG - Intronic
1180898437 22:19353897-19353919 GGTGGAGACCAGGCCTGGGCAGG + Intronic
1180949527 22:19714879-19714901 GGGTGAGGGCCGGCGGGGGCGGG - Intronic
1180960581 22:19760681-19760703 GGGGGGGCCCCGGGCGGGGCGGG + Intronic
1181027293 22:20133325-20133347 GGGTGGGCCCAGCCCAGTGCTGG + Intronic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1181043516 22:20204016-20204038 GGGTGACTCCAGGCCTGGCCAGG - Intergenic
1181045199 22:20211039-20211061 CGGTGGGCTCAGGCCTGGGCGGG + Intergenic
1181127874 22:20712456-20712478 GGGTGGCCACAGGCCGGGGGAGG - Intronic
1181169073 22:20998239-20998261 GGGTGACCCCAGGTGGAGGCAGG - Exonic
1181276177 22:21688618-21688640 TGCTGAGCCCAGCCTGGGGCAGG - Intronic
1182283422 22:29231080-29231102 GGGGGACCCCAGAGCGGGGCAGG - Exonic
1182360515 22:29743873-29743895 GGGAGAGGCAAGGCCTGGGCTGG + Intronic
1182765812 22:32757585-32757607 GGAGGAGCCCAGGCCGGGCACGG - Intronic
1183727618 22:39598281-39598303 GGATGAGGGCAGGGCGGGGCGGG - Intronic
1183737062 22:39649981-39650003 GGGGCTGCCCAGGCCTGGGCAGG - Intronic
1184164093 22:42717308-42717330 GGGTGAGTCCATGCAGGGCCAGG - Intronic
1184296661 22:43529334-43529356 GGGTGCGCCCAGGCAGGGGAGGG + Intronic
1184337563 22:43862637-43862659 GGGTGACCCCGGCCGGGGGCGGG - Intergenic
1184430356 22:44438648-44438670 GTCTGAGCCCAGGCTGGGCCGGG + Intergenic
1184444428 22:44539145-44539167 AGGTCAGCCCAAGCCAGGGCAGG - Intergenic
1184564643 22:45284884-45284906 TGGCCAGCCCAGGCGGGGGCGGG + Intergenic
1184769086 22:46587579-46587601 CAGGCAGCCCAGGCCGGGGCGGG + Intronic
1184877298 22:47283834-47283856 GGGGGACCCTGGGCCGGGGCAGG + Intergenic
1185070086 22:48651385-48651407 GGCTGTGCCCAGGAAGGGGCAGG + Intronic
1185088919 22:48755279-48755301 GGGAGAGTCTAGGCTGGGGCTGG - Intronic
1185213577 22:49585961-49585983 GGGTGACCCCATCCCTGGGCCGG + Intronic
1185215767 22:49599201-49599223 GGGAGCTCCCAGGACGGGGCTGG + Intronic
1185217835 22:49613262-49613284 GGGTGAGCAAAGGCTGGGGTGGG - Intronic
1185340534 22:50288938-50288960 GGTTTGGCCCAGGCTGGGGCGGG - Exonic
1185409460 22:50674487-50674509 GGGGGGGCCGGGGCCGGGGCCGG - Intergenic
1185420277 22:50731056-50731078 GGGGGCGCCGGGGCCGGGGCCGG - Intergenic
950032572 3:9862436-9862458 GGGTCAGCCCCGGGCAGGGCGGG + Intergenic
950053894 3:10010788-10010810 GGGTCAGCCCGGGGCAGGGCTGG + Intronic
950097426 3:10338135-10338157 GGCTGGGCCCAGGCCTGGCCGGG - Intronic
950187891 3:10956618-10956640 GGGGGTGGCCAGGCCCGGGCAGG - Intergenic
950400955 3:12768904-12768926 GGGCGGGCCGGGGCCGGGGCCGG + Intronic
950404542 3:12796591-12796613 GCGTGAGCACGGGGCGGGGCGGG + Intronic
950415682 3:12867785-12867807 GGGTCAGCCCCGGGCAGGGCTGG + Intronic
950421757 3:12903642-12903664 GGGCGGGGCCAGGCCGGGCCTGG - Intronic
950543646 3:13626634-13626656 GGGTGGGACCAGGGAGGGGCGGG - Intronic
950673229 3:14539637-14539659 GGGTGAGCCCAGGCTGAGGCTGG + Intronic
953901427 3:46846075-46846097 GGGTGGGCCGGGGCCTGGGCCGG - Intergenic
953913809 3:46905695-46905717 TGGTGTCCCCAGGCCAGGGCCGG + Intergenic
953947831 3:47164240-47164262 GCTTGACCCCAGGCCGGGACGGG + Intergenic
954293161 3:49660397-49660419 GGCAGAACCCAGGCCTGGGCTGG - Intronic
954315916 3:49801791-49801813 GGGAGGGCCTAGGCCTGGGCAGG - Intergenic
954673406 3:52302741-52302763 GGATGACCCCAGGGAGGGGCGGG + Intergenic
954713607 3:52516590-52516612 GAGTGGGCCCAGCCTGGGGCGGG + Intronic
954795854 3:53161129-53161151 GGGCGAGGCCTGGCGGGGGCGGG + Exonic
955341819 3:58130798-58130820 GCCTGAGCCCAGCCCGGGGCCGG - Exonic
956325198 3:68044536-68044558 GGGAGAACCCAGGCCCAGGCTGG - Intronic
958592503 3:96175679-96175701 GGCTCAGCCCACGCCTGGGCCGG - Intergenic
959713982 3:109413038-109413060 GGGGGACCCCAGGCAGGGTCTGG + Intergenic
960937597 3:122913104-122913126 GGGGAGGCCCAGGCCGGGGTCGG - Intronic
961081879 3:124034161-124034183 GGGGGAGCCAAGGGAGGGGCCGG - Intergenic
961359407 3:126357535-126357557 GGGCGGGGCCAGGGCGGGGCGGG - Intergenic
961594278 3:128004874-128004896 CGCTGACCCCAGGACGGGGCTGG - Intergenic
961601039 3:128062267-128062289 GGGAGAGCCTAGGGAGGGGCAGG + Intronic
961612803 3:128153822-128153844 CGGTGAGCGCGGGCCGGGGCGGG + Exonic
962301815 3:134250394-134250416 GGGGCCGCCGAGGCCGGGGCGGG - Intronic
964118023 3:153156131-153156153 GGGCTGGCCAAGGCCGGGGCCGG - Intergenic
965220264 3:165918857-165918879 GGGCTAGCCAAGGCCGGAGCCGG - Intergenic
965901290 3:173644814-173644836 GGCTGAGGCCTGGCCAGGGCAGG - Intronic
967362451 3:188647198-188647220 GGGTGGGCCCAGGTCAGAGCTGG - Intronic
968091290 3:195899949-195899971 GGGGGAGGCAAAGCCGGGGCTGG - Intronic
968276809 3:197446528-197446550 GGGAGAGCCCAGGAAGAGGCCGG + Intergenic
968549430 4:1214587-1214609 TGGTGAGCCCAGGGTGGGGCTGG - Intronic
968556348 4:1248210-1248232 GGGCGGGCCCAGGCAAGGGCAGG + Intronic
968584274 4:1408722-1408744 GGCTGAGGTCAGGCCGTGGCAGG - Intergenic
968850394 4:3074277-3074299 GGGCGTGGCGAGGCCGGGGCGGG - Intergenic
969429823 4:7147643-7147665 TGGGGGGCCCAGGCCTGGGCAGG - Intergenic
969717984 4:8877628-8877650 GAGTGAGCCCAGGCAGGGAGAGG - Intergenic
972725766 4:41745747-41745769 GGGCGAGCCAGGGCCCGGGCGGG - Exonic
974016799 4:56655806-56655828 GGCTCAGCCCAGGCAGGGGTCGG + Intronic
974807613 4:66899870-66899892 GGGTTGGCCGAGGCCGGAGCTGG - Intergenic
975612221 4:76214017-76214039 GGGAGCGGCCAGGCCGGGCCTGG - Intergenic
978030545 4:103936727-103936749 GGGCTGGCCGAGGCCGGGGCTGG + Intergenic
981153976 4:141412543-141412565 GGGTGAGACCTGGATGGGGCAGG - Intergenic
981180354 4:141735134-141735156 TGTTGAGCCCAGGCCGGGCACGG + Intergenic
984908205 4:184649181-184649203 GCGGGAGCCTGGGCCGGGGCCGG - Intronic
985068509 4:186145239-186145261 GCGTGAGCCATGCCCGGGGCCGG - Intronic
985631839 5:1017936-1017958 GGGACAGGCCAGGCAGGGGCGGG + Intronic
985650332 5:1104599-1104621 GGGTCAACACAGGCCTGGGCGGG + Intronic
985709554 5:1420637-1420659 GGGTGACCCCACGCAGGAGCAGG + Exonic
985727554 5:1523996-1524018 GCGGGAGCGCCGGCCGGGGCGGG + Intergenic
985757842 5:1729849-1729871 GGGTGTGTCCAGGCCGGGCGAGG + Intergenic
988497558 5:31758040-31758062 AGATGAGCCCCGGCCTGGGCAGG - Intronic
993418059 5:87659996-87660018 GTGTGTGTCCAGGGCGGGGCGGG + Intergenic
995208469 5:109509724-109509746 TGGAGAGCCCAGGCCTGGGCTGG + Intergenic
995670559 5:114598177-114598199 GGGTGAGCCAAAGCGGGGGGGGG + Intergenic
996058901 5:119011298-119011320 GGCTGGGCCCAGTCCTGGGCTGG + Intergenic
997302944 5:132819763-132819785 GGGGGAGCACAGGCCGCGGCTGG - Intergenic
997470637 5:134115154-134115176 AGGTGAGCCCCCGCCGGCGCCGG + Exonic
998406257 5:141876333-141876355 GGGGGACCCTAGGCCGAGGCCGG - Intronic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
998849330 5:146338785-146338807 GGGAGAGGCCAGGCCAGGCCCGG + Intronic
999044732 5:148454814-148454836 GGGTGAGCGCAGGCCTGGCCAGG + Intronic
999300258 5:150486292-150486314 GGGTTAACCCTGGCCCGGGCCGG + Intronic
1000210945 5:159105480-159105502 GGCAGAGCCGGGGCCGGGGCTGG - Intergenic
1002051796 5:176575591-176575613 GGGTGTCCCCAGGCCAGGGCTGG + Intronic
1002059226 5:176616653-176616675 GGCCGAGCCCAGGCAGGGGAAGG - Intergenic
1002074521 5:176700188-176700210 GGGCGAGCCGAGGCTGCGGCGGG + Intergenic
1002170326 5:177371060-177371082 GGGCGGGGCCGGGCCGGGGCCGG + Intronic
1002524055 5:179806067-179806089 GGGGTCGCCCAGGCCGGCGCGGG + Intronic
1002599885 5:180348059-180348081 GGGTGAGTCCTGGCCTGGGTGGG - Intronic
1002632572 5:180591181-180591203 GGGTGTCCCCAGGCCAGGGGCGG + Intronic
1002927857 6:1615073-1615095 TGGTGCGGCCAGGCCGAGGCGGG - Intergenic
1003048971 6:2763678-2763700 GGGCGGGCCAAGGCCGGAGCTGG - Intergenic
1003116404 6:3286633-3286655 GGTGCAGCCCGGGCCGGGGCAGG + Intronic
1003882100 6:10488145-10488167 GGGCTAGCCAAGGCCGGAGCCGG - Intergenic
1003890382 6:10558837-10558859 GGATGAACCCAGGCAGAGGCAGG - Intronic
1004248411 6:14002376-14002398 GGGCTAGCCAAGGCCGGAGCCGG + Intergenic
1005725107 6:28640152-28640174 GGGCTAGCCAAGGCCGGAGCCGG - Intergenic
1005946681 6:30600981-30601003 TGGTGAGCCCACGCTGGGGGAGG + Exonic
1005993445 6:30917703-30917725 GTGTGTGGCCAGGCAGGGGCCGG - Exonic
1006132495 6:31877832-31877854 GGGAGAGCCGAGGGCTGGGCAGG + Intronic
1006474141 6:34244334-34244356 GGCTGACCCTAGGCCGGGGTGGG - Intronic
1006503649 6:34474383-34474405 TGGTGAGGCAAGGACGGGGCAGG - Intronic
1006764737 6:36494875-36494897 AGGAGAGCCCAGGCCTAGGCAGG - Exonic
1007473353 6:42104645-42104667 GGGAGAGCTCAGGCTGCGGCCGG + Exonic
1007581168 6:42960972-42960994 GGGTGAGCCCAGGCCGGGGCCGG + Exonic
1007633480 6:43285202-43285224 GGGGGACCCCGGGCCGGGCCTGG - Exonic
1007779845 6:44246516-44246538 GGGAGGGCGCCGGCCGGGGCTGG - Intronic
1008629450 6:53349122-53349144 TGGAGAGCCTAGGCCGGGGTTGG + Exonic
1009166800 6:60350708-60350730 GCGTGAGCCGAGGCAGGGCCAGG - Intergenic
1010980459 6:82364482-82364504 TGGGGAGGCGAGGCCGGGGCGGG + Intronic
1011139308 6:84134639-84134661 GGGTGAGCCAAGGCAGGGTGGGG - Intronic
1011535234 6:88369640-88369662 GGGTGAGACAAGGCCATGGCAGG + Intergenic
1012413174 6:98983436-98983458 GAGGGTGCCCAGGCAGGGGCAGG + Intergenic
1012850943 6:104446286-104446308 GGGCTGGCCCAGGCCGGAGCCGG + Intergenic
1013087380 6:106867933-106867955 GGCTGAGCCCAGAGAGGGGCAGG + Intergenic
1013271153 6:108546638-108546660 GGGTGAGCCAAGGATGGAGCAGG + Intergenic
1013466286 6:110419642-110419664 GGGTGAGCCCAGAGAGAGGCTGG + Intergenic
1014460306 6:121686822-121686844 GGGCAGGCCAAGGCCGGGGCCGG - Intergenic
1015142824 6:129955125-129955147 GGTTGAGCCCAGGCAGATGCAGG - Intergenic
1015750111 6:136550499-136550521 AGGTGAGCGCAGTCCGGGGATGG + Intronic
1017071211 6:150576813-150576835 GGGTGTGGCCAGGCTGGCGCAGG + Intergenic
1018615808 6:165685722-165685744 GGGTGAGCCCAGCCAGATGCTGG + Intronic
1018762363 6:166903535-166903557 GGGTGGGCCGAGGAAGGGGCCGG - Intronic
1019265784 7:116767-116789 GGGTGAGGCCAAGCCGGAGTGGG - Intergenic
1019301153 7:304173-304195 GGCTGAGCCCAGCCCTGGACGGG - Intergenic
1019413049 7:914909-914931 GGGTGAGCCCTGCCCTGAGCAGG + Intronic
1019424442 7:967546-967568 GGGAGTGCCCAGGCCCGGGTCGG - Exonic
1019504734 7:1385256-1385278 GGGGCAGGGCAGGCCGGGGCGGG + Intergenic
1019520745 7:1459599-1459621 GCGGGAGCCTATGCCGGGGCTGG - Intergenic
1019596049 7:1858881-1858903 GGGAGATCCCAGGTCAGGGCAGG + Intronic
1019712872 7:2525369-2525391 GGGGGAGGGCATGCCGGGGCGGG - Intronic
1019738779 7:2662783-2662805 GTGTGAGCCCAAGTCCGGGCTGG + Exonic
1020083163 7:5297125-5297147 GGGGCAGGCCAGGCCTGGGCAGG + Exonic
1022734454 7:33062885-33062907 GGGAGAGGCCAGGACGCGGCGGG + Intergenic
1022937381 7:35192880-35192902 GGGGGAGGCCAGGTTGGGGCTGG - Intergenic
1023980739 7:45068637-45068659 GGGTGTGGCCAGGGTGGGGCTGG - Intronic
1024267256 7:47616220-47616242 GGGTGTGCTCAGACTGGGGCTGG + Intergenic
1025211120 7:57020062-57020084 GGGGCAGGCCAGGCCTGGGCAGG - Intergenic
1025660835 7:63556785-63556807 GGGGCAGGCCAGGCCTGGGCAGG + Intergenic
1026827891 7:73595567-73595589 GGGTGAGACCAGGCTGGGCCTGG - Intronic
1026840380 7:73667622-73667644 TGGTGAGCCAGGGCCGGTGCTGG + Intergenic
1026846952 7:73703903-73703925 GGGGGAGCCCGGGCCTGGGACGG - Intronic
1026893558 7:73997166-73997188 GGGAGAGCCCAGGCCAGAGTTGG + Intergenic
1027189199 7:75988054-75988076 GGCTGGGCCCCGGCAGGGGCAGG - Intronic
1027233263 7:76283754-76283776 GGCTGTGCCCAGGGCGTGGCTGG + Intronic
1027237650 7:76307535-76307557 GGCAGAGCCCAGGGCAGGGCAGG + Intergenic
1028372744 7:90112722-90112744 GGGGGAGGCCAGGTTGGGGCTGG + Intergenic
1028727126 7:94100843-94100865 GGGCTGGCCTAGGCCGGGGCCGG + Intergenic
1029422229 7:100477625-100477647 GGGGGCGCCCAGGCCGAGGCTGG + Exonic
1029443613 7:100601201-100601223 GCAGGAGCCCAGGCAGGGGCAGG + Intergenic
1029495900 7:100895444-100895466 GGGGGTGCCCAGCCCGGCGCCGG + Intronic
1029833542 7:103285524-103285546 GGGGGAGGCCAGGTTGGGGCTGG - Intergenic
1030049109 7:105522307-105522329 GGGTGGGCCGGGGGCGGGGCCGG - Intergenic
1030271746 7:107675860-107675882 GGGTGCTCCCAGGCCGGGCGCGG - Intronic
1032037688 7:128531807-128531829 GGCTGAGCCCCGGGCGGGGGAGG + Intergenic
1032339597 7:131058713-131058735 GGGTTGGCCAAGGCCGGAGCTGG + Intergenic
1032792099 7:135249960-135249982 GGTTTAGGCCAGGCCAGGGCTGG + Intronic
1033345896 7:140525611-140525633 GTGTGACCCCAGGACGGGGCTGG - Intronic
1035019762 7:155794002-155794024 GGGTGTGCCCAGCCAGGGCCCGG + Intergenic
1035058215 7:156050915-156050937 GGGTGAGCCCAGGGTGGGTGAGG - Intergenic
1035244708 7:157554397-157554419 GGGTGTGGCCAGGCCGGGCAGGG + Intronic
1035245787 7:157561282-157561304 GGGAGAACCCAGGCAGGTGCTGG - Intronic
1035331240 7:158098628-158098650 GGCAGATGCCAGGCCGGGGCGGG - Intronic
1036259434 8:7228376-7228398 GGGTGCAACCTGGCCGGGGCGGG - Intergenic
1036310427 8:7680828-7680850 GGGTGCAACCTGGCCGGGGCGGG - Intergenic
1036311476 8:7686946-7686968 GGGTGCAACCTGGCCGGGGCGGG - Intergenic
1036614716 8:10379442-10379464 GGGGGAGCCCGGGCTGAGGCTGG + Intronic
1036914926 8:12796245-12796267 GGGCTAGCCAAGGCCGGAGCGGG + Intergenic
1036928705 8:12931712-12931734 GGGCTGGCCCAGGCCGGAGCCGG - Intergenic
1037901261 8:22690880-22690902 GGGTGAGCGGCGGCTGGGGCAGG + Exonic
1038245001 8:25847252-25847274 GGGTGATCGCAGGCTGGGGAGGG - Intronic
1038963785 8:32549130-32549152 GGCTGAGCCCAGCCCGGGAGTGG + Intronic
1039721863 8:40173281-40173303 GGCTGAGACCAGGCCGGGCACGG + Intergenic
1039846308 8:41328159-41328181 CTGTGAGCCCAGGCCAGGGCGGG - Intergenic
1039847836 8:41338300-41338322 GGCTGAGCCTGGGCAGGGGCGGG - Intergenic
1039881692 8:41629206-41629228 GGGAGGGCCCAGCCTGGGGCCGG + Intergenic
1040039020 8:42897379-42897401 GGGCGGACCCCGGCCGGGGCTGG + Intronic
1040552548 8:48449675-48449697 GGGACAGCCCAGGCCTGTGCCGG + Intergenic
1041383834 8:57278971-57278993 AGCTGAGCCCAGGCGGAGGCTGG - Intergenic
1041423486 8:57695007-57695029 GGGTGAGCCAAAGCAGGGTCGGG + Intergenic
1044667137 8:94642107-94642129 GGTTGGGCCCAGGCTGGGGTGGG - Intronic
1045847872 8:106658289-106658311 AGGTGTGCCTGGGCCGGGGCGGG + Intronic
1047259219 8:123241147-123241169 GGAGGGGCCGAGGCCGGGGCCGG + Intronic
1048222272 8:132552780-132552802 GGGTGAGCATGGGCTGGGGCGGG + Intergenic
1048295493 8:133210720-133210742 GGGTGAGGGCAGGATGGGGCAGG - Intronic
1048345698 8:133572642-133572664 GGCTGGGCCAGGGCCGGGGCCGG - Intergenic
1049044690 8:140140107-140140129 GGGTGAGCACACGCAGGGGCAGG + Intronic
1049279446 8:141736904-141736926 CGGTGAGGGCAGGCAGGGGCGGG - Intergenic
1049396398 8:142403063-142403085 GGCTGGGGCCTGGCCGGGGCCGG - Intronic
1049513902 8:143043571-143043593 GGGGGTCCCAAGGCCGGGGCAGG - Intronic
1049521606 8:143094310-143094332 GGGTGAGCCCTGGGCAGGTCGGG + Intergenic
1049578409 8:143400098-143400120 GGTTGGGCCCAGGCAGGGGGAGG + Intergenic
1049614042 8:143568651-143568673 TGGTGCGCCGGGGCCGGGGCGGG - Exonic
1049777441 8:144413216-144413238 GGGTGAGCGCAGGCGGGGCCTGG - Exonic
1050684115 9:8147716-8147738 GGGTGGGACCAGGCAGGGACTGG - Intergenic
1050874067 9:10613255-10613277 GGGTCCGCCCAGGCCGCGTCAGG - Intergenic
1051170447 9:14314996-14315018 GGCCGCCCCCAGGCCGGGGCTGG + Intronic
1051355936 9:16239878-16239900 GGGTGAGCCCAGGGCCAGGATGG - Intronic
1052980005 9:34441165-34441187 GCCAGAGCCCAGGCTGGGGCAGG + Intronic
1053204470 9:36174340-36174362 GGGTGAGTCCAGGCCAGGCCTGG + Intergenic
1053510989 9:38687676-38687698 AGGTGAGCCCGGGCCGCCGCAGG + Intergenic
1054820480 9:69516279-69516301 GGGCGACCCCCGGCCGGGGTAGG + Exonic
1056913969 9:90729423-90729445 GGGCCTGCCCAGGCCGGAGCCGG + Intergenic
1057191758 9:93092296-93092318 GGGTGTTCCTAGGCCAGGGCAGG - Intergenic
1057192175 9:93094405-93094427 GGGTGAGTCCAGGCTGGCTCTGG - Intergenic
1057303504 9:93899743-93899765 TGGGGAGCCCTGGCTGGGGCTGG + Intergenic
1057442513 9:95092305-95092327 GGGTGGGCCCAGGCGGGGGTGGG - Intergenic
1057560230 9:96122357-96122379 TGGTGAGCTCAGGCCTGGGGAGG + Intergenic
1057716705 9:97501674-97501696 GGGCGAGCGCAGCGCGGGGCTGG - Exonic
1058908109 9:109497964-109497986 GGGTGGGGCTCGGCCGGGGCGGG - Intronic
1060253770 9:122007225-122007247 GGCTGAGTCCAGGGCAGGGCAGG + Intronic
1060544832 9:124453683-124453705 GGGTGGGGCCGGGGCGGGGCGGG - Intronic
1060723380 9:125992626-125992648 GGGAGAGCCCTGGCCGGGGTTGG - Intergenic
1060827137 9:126693811-126693833 GGGTGAGCCGGGGCCGGGGCAGG + Exonic
1060827178 9:126693910-126693932 GGGTGAGCCTGGGCCAGGGCTGG + Intronic
1060933863 9:127504980-127505002 GGGTGGGCCCAGGCTCGGGCTGG - Intergenic
1061262941 9:129490011-129490033 GGGTGAGCCTGGACCGGGGCAGG - Intergenic
1061264001 9:129495321-129495343 GGGTGAGGGCAGGGAGGGGCTGG - Intergenic
1061307153 9:129738712-129738734 GGGTGAGCCAAGGACAGGGCTGG - Exonic
1061324133 9:129852538-129852560 AGGTGAGCCCAGGCCAGGATGGG + Exonic
1061766046 9:132882103-132882125 GGGTGGGCCTGGGCCAGGGCAGG - Intronic
1061802669 9:133120877-133120899 GGGCGAGCCCCGGACGGGGCCGG - Intronic
1061862427 9:133474930-133474952 GGGTGGGCGCCGGCCGGGGCTGG + Intronic
1061874817 9:133538423-133538445 AGGTGAGGCCCGGCCCGGGCAGG + Exonic
1061994099 9:134175354-134175376 GGCGGGGCCCAGGCGGGGGCGGG + Intergenic
1062265033 9:135683123-135683145 GGGTGTGCCCAGGTGTGGGCTGG - Intergenic
1062345592 9:136113170-136113192 GTTTGAGCCCAGGCCGGGGAGGG - Intergenic
1062443050 9:136579617-136579639 GGGGAGGCCCAGGCAGGGGCGGG - Intergenic
1062491837 9:136808491-136808513 AGGAGAGGCCAGGCCAGGGCCGG + Intronic
1062556220 9:137114432-137114454 GGGGGCGGCCGGGCCGGGGCCGG + Intronic
1062565616 9:137162738-137162760 GGGTGAGGCCTGGCCGGGCTGGG + Exonic
1062606913 9:137352584-137352606 GGGTGACCCCAGCCAGGGGTGGG - Intronic
1062623724 9:137433863-137433885 GGGTGAGCCAAGGGCGAGGCAGG + Exonic
1185460239 X:329862-329884 GGGTGAGGTGAGGACGGGGCAGG + Intergenic
1189626555 X:42903322-42903344 GAGTGAGCTCAGGCTGGGGCTGG + Intergenic
1190692351 X:52921859-52921881 GGATGAGACCAGGCCGGGCCCGG - Intergenic
1192181792 X:68920774-68920796 AGCTGAGCCCAGGCCGGGGCTGG + Intergenic
1192251350 X:69416738-69416760 GGGCCAGCCAAGGCCGGAGCTGG + Intergenic
1192261639 X:69509174-69509196 GGGAGAGGCCAGGGCGGGGAAGG - Intronic
1192502618 X:71663835-71663857 GAGGGAGCCCTGGCTGGGGCAGG - Intergenic
1192509827 X:71715220-71715242 GAGGGAGCCCTGGCTGGGGCAGG - Intronic
1192516870 X:71766333-71766355 GAGGGAGCCCTGGCTGGGGCAGG + Intronic
1192528965 X:71870329-71870351 GACGGAGCCCTGGCCGGGGCAGG - Intergenic
1194294634 X:92113203-92113225 GATTGAGCCCTGGCTGGGGCTGG + Intronic
1197000344 X:121431940-121431962 GGGCTAGCCAAGGCCGGAGCCGG - Intergenic
1197775232 X:130114451-130114473 GGGTGAGCCCAAGCCAGGTGGGG + Intergenic
1199980866 X:152919751-152919773 GGCTGAGCCCAGGGAGGGGAGGG - Intronic
1199996706 X:153030602-153030624 TGGGGAGGCCAGGCCAGGGCTGG + Intergenic
1200039229 X:153353729-153353751 GGGCTGGGCCAGGCCGGGGCAGG - Intronic
1200218861 X:154380812-154380834 GGGGGAGCCCAGGGACGGGCTGG + Intronic
1200224898 X:154411955-154411977 GAGTGGGCCCAGGCCGAGGCAGG + Exonic
1200232176 X:154449584-154449606 AGGAGAGCCCATGCTGGGGCTGG - Intronic
1200612131 Y:5337706-5337728 GATTGAGCCCTGGCTGGGGCTGG + Intronic