ID: 1007581169

View in Genome Browser
Species Human (GRCh38)
Location 6:42960973-42960995
Sequence GGTGAGCCCAGGCCGGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 703}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581158_1007581169 21 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581169 6:42960973-42960995 GGTGAGCCCAGGCCGGGGCCGGG 0: 1
1: 0
2: 4
3: 80
4: 703
1007581159_1007581169 9 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581169 6:42960973-42960995 GGTGAGCCCAGGCCGGGGCCGGG 0: 1
1: 0
2: 4
3: 80
4: 703

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581169 Original CRISPR GGTGAGCCCAGGCCGGGGCC GGG Exonic
900018770 1:172256-172278 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
900049028 1:530851-530873 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
900071258 1:772675-772697 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
900089478 1:913585-913607 CGTGAGCCAAGGCCTGGGCCTGG + Intergenic
900103340 1:972009-972031 GATGAGGCCAGGCGGGGCCCCGG + Intronic
900103799 1:973804-973826 GGAGAGCCAGGGCTGGGGCCTGG - Intronic
900127037 1:1073268-1073290 GGAGGGCCCAGGCAGGGGCAGGG + Intronic
900227428 1:1539852-1539874 GGGGAGCGCAGGCCGGGGTCGGG + Intronic
900227467 1:1539971-1539993 GGGGAGCGCAGGCCGGGGTGGGG + Intronic
900227532 1:1540129-1540151 GGGGAGCGCAGGCCGGGGAGGGG + Intronic
900227540 1:1540148-1540170 GGGGAGCGCAGGCCGGGGAGGGG + Intronic
900227548 1:1540167-1540189 GGGGAGCGCAGGCCGGGGAGGGG + Intronic
900243457 1:1627444-1627466 GGTGAGGCCTGGGAGGGGCCCGG + Exonic
900243477 1:1627495-1627517 GGTGAGGCCTGGGAGGGGCCCGG + Intronic
900243497 1:1627546-1627568 GGTGAGGCCTGGGAGGGGCCCGG + Intronic
900245093 1:1632913-1632935 GGTGCGCCCTGGCTGGGCCCCGG + Exonic
900256324 1:1700072-1700094 GGTGCGCCCTGGCTGGGCCCCGG + Intronic
900344203 1:2203386-2203408 GCTGTGCCCAGGCCTGGGCAGGG - Intronic
900366104 1:2312591-2312613 GGGGTGGCCAGGCCTGGGCCAGG - Intergenic
900387031 1:2415368-2415390 GGTGATCCCCTGCTGGGGCCAGG - Intergenic
900516858 1:3086267-3086289 GGTGCGCCCAGGGCAGAGCCAGG - Intronic
900596749 1:3483439-3483461 GGATAGCCCAGGCCGAGGGCTGG + Intergenic
900650603 1:3728272-3728294 GCTGAGCCCAGGCTGGGCCATGG + Intronic
901021792 1:6259849-6259871 GGGGAGCCCAGCCTGGGGTCTGG - Intronic
901066575 1:6497298-6497320 GGTGAGTGCAGGCGGGGACCCGG - Intronic
901506221 1:9687609-9687631 GCGGAGCCCGGGCCGGGGGCTGG - Intronic
901650859 1:10742484-10742506 GGTGAGGCCAGGCCAGGGACTGG - Intronic
901704060 1:11060214-11060236 CGTGGGGCCCGGCCGGGGCCGGG + Intergenic
901765097 1:11494969-11494991 AGTGAGGCCTGGCAGGGGCCTGG + Intronic
902220150 1:14959451-14959473 GGGCAGCCCTGGCTGGGGCCAGG - Intronic
902282342 1:15383709-15383731 GGTGAGCCCAGTCCCTGGCCTGG - Intronic
902333748 1:15743231-15743253 GGTGAGCCCGGGCCCTGGGCTGG - Intronic
902394011 1:16122604-16122626 GGTCAGGCCAGGCCAGGGTCAGG + Intergenic
902504679 1:16931397-16931419 GGTGAGGCCTGGCCGGGGACGGG + Exonic
902812505 1:18896572-18896594 GCAGGGCCCAGGGCGGGGCCTGG + Intronic
902881047 1:19371960-19371982 GGGGAGCCCAGGCCGGGGGGTGG + Intronic
902990743 1:20185809-20185831 GGAGAGCCCTGGCCGGGGCATGG - Intergenic
903448396 1:23436889-23436911 GGTGAGGGCGGGGCGGGGCCTGG - Exonic
903999042 1:27327712-27327734 AGTGAGCCAAGGCTGGGCCCAGG - Intronic
904266389 1:29320627-29320649 GCTCAGCCCAGGCCAGGGGCCGG + Intronic
904274221 1:29369748-29369770 GGTGAGCCCAGCAGGGGGCCTGG - Intergenic
904409643 1:30317714-30317736 GGTGGGCTGAGGCCTGGGCCTGG - Intergenic
904423743 1:30410341-30410363 GGTGAGCCCAGCAAGGGGCCTGG + Intergenic
904493282 1:30873144-30873166 GGTGGGGCCAGGCTGGGGACTGG + Exonic
905485463 1:38292791-38292813 GGGGATCCCAGGCAGGGGGCTGG - Intergenic
905570934 1:39004927-39004949 GGTGAGCCCAGGGCTAGGCCTGG + Exonic
906090287 1:43172659-43172681 GGCGAGTCCGGGCCGGGGGCGGG + Intronic
906117761 1:43367377-43367399 GCAGGGCCCAGGCCGGGGCGAGG + Intronic
906240911 1:44241726-44241748 GGGGAGGCGAGGCCGGGGCCTGG + Intronic
906640837 1:47439417-47439439 GGAGAGCCCTCGCCGGCGCCCGG - Exonic
906960990 1:50419383-50419405 GGTGAGGCCGCGCCGGCGCCAGG - Exonic
907160574 1:52366086-52366108 GGTGAGACAAGGCCGGGGTTTGG - Exonic
907160582 1:52366107-52366129 CGGGAGCCCAGGGCGGTGCCGGG - Exonic
907261212 1:53220239-53220261 GGTGCGGCCGGGGCGGGGCCCGG - Exonic
907277663 1:53326268-53326290 GGTGTGGCCGGGGCGGGGCCGGG + Intronic
907300703 1:53484840-53484862 GGTGAGGCCATGCCGGGCCTGGG + Intergenic
907359759 1:53904957-53904979 GGTTAGCCCAGTGCAGGGCCTGG - Intronic
907513813 1:54980844-54980866 GGTGAGCCCTGGGAGGGCCCAGG + Exonic
907540890 1:55214914-55214936 GGTGGCCCCAGCCCCGGGCCCGG - Exonic
910806261 1:91192220-91192242 GGTGAGCCCAGAGCGGGGTGGGG - Intergenic
911176163 1:94820360-94820382 CGCGAGCCGGGGCCGGGGCCGGG - Exonic
912167372 1:107057011-107057033 TCTGTGCCCAGGCCGGGGCCCGG + Exonic
912387934 1:109281828-109281850 GGAGAGCGCAGGCGAGGGCCTGG - Exonic
912932092 1:113973170-113973192 GGTGAGCAGGGGCCGGGGCAAGG - Exonic
913957650 1:143319397-143319419 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
914051960 1:144144761-144144783 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
914127237 1:144821780-144821802 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
915563117 1:156699195-156699217 GGTGACCCCAGGCCTGGCCTTGG - Intergenic
915568298 1:156729010-156729032 GTTGAGCCCCGTCCGGGTCCTGG + Exonic
916714771 1:167439537-167439559 GCTGAGCCCTTGCAGGGGCCGGG + Intronic
917981330 1:180271563-180271585 GGGGATCCCAGGCCCGGGACAGG + Intronic
918044760 1:180935218-180935240 GGTGGGCACAGGCCGAGGCGGGG + Exonic
918100322 1:181367058-181367080 GGTGGGCCCAGAGCGGGCCCTGG + Intergenic
919678436 1:200409771-200409793 GGTGGTCCCGGCCCGGGGCCCGG - Intronic
919747780 1:201019537-201019559 GCGGGGCCCAGGCCTGGGCCAGG - Intronic
919878667 1:201888609-201888631 ATTGGGCCCAGGCCGGGGGCGGG + Intergenic
920364737 1:205442149-205442171 GTGGAGGTCAGGCCGGGGCCTGG + Intronic
920377896 1:205519107-205519129 CCTGAGGCCAGCCCGGGGCCAGG - Intronic
920805730 1:209231876-209231898 TGGGGGCCGAGGCCGGGGCCAGG + Intergenic
921390411 1:214608704-214608726 ACTGAGCCCGAGCCGGGGCCTGG - Intronic
922106620 1:222518124-222518146 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
922705438 1:227788076-227788098 GGTGTGGCCAGGCGGGGGCGGGG + Intergenic
923045277 1:230350936-230350958 GGTGAGCCCTGGGCTGAGCCCGG - Exonic
923290215 1:232538179-232538201 GGTCAGGCCAGGATGGGGCCAGG + Intronic
924257513 1:242197115-242197137 GAGGAACCCAGGCCGAGGCCAGG + Intronic
924309205 1:242722409-242722431 GAGGAGCCAAGGCCGGGGCAGGG - Intergenic
924348803 1:243095690-243095712 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
924937949 1:248788325-248788347 GGTGATCCCAGGCTGGGGGCTGG - Intergenic
1062802869 10:393007-393029 GGTGACCCAAGGACGGGACCCGG + Intronic
1062858378 10:790935-790957 GGTGAGGCCAGCCAGGGGCCAGG + Intergenic
1063141167 10:3257769-3257791 GGTGAGTCCAGGCCGGGCCAGGG - Intergenic
1063429566 10:5977259-5977281 GGTGCGCGCAGGCCCAGGCCGGG - Intronic
1065727066 10:28677216-28677238 GGGGAGCCCAGCCCCGGGACCGG - Intergenic
1066727560 10:38409213-38409235 GCTGAGCCCAAGCCAGGGGCAGG - Intergenic
1067064984 10:43099096-43099118 AGTGAGCCCAAGCAGGGGCACGG - Intronic
1067068638 10:43117344-43117366 GGTGAACCCAGTCTGGGGCTGGG - Intronic
1067102476 10:43343040-43343062 GGTGGGCCCGGGGCGAGGCCGGG + Intergenic
1067878581 10:50024952-50024974 CGCGAACCCGGGCCGGGGCCTGG - Intergenic
1067893144 10:50152980-50153002 CGCGAACCCGGGCCGGGGCCTGG + Intergenic
1069527717 10:69188185-69188207 GGTTAGCCCAGCCCTTGGCCAGG + Intronic
1070160889 10:73866103-73866125 TCTGAGCCCAGGCCAGAGCCAGG + Intronic
1070398437 10:76032588-76032610 GGGGAGCCCAGGCAGAGCCCTGG + Intronic
1070777533 10:79118584-79118606 CGTGTGCCAAGGCCGGAGCCAGG + Intronic
1071333475 10:84583502-84583524 GCTTAGCACAGGCAGGGGCCAGG + Intergenic
1071561350 10:86648984-86649006 GGTGTCCCCAGGCCAGGGGCAGG + Intergenic
1071618355 10:87095469-87095491 GGCGGCCTCAGGCCGGGGCCGGG + Intronic
1072426409 10:95334417-95334439 GGTGTGCACAGGCTGTGGCCTGG - Intronic
1073138038 10:101230313-101230335 GCGGGGCCCCGGCCGGGGCCCGG - Intergenic
1073207229 10:101775708-101775730 GGTGCGCGGAGGCGGGGGCCGGG - Intronic
1074546359 10:114404608-114404630 GGCGAGCCCTGGCGGGGGCCAGG - Intronic
1075320131 10:121484938-121484960 GATGGGGCCAGGCGGGGGCCAGG + Intronic
1076066610 10:127453305-127453327 GGAGAGCCCAGCCTGGGGACAGG + Intergenic
1076142015 10:128086783-128086805 TGTGAGCCCTGGCTGGGGCATGG - Intergenic
1076364627 10:129914114-129914136 CCTGAGGCCAGGCTGGGGCCAGG + Intronic
1076556057 10:131322209-131322231 GGGGAGCCCAGGCAGGTGCCAGG + Intergenic
1076686601 10:132200983-132201005 GGTGAGCACAGGCCTGGCCGGGG + Exonic
1076724617 10:132407612-132407634 GGTGAGGCCAGGCCAGAGCCTGG - Intronic
1076749995 10:132537751-132537773 GCCGAGCCCGGGGCGGGGCCTGG - Intergenic
1076751775 10:132546914-132546936 GCAGAGCCCAGGCCTGGCCCTGG + Intronic
1076809867 10:132880839-132880861 GGTGAGCCCACGCCGCTGGCAGG - Exonic
1076810215 10:132882550-132882572 GCTGGCCCCAGGGCGGGGCCAGG + Intronic
1076837924 10:133030383-133030405 GGTGGGACCAGGCCAGAGCCGGG - Intergenic
1076877839 10:133225407-133225429 GGTGAACCCAGGCAGGGTCTCGG - Exonic
1076894365 10:133302612-133302634 GGTGAGCCCACCCCTGGGTCAGG - Intronic
1076894393 10:133302704-133302726 GGTGAGCCCACCCCTGGGTCAGG - Intronic
1076894633 10:133303932-133303954 GGTGAGCCCACCCCTGGGTCAGG + Intronic
1076913127 10:133402245-133402267 GGTGAGCCGGGGCTGGGGCTGGG + Exonic
1076975372 11:167452-167474 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
1077118384 11:895714-895736 GCTGAGCCCAGTCTCGGGCCTGG + Intronic
1077147630 11:1053056-1053078 AGAGGGCACAGGCCGGGGCCAGG + Intergenic
1077155685 11:1089888-1089910 GGAGGGCTCAGGCCTGGGCCGGG - Intergenic
1077194589 11:1272764-1272786 GGGAAGGCCAGGCCGGGCCCAGG + Intergenic
1077214439 11:1389518-1389540 GGCGAGGCCAGGGCGAGGCCGGG - Intergenic
1077224435 11:1433926-1433948 GGTGAGCCCAGGCCGGGTGGGGG - Intronic
1077382393 11:2250221-2250243 GGTGACCCCAGGGGAGGGCCAGG + Intergenic
1077411719 11:2406845-2406867 GCAGAGCCCAGGCCTGGTCCCGG + Intronic
1077459763 11:2703133-2703155 GGTGAGCCCAGGGCTGGCCTTGG + Intronic
1077535536 11:3122326-3122348 GGTGAGCCCGGGCCCGGGGAGGG - Exonic
1078771772 11:14358639-14358661 CGCGGGCCCGGGCCGGGGCCAGG - Intronic
1079689748 11:23405045-23405067 CCTCAGCCAAGGCCGGGGCCAGG - Intergenic
1081298543 11:41422259-41422281 GATTAGCCCAGGCTGGGGTCGGG - Intronic
1081611315 11:44565188-44565210 GCTGAGCCCAGGCTGGTGCGGGG + Intronic
1081812729 11:45922623-45922645 CCTGAGCCCAGGTCGGGGGCGGG + Intronic
1083176145 11:60951552-60951574 GGGGGGCCCAGCCCGGAGCCAGG - Exonic
1083293650 11:61703553-61703575 GGTGAGGGCAGGCAGAGGCCAGG + Intronic
1083306400 11:61764239-61764261 GCTGAGGCCAGGGAGGGGCCTGG + Intronic
1083340819 11:61957326-61957348 GGCGAGCCCAGGGTGGGGGCAGG + Intronic
1083571271 11:63763351-63763373 GGCGAGCACAGGGCGGGGCGGGG + Exonic
1083607346 11:63986752-63986774 TGTGCGCCCGGGGCGGGGCCTGG + Intronic
1083610331 11:64001207-64001229 GGTGAGCCCGGGCTGGACCCAGG - Intronic
1083843507 11:65317470-65317492 GGTGAGCCCCTGGCTGGGCCTGG + Intronic
1083899595 11:65637167-65637189 GGGGAGCCCAGGCCCTGGACTGG - Exonic
1083923471 11:65792605-65792627 CCAGAGGCCAGGCCGGGGCCAGG + Intronic
1083937901 11:65879969-65879991 GGTGACCCCAGGCGTGGGACTGG - Intronic
1084156762 11:67317494-67317516 GCTCAGCCCAGGCTGGGGCGGGG + Intergenic
1084258062 11:67955894-67955916 GCTCAGCGCAGGCCAGGGCCCGG - Intergenic
1084272973 11:68038898-68038920 GTTGAGCCCAGGCTGTGGCCTGG - Intergenic
1084411548 11:69008983-69009005 GCAGAGCCCAGGGTGGGGCCGGG - Intronic
1084546571 11:69817910-69817932 GGTGAGCGCAGCCCGGGCCGCGG + Intronic
1084608296 11:70185303-70185325 TGTGAGCCCACGGCTGGGCCTGG + Intronic
1084930736 11:72553708-72553730 AGTGAGCCCAGGGCTGGGGCTGG + Intergenic
1085030629 11:73269017-73269039 TGTGAGCCCAGCCCAGAGCCAGG + Intronic
1085306136 11:75487114-75487136 GGAGAGCACAGGGCAGGGCCGGG - Intronic
1085332901 11:75668038-75668060 CCGGAGCCCAGGCCCGGGCCCGG + Exonic
1085400354 11:76232359-76232381 GGTGAGAGCAGGGCGGGGCCAGG - Intergenic
1086142023 11:83510038-83510060 GGAGGACCCAGGCCAGGGCCAGG - Intronic
1088984088 11:114890252-114890274 ATTGAGCCCTGGCTGGGGCCAGG + Intergenic
1089353275 11:117833499-117833521 GGCCAGCCCAGCCCCGGGCCTGG - Intronic
1089527672 11:119107700-119107722 GGTGAGCCCCAGCCGGGACCGGG + Exonic
1089615216 11:119691316-119691338 GGTGACCCCAAGCTGGGGCTGGG - Intronic
1089622291 11:119728918-119728940 GGTGTGAGCGGGCCGGGGCCAGG - Exonic
1090778327 11:129984506-129984528 GGTGGGCCGAGGCCGAGGCAGGG - Intronic
1091730526 12:2877087-2877109 GGGGGTCCCGGGCCGGGGCCGGG + Intronic
1091759294 12:3076944-3076966 AGAGAGCCGAGGCCTGGGCCAGG + Intergenic
1091781083 12:3215016-3215038 TGGGAGCGCAGGCCAGGGCCAGG - Intronic
1092246632 12:6867702-6867724 GGTCTGGCCGGGCCGGGGCCGGG + Intronic
1094233476 12:28136085-28136107 GGAGAGCCTAGGCCTGGGCAAGG + Intronic
1094237954 12:28190361-28190383 CGTGGCCCCAGGCCGAGGCCCGG - Intronic
1096148671 12:49295584-49295606 GCTGAGCCAAGCCCGGGGCCAGG + Exonic
1096271179 12:50167369-50167391 GGCGGCCCCAGGGCGGGGCCCGG + Exonic
1096513614 12:52144978-52145000 GGTGAGCCCCGGCCTGGCCGAGG + Intergenic
1096550701 12:52369955-52369977 GCTGAGCCCAGGGCTGGGGCTGG + Intergenic
1096555437 12:52400778-52400800 TGGGACCCCAGGCCTGGGCCTGG + Intronic
1097029187 12:56079548-56079570 GGAGAGGCCCGGCCGGCGCCGGG + Intergenic
1097054304 12:56240668-56240690 GGGGAGCCCAGGGTGGGGCGTGG + Exonic
1097225665 12:57475705-57475727 GGAGAGCCCTTGCCTGGGCCGGG - Intronic
1101492645 12:105223454-105223476 GCAGAGCCCAGGAGGGGGCCAGG + Intronic
1102644622 12:114396138-114396160 GGCGAGCCGCGGCCGGGGGCGGG + Intronic
1102651778 12:114447550-114447572 GGTGAGCCCAGGCCAAGCGCTGG + Intergenic
1103074207 12:117969097-117969119 GGCGCGCCGGGGCCGGGGCCCGG - Intergenic
1103596374 12:122026682-122026704 GGTGAGGCCAGCCATGGGCCAGG + Intronic
1103952329 12:124557968-124557990 GAAAAGCCCAGGCCAGGGCCTGG + Intronic
1104760271 12:131293966-131293988 GGTGAGCACAGCCAGGGGCTGGG - Intergenic
1105472272 13:20704358-20704380 GGTGGGGCCGGGCCGAGGCCGGG + Intronic
1105738920 13:23301451-23301473 GCTGATCCCAGGGCTGGGCCAGG + Intronic
1105851265 13:24338848-24338870 GCTGCCCCTAGGCCGGGGCCGGG + Intergenic
1105896355 13:24719901-24719923 GCTGAGCTCAGGCTGGGGGCGGG + Intergenic
1106458500 13:29948281-29948303 TGTGAGCCCACCCCGGAGCCGGG + Intergenic
1106473451 13:30077843-30077865 GTTGAGCCCTGGCCAGGGGCTGG - Intergenic
1107838813 13:44435230-44435252 GGCGAGCGCGGGGCGGGGCCTGG - Intronic
1111072224 13:83184050-83184072 GGTGGGAGCAGGCAGGGGCCAGG + Intergenic
1111979651 13:95002973-95002995 AGCGATCACAGGCCGGGGCCCGG - Intergenic
1112299138 13:98214152-98214174 GGAGAGGCCAGGCAGGGGCTCGG - Intronic
1112570422 13:100588711-100588733 GCTGAGCCCGGGCGGGGGTCGGG - Intronic
1113216345 13:108045133-108045155 TGTCAGCCCAGGGAGGGGCCTGG + Intergenic
1113251063 13:108453079-108453101 GGTGAGCCCTGGGCCAGGCCTGG - Intergenic
1113778320 13:112961572-112961594 GGTGGGCTCTGGCCTGGGCCTGG - Intronic
1113967697 13:114163769-114163791 GCTGGGCCCAGGCCGAGGGCAGG + Intergenic
1117099901 14:52335376-52335398 TGAGAGCCCACGCAGGGGCCTGG + Intergenic
1117647334 14:57865863-57865885 GGAGAGCGCAGCGCGGGGCCCGG + Intronic
1117842062 14:59870476-59870498 GGGGAGCCCAGCCCGGGGTTGGG - Exonic
1118748370 14:68789983-68790005 GCCGTGCCCTGGCCGGGGCCCGG - Exonic
1119593468 14:75912058-75912080 GGTTAGCCCATCCCGTGGCCAGG + Intronic
1119642694 14:76326994-76327016 GGAGAGCCTAGGCCTGGGCCGGG + Intronic
1119703043 14:76768207-76768229 GGGGAGGCCAGGCCAGGCCCTGG + Intronic
1121086571 14:91150976-91150998 GGTGACCACAGGCTGGGTCCAGG - Intronic
1121342685 14:93114998-93115020 GGTGACCCCCGGCCCGAGCCCGG - Intronic
1121584560 14:95054481-95054503 GGTCATCCCAGGCCAGGGCCTGG + Intergenic
1121665356 14:95667691-95667713 GGTGAGCCCAGACAGGAGCAAGG - Intergenic
1122593335 14:102871181-102871203 GCTGTGCCCAGGCTGGGGCTCGG - Intronic
1122775896 14:104116876-104116898 GGTGCGCCCAGGCCAGGCGCTGG + Intergenic
1122869833 14:104633293-104633315 GGTGCTCCCAGGCCGGTGGCTGG - Intergenic
1123020871 14:105397382-105397404 TGTGAGGCCAGTCCAGGGCCAGG - Exonic
1123048306 14:105528803-105528825 CGCGCGCCCAGGCCGGGGCCCGG + Exonic
1202930731 14_KI270725v1_random:30693-30715 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1123421625 15:20140719-20140741 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
1123443430 15:20305797-20305819 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1123530851 15:21147259-21147281 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
1123802745 15:23838590-23838612 GGGAGGCCGAGGCCGGGGCCGGG - Intergenic
1123930996 15:25171612-25171634 GCTGAGCTCTGGCCGGTGCCTGG + Intergenic
1123931862 15:25175795-25175817 GCTGAGCTCTGGCCGGTGCCTGG + Intergenic
1124120384 15:26883557-26883579 GGTGAGCGCCGGGCGGGGGCGGG + Exonic
1124339815 15:28883528-28883550 TGTGAGCCAAGGTGGGGGCCTGG + Intergenic
1125262922 15:37848109-37848131 GGTGGGCCAGGGCCAGGGCCAGG - Intergenic
1125503216 15:40252356-40252378 GCTGTGGCCAGGCCAGGGCCCGG + Exonic
1125519588 15:40340447-40340469 TGAGAGCCCAGGACGGAGCCAGG - Intronic
1125541145 15:40470923-40470945 GGCGGGCCCACGCCGGGGGCGGG - Intergenic
1125730443 15:41890031-41890053 GGTGAGGCCAGGGCTGGGCTGGG + Intronic
1125903650 15:43370989-43371011 GGAGAGCCGGGGCCGGGGCCGGG - Intronic
1126049580 15:44673966-44673988 GGTGTGCCCAAGCAGGGGCATGG - Intronic
1126167081 15:45662798-45662820 GCTGAGCCCAGGGCAGGGGCAGG + Intronic
1128253456 15:66179908-66179930 GGTGAGGACAGGCCAGGACCAGG - Intronic
1128466628 15:67918198-67918220 GGTGAACCCAGGCCCGAGCAAGG - Intergenic
1129171440 15:73810545-73810567 GGTGTGCCTAGGCCTGAGCCAGG + Intergenic
1129271513 15:74421630-74421652 CGGGAGCCCAGGCTGGGGCTGGG - Intronic
1129470452 15:75750786-75750808 AGTGAAACCAGGACGGGGCCAGG + Intergenic
1129691825 15:77718103-77718125 TGTGAGCTCAGGCCTGGGCTGGG - Intronic
1129710674 15:77819041-77819063 GGTGAGGCGGGGCCGCGGCCTGG + Intronic
1131074511 15:89486777-89486799 AGTGAGCGCAGGGCGGGCCCCGG - Exonic
1131254398 15:90852552-90852574 GATGTGCCCAGGCCAGCGCCTGG + Intergenic
1131508608 15:93036613-93036635 GGTGAGCAGAGGGTGGGGCCAGG - Intronic
1132031832 15:98444830-98444852 GGCGAGGCCAGGCCAGGGCTGGG - Intronic
1132393242 15:101454019-101454041 GGGGAGTCCAGGAGGGGGCCTGG - Intronic
1132576261 16:665810-665832 GGAGTGCCCGGGCCGGGGGCGGG + Intronic
1132590410 16:724014-724036 GTTGAGCCCAGGATGAGGCCTGG + Intronic
1132603491 16:784112-784134 GGGGAGGGGAGGCCGGGGCCAGG + Intergenic
1132655260 16:1039294-1039316 GGTGGGACCAGGCCGGCCCCAGG - Intergenic
1132679133 16:1132594-1132616 GCGGAGGCCAGGCTGGGGCCGGG + Intergenic
1132719734 16:1309773-1309795 GGTGAGCGCGTGCGGGGGCCGGG + Intronic
1132726641 16:1341758-1341780 GCTCTGCCCAGGCCGGGGTCAGG - Intronic
1132745930 16:1436297-1436319 GGTGAGCCCGGTGCTGGGCCAGG + Intronic
1132760631 16:1507070-1507092 GGTTAGCACAGGCCGGCGCCCGG - Intronic
1132803856 16:1766807-1766829 GGTGACCCCAGACCGAGGGCCGG + Intronic
1132892197 16:2209915-2209937 GCTGGGCGCAGGCCCGGGCCAGG - Intronic
1133020905 16:2966603-2966625 GGTGACCCCAGGGCAGGGGCTGG - Intronic
1133156754 16:3881047-3881069 CGAGAGCCCAGCCCGCGGCCAGG - Intergenic
1133784260 16:8963070-8963092 CGGGAGGCCAGGCCGAGGCCCGG + Intronic
1136284535 16:29233323-29233345 GGGGAGGCCAGGCCAGGTCCCGG + Intergenic
1136478378 16:30526751-30526773 GTGCAGCCCAGCCCGGGGCCGGG - Intronic
1136863211 16:33714918-33714940 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1136891521 16:33975574-33975596 CGCGGGCCCCGGCCGGGGCCGGG + Intergenic
1138178697 16:54928748-54928770 GGTGAGCCCCCGCCCGGGCCAGG - Intergenic
1138550192 16:57743657-57743679 TGTGAGCCAGGGCAGGGGCCCGG - Intronic
1138647564 16:58436105-58436127 GCAGAGCCCAGGCCCAGGCCGGG - Intergenic
1139388243 16:66588335-66588357 GGCGAGGCCAGGGCAGGGCCTGG + Intergenic
1139483281 16:67242500-67242522 GGTGACCCCAGGAAGGGGCCGGG - Intronic
1139546581 16:67652708-67652730 GGTCAGCCCGGGGCGGGACCTGG + Intronic
1139661784 16:68425754-68425776 GGCCAGCCCAGGCTGGGGCTGGG + Intronic
1139761442 16:69187418-69187440 CGGGAGCCCAAGCCGCGGCCTGG + Exonic
1139774908 16:69311143-69311165 GGTGGGACAAGGCCGGGGCGGGG - Intronic
1139946933 16:70648022-70648044 GGTGAGGCCAGGCTGGGAGCTGG + Intronic
1141422531 16:83926145-83926167 GGGGAGGCCAGACCAGGGCCAGG - Exonic
1141463435 16:84191648-84191670 GGTGAGGCCGGGCCGGGGCATGG + Exonic
1141633925 16:85303801-85303823 GGTGAACACAGGCCCTGGCCTGG + Intergenic
1141805811 16:86340835-86340857 GGAGAGCCCAGCCTGGGGGCAGG - Intergenic
1141996378 16:87638830-87638852 GGTGACGCCAGGCTGGGGTCAGG - Intronic
1142030519 16:87836188-87836210 GGTGAGCCCCGGCAGGGGCGGGG - Intronic
1142150516 16:88510619-88510641 GGTGAGCCCAGCCAGGGGAATGG - Intronic
1142444888 16:90130207-90130229 GCTGAGCCCAAGCCAGGGGCAGG - Intergenic
1203081511 16_KI270728v1_random:1148032-1148054 CGCGGGCCCCGGCCGGGGCCGGG - Intergenic
1203124703 16_KI270728v1_random:1563071-1563093 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1142462623 17:105259-105281 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
1142480562 17:215927-215949 GGTGAGGTCAGGCCAGAGCCTGG - Intronic
1142480593 17:216026-216048 GGTGAGGTCAGGCCAGAGCCCGG - Intronic
1142480613 17:216092-216114 GGTGAGGTCAGGCCAGAGCCCGG - Intronic
1142480633 17:216158-216180 GGTGAGGTCAGGCCAGAGCCCGG - Intronic
1142480653 17:216224-216246 GGTGAGGTCAGGCCAGAGCCCGG - Intronic
1142593692 17:1019374-1019396 TCTGAGGCCAGGCCTGGGCCAGG + Intronic
1142764000 17:2055890-2055912 GTAGGGCCCAGGCCGAGGCCGGG + Intronic
1142811925 17:2399586-2399608 GGTGCCCAGAGGCCGGGGCCCGG + Intronic
1142876244 17:2853516-2853538 GGGGAGGCAGGGCCGGGGCCGGG + Intronic
1143022755 17:3925247-3925269 AGAGACCCCAGGACGGGGCCCGG + Intronic
1143023152 17:3926995-3927017 GGTGAGGCCCGGCAGGGGCAAGG - Intronic
1143032634 17:3976419-3976441 GGTGCTCCCAGGCCTGGGGCTGG + Intergenic
1143107883 17:4538461-4538483 AGTGACCCCAGGGGGGGGCCAGG + Exonic
1143119652 17:4598941-4598963 GGTGGGCCAGGGCCGGGGCTGGG - Intronic
1143323058 17:6080532-6080554 GGCGAGCACAGGCAGGTGCCAGG + Exonic
1143400763 17:6640615-6640637 GGTGGGCTCGGGCCGGGGCTGGG - Exonic
1143543550 17:7583225-7583247 GGCGAGCCCAGGTCGGGGAAGGG - Intergenic
1143655072 17:8289157-8289179 GGTGAGACCACGCACGGGCCGGG + Exonic
1144789003 17:17847259-17847281 GGTGAGCACAGGGCGGGGCCGGG + Exonic
1144816693 17:18039902-18039924 GGTGAGCGCCGGGCCGGGCCGGG + Exonic
1144942109 17:18948871-18948893 GGGGAGCCCAGGCAGGGTCGGGG + Intergenic
1144950503 17:18991203-18991225 TCTGAGCCCAGGACGGGGCCTGG + Intronic
1145077357 17:19867306-19867328 GGTGAGCGCCGGCCGGGGCGAGG - Exonic
1145190727 17:20841161-20841183 CCTGAGCCCAAGCCGGGGCCTGG + Intronic
1145328222 17:21849281-21849303 GGGGTGCACAGGCCAGGGCCTGG + Intergenic
1145348424 17:22056784-22056806 GGGGTGCACAGGCCAGGGCCTGG - Intergenic
1145783520 17:27579311-27579333 GCTGGGCCCAGGCAGGGCCCAGG - Intronic
1146398517 17:32486833-32486855 GGCGAGACCAGGCCGGAGCGTGG + Exonic
1146901491 17:36592156-36592178 GGTGAGGCCGGGCCGAGGGCGGG + Exonic
1147862876 17:43533837-43533859 GGTGAGCCCCAGCCTGGACCTGG - Exonic
1148018762 17:44540058-44540080 GGGGAGCCAGGGCTGGGGCCAGG + Intergenic
1148466268 17:47866916-47866938 GGTGAGCAGAGGGCAGGGCCAGG + Intergenic
1148486102 17:47991741-47991763 AGGGAGCCCAGGCAGGGGACAGG + Intergenic
1148688911 17:49515548-49515570 GGAGCTCCCAGGCCTGGGCCAGG - Intergenic
1148735601 17:49863003-49863025 GGGGATCCCAGGACGTGGCCAGG + Intergenic
1148738797 17:49880442-49880464 GGGGACCCCAGGACGGGGGCAGG - Intergenic
1149647297 17:58249695-58249717 GGTGAGGGCAGGCCGGGCCGGGG + Exonic
1149994317 17:61399073-61399095 GGAAAGCTCAGGGCGGGGCCCGG + Intergenic
1150613712 17:66753183-66753205 GGAGAGCCCAGCCTGGGGACTGG - Intronic
1150643318 17:66964079-66964101 GGTGGGGCCTGGCCCGGGCCTGG + Intergenic
1150812900 17:68370564-68370586 GCTGAGCCCAGGCTGGGGTGTGG + Intronic
1151679389 17:75615600-75615622 GGTGAGCGCTGGCAGGGCCCTGG + Intergenic
1151906492 17:77052738-77052760 GGTGAGCCCCGGCAGGTGCAGGG + Intergenic
1152008327 17:77696015-77696037 GGGGAGCCCAGGAAGGGGGCAGG - Intergenic
1152310223 17:79545455-79545477 GGAGAGGCCAGGCAGGGGCAAGG - Intergenic
1152423218 17:80205110-80205132 GAGGAGCACAGGCCGGGGCCGGG - Exonic
1152461476 17:80444543-80444565 GGTGAGCCCAGCATGGGGCAGGG - Intergenic
1152565461 17:81098255-81098277 TGGGAGCACAGTCCGGGGCCTGG + Intronic
1152574069 17:81132557-81132579 GGTGGGGCCAGGCCGGGGCTGGG - Intronic
1152637251 17:81435187-81435209 GGTGAGCTCAGGCCTGGGGGTGG + Intronic
1152664225 17:81558089-81558111 GGCGTGGCCAGGCCGGGGCATGG - Exonic
1152721917 17:81927542-81927564 GGCGGGCCGAGGCCGGGGCGGGG + Exonic
1152838626 17:82551887-82551909 GGGGAGCCCATTCCTGGGCCTGG + Intronic
1153226864 18:2906560-2906582 GGGGACCCCTGCCCGGGGCCGGG - Intronic
1153815106 18:8784571-8784593 GGTGCGCCCTTACCGGGGCCTGG + Exonic
1154070274 18:11147287-11147309 GGTGTGGCCAGGCGGGGTCCCGG - Intronic
1154208310 18:12356558-12356580 GGAGAGCTCAGGCCAGGGACTGG + Intronic
1154216498 18:12420280-12420302 GGTGAGCAAGCGCCGGGGCCGGG - Intronic
1154338685 18:13485595-13485617 GGTGATCCCAGGCCACGCCCCGG - Intronic
1155057867 18:22200808-22200830 CGTGGGCTCAGGCCAGGGCCAGG - Exonic
1157449419 18:47774055-47774077 GATGAGCCCAGGCCTGGACCAGG - Intergenic
1157504912 18:48219279-48219301 GGAGAGCCCAGGGCAGTGCCTGG - Intronic
1157522265 18:48353518-48353540 GCTGAGCCCAGGCTGCAGCCTGG - Intronic
1157539771 18:48492275-48492297 GCTGAGACCAGGCTAGGGCCCGG - Intergenic
1157625941 18:49051291-49051313 GGTGAGCCCAGGCTGGGGACAGG + Intronic
1157799953 18:50611004-50611026 GGTGTGTCCAGCCCTGGGCCAGG + Intronic
1159915244 18:74182534-74182556 GGAGAGCCCAGCCCGGCCCCGGG - Intergenic
1160163218 18:76491281-76491303 GGAGGGCCGGGGCCGGGGCCGGG - Intronic
1160365138 18:78318152-78318174 TGGGAGCCCATGCTGGGGCCAGG - Intergenic
1160385832 18:78495709-78495731 GCAGAGCCCAGGCGGGCGCCCGG + Intergenic
1160404963 18:78639077-78639099 GGTGAGGCCAGGCCTGCTCCTGG - Intergenic
1160631215 18:80247436-80247458 AGCGAGCGCGGGCCGGGGCCGGG - Exonic
1160652328 19:237635-237657 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
1160668391 19:344396-344418 GCGGGGCCCGGGCCGGGGCCGGG + Intronic
1160678655 19:403815-403837 GGTGAGCCCCAGTCAGGGCCTGG - Intergenic
1160726151 19:618676-618698 GGGGGGCCCGGGCTGGGGCCTGG - Intronic
1160736071 19:662978-663000 CCTGAGGCAAGGCCGGGGCCGGG - Intronic
1160739638 19:680007-680029 GGTGCGCGCGGGCCGGGGCGGGG - Intronic
1160740985 19:685740-685762 GGTGGTCCCAGGCAGGGGGCCGG + Exonic
1160775424 19:853091-853113 GGTGGGGGGAGGCCGGGGCCGGG + Intronic
1160807750 19:1000204-1000226 GGTGACACCTGGCGGGGGCCGGG - Intergenic
1160813817 19:1026441-1026463 GCTGTGCCCAGGCGGGGGTCCGG + Intergenic
1160826406 19:1082414-1082436 GGTGGGGCGAGGCTGGGGCCAGG + Intronic
1160919481 19:1513092-1513114 GGCGCGCCCAGGCCCGGGTCAGG + Exonic
1160935415 19:1592421-1592443 GCGGGGCCCAGGCCGCGGCCCGG + Intronic
1160995780 19:1881430-1881452 CCTGAGCCCGAGCCGGGGCCTGG - Exonic
1161101868 19:2425493-2425515 GGTGAGCCCCGCCCCGGCCCAGG + Exonic
1161233307 19:3186295-3186317 GGGCAGCCCAGGCCGGAGCTAGG - Intronic
1161346094 19:3769547-3769569 GGGGAGCCCAGGCTGGAGACGGG + Exonic
1161400230 19:4064064-4064086 GCAGAGCCCAGCCTGGGGCCTGG - Intronic
1161400350 19:4064510-4064532 GGGGAGGCCAGGCTGGGGCAGGG - Intronic
1161408352 19:4102754-4102776 GGCCAGCCCAAGCCGCGGCCGGG + Intronic
1161477316 19:4493893-4493915 GGAGCGCCCCGGCAGGGGCCAGG - Intronic
1161572920 19:5040182-5040204 GGTCAGCCCAGGCCGGGAGAGGG - Intronic
1161586273 19:5107486-5107508 GGTGAGAACAGTCAGGGGCCTGG + Intronic
1161724264 19:5919265-5919287 GGTGGGCCCAGGCCAGGCGCAGG - Intronic
1161901194 19:7120851-7120873 GGTGAGCGCAGACGTGGGCCAGG - Intronic
1161962460 19:7530143-7530165 GGTGACCGCAGCCCGGGACCCGG + Intronic
1162035045 19:7934067-7934089 GGTGAGCCCAGTCCTGGGCTAGG - Exonic
1162109072 19:8390536-8390558 GCTGGGCCCAGGCCGGAGCCCGG + Intronic
1162112872 19:8410143-8410165 GTTGAGTCCAGGCCTGGGGCAGG + Intronic
1162301893 19:9849204-9849226 GGGGAGCCCAGGCCTGGCCTCGG + Exonic
1162779573 19:12999927-12999949 GGTGTGCCCAGGTGTGGGCCGGG + Intronic
1162932479 19:13963836-13963858 GGTGAGCGCGGGGCGGGGCGGGG - Exonic
1163128449 19:15257213-15257235 GGTGATGCTAGGCCGCGGCCTGG - Intronic
1163325376 19:16600085-16600107 GGTGGGCCTGGGCCTGGGCCTGG - Intronic
1163334385 19:16661341-16661363 GGTGAGCCGGGGCGGGGGGCTGG + Exonic
1163392168 19:17037343-17037365 GGTGAGCACAGGCGGAGGGCAGG + Intergenic
1163566041 19:18051972-18051994 GGTCAGCCCAGGGCGGGGACGGG + Intergenic
1163672406 19:18636822-18636844 GGTGGGTCCAGGGCGGGGCCTGG - Intergenic
1163703451 19:18798783-18798805 CAGGAGCCCAGGCCAGGGCCGGG + Intergenic
1164939738 19:32243365-32243387 GGTGAGCAAAGGCTGGAGCCAGG - Intergenic
1165145709 19:33728729-33728751 GGGGAGCCCAGGCCAGGGAAGGG + Intronic
1165305926 19:35002747-35002769 GGTGAGCCCAGTGCGGGCACGGG + Intronic
1165351255 19:35277226-35277248 GCTGAGCCCAGTGCAGGGCCTGG + Intronic
1165394809 19:35558326-35558348 GGCGGGCCCAGGCCGTGGGCGGG + Intronic
1165448317 19:35868783-35868805 GGTGAGGCCGGGCCGGGTCCTGG + Exonic
1165660784 19:37578641-37578663 GGGGAGCTCAGGCGGGGGCAGGG - Intronic
1165837729 19:38769949-38769971 GGCGCGCCCAGGCTTGGGCCTGG - Intergenic
1166042876 19:40213878-40213900 CGTGGGCCCCGGCCTGGGCCTGG + Exonic
1166101518 19:40574173-40574195 GGGTAGCCCAGGCCGCGGCCAGG + Intronic
1166317888 19:41998901-41998923 GGCGGGGCCAGGCCGCGGCCGGG + Exonic
1166330627 19:42076241-42076263 GGGGAGCCGTGGCCCGGGCCCGG + Intronic
1166335388 19:42103183-42103205 GGGGAGGCCAGGCCAGGGGCTGG - Intronic
1166366597 19:42281193-42281215 GGTGAGCTGAGGCGGGGACCCGG + Intronic
1166384188 19:42370969-42370991 GGAGCGCCCAGGCTGGGGTCAGG + Intronic
1166547047 19:43639895-43639917 GGGGCGCCGAGGCCGGGGCGGGG + Intergenic
1166702667 19:44891281-44891303 GCGGAGCCCAGGCCGGGAGCAGG + Exonic
1166705647 19:44906524-44906546 GGTGAGGCCGGGTTGGGGCCGGG + Intronic
1166846335 19:45730825-45730847 TGAGAGCCCAGGCGCGGGCCGGG - Intronic
1167052273 19:47086518-47086540 AGGCAGCCGAGGCCGGGGCCGGG - Exonic
1167268069 19:48493310-48493332 GCGGAGCCCAGGGCGGGGCCTGG - Intronic
1167667513 19:50831423-50831445 GGTGGCCCCAGGAGGGGGCCAGG - Intronic
1167673569 19:50870683-50870705 CGTGGTGCCAGGCCGGGGCCTGG + Intronic
1167720899 19:51179643-51179665 GGGGTGCCCATGCAGGGGCCTGG + Intergenic
1167859180 19:52269544-52269566 GGAGAGGCCGGGCCGGGGCGTGG - Intergenic
1168465153 19:56595585-56595607 GCTGAGGAGAGGCCGGGGCCAGG + Intronic
1168489377 19:56795402-56795424 GGGTAGCCCAGCCAGGGGCCTGG - Intronic
1202691359 1_KI270712v1_random:97185-97207 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
925015836 2:523577-523599 GCTGAGCAGAGGCCGGGGCAGGG + Intergenic
925185344 2:1842977-1842999 GGTGTTCCCAGCCCGGGGGCCGG - Intronic
925234851 2:2269071-2269093 GGTGCACCCAGGCCTGGGCTGGG + Intronic
925258220 2:2507661-2507683 GGGGAGGGCAGGCCGTGGCCAGG - Intergenic
925432503 2:3807341-3807363 AGTGTGCCCAGGCAGGGGGCTGG + Intronic
926112028 2:10189576-10189598 GGGGAGCTCAGGCCAGGGGCTGG + Intronic
926679398 2:15652459-15652481 GGAGAGACCATGGCGGGGCCTGG - Intergenic
926801449 2:16664297-16664319 GCTGGGCCCAGGCTGGGGGCTGG - Intronic
927095932 2:19747696-19747718 CGGGAGCCCAGGCTGAGGCCAGG - Intergenic
927514259 2:23662727-23662749 GGTGGGCCCAGGCTGGGGAGAGG - Intronic
927574560 2:24190553-24190575 GGTGAGCAGAGGCCTGGGGCGGG + Exonic
927702741 2:25278147-25278169 GGTGACCCTGGGCCTGGGCCAGG - Intronic
927981140 2:27375869-27375891 GAGCAGCCCAGGCCGGGGCCGGG + Exonic
929891998 2:45925907-45925929 GGTTATCCCTGGCCTGGGCCAGG - Intronic
930028624 2:47044938-47044960 GGTGAGGCCAGGCCTGCCCCTGG - Intronic
933775640 2:85769724-85769746 GCTGAGCCCAGGCCTCGGACAGG + Intronic
933782170 2:85810562-85810584 GGTCAGACAAGGCCTGGGCCTGG - Intergenic
933847458 2:86337409-86337431 GGCGCGCGCAGCCCGGGGCCGGG + Intronic
933955031 2:87356765-87356787 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
934239222 2:90252979-90253001 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
934273963 2:91563719-91563741 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
934461663 2:94216333-94216355 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
934561330 2:95315014-95315036 GGTGGGCACAGGACGGGGACGGG + Intronic
934947740 2:98554223-98554245 GCTGAGCCCAGGCCAGGGGCTGG - Intronic
934972288 2:98773290-98773312 GCTGGGGCCAGGCTGGGGCCAGG + Intergenic
935105776 2:100042067-100042089 GGTGGGGCCGGGCCGGGGGCTGG - Intronic
935292967 2:101625402-101625424 GGGCAGCACAGGCCGGGGCTGGG + Intergenic
935692738 2:105745227-105745249 GGTGCGCCCGGGAAGGGGCCAGG + Intronic
935692757 2:105745287-105745309 GGGGCGCCCAGGCCGCGGCAGGG - Intronic
936105871 2:109623883-109623905 GGAGAGCCCAGGATGGGGTCTGG + Intergenic
936614830 2:114037955-114037977 GGAGAGCCCAGACCTGTGCCTGG + Intergenic
937869357 2:126776697-126776719 GGCGGGGCCAGGGCGGGGCCGGG - Intergenic
938301147 2:130213762-130213784 GGGGAGACCAGGCCGGGGAGAGG - Intergenic
938487381 2:131724297-131724319 GCGGAGCCCAGGCCGGGAGCAGG - Intronic
942044859 2:172094544-172094566 GGTCTGCCCATCCCGGGGCCCGG - Intergenic
942314062 2:174682477-174682499 GGTGAGCTCAGCCCGAGGCGCGG + Intronic
942455654 2:176136694-176136716 GGTGGGGCCAGGCCGGGCGCCGG - Intergenic
945290709 2:208124443-208124465 GGTGAGCCCAGCCTGCGCCCCGG - Exonic
946202144 2:218076636-218076658 GGTGTGCCCAGTCCAGGGCCTGG - Intronic
946382487 2:219358517-219358539 GAAGAGCCCAGTCCTGGGCCGGG - Intergenic
946396006 2:219444108-219444130 GGTGAGGAGAGGCCGGGGCCGGG - Intronic
947518738 2:230828482-230828504 GCTGAGCCCTGGGTGGGGCCAGG - Intergenic
947519016 2:230829511-230829533 GGGGAGTCCACGCCTGGGCCGGG - Intergenic
947622076 2:231597290-231597312 GGCCAGGCCAGGCCAGGGCCAGG + Intergenic
947622079 2:231597297-231597319 GGTGAGCCCTGGCCCTGGCCTGG - Intergenic
947749229 2:232524121-232524143 GGAGAGCCAGGGCGGGGGCCAGG - Exonic
948809236 2:240466436-240466458 GGCGAGGCCAGGCCTGGGGCTGG - Exonic
948867378 2:240782782-240782804 AGGCAGCCCAGGCCTGGGCCCGG - Intronic
949002928 2:241627824-241627846 GGTGAGGCCAGGCCACGGCTGGG - Intronic
949035898 2:241815638-241815660 GGTGAGGCCTGGCCAGGCCCTGG - Intronic
1168972869 20:1942744-1942766 GCTGAACCCAGCCCAGGGCCTGG + Intergenic
1170629941 20:18057513-18057535 GGTGAGCGCGCGCGGGGGCCGGG - Exonic
1171173578 20:23035395-23035417 GGCGGGCCCAGGGCGGGGGCTGG - Exonic
1171460173 20:25293646-25293668 GGGCATCCCAGGACGGGGCCCGG - Intronic
1172009456 20:31837945-31837967 GTTGAGCCCAGCTCTGGGCCTGG + Intergenic
1172647398 20:36479526-36479548 AGTGAGCCAGGGCAGGGGCCTGG + Intronic
1174377133 20:50133544-50133566 GGTGGACCCAGGCCAGGGGCAGG + Intronic
1174378518 20:50141756-50141778 GGGAAGCCCAGGCAGGAGCCAGG - Intronic
1174397562 20:50257274-50257296 GGTGAGCCCAGCCCTGCGCCTGG + Intergenic
1174569718 20:51492831-51492853 AGTGAGCGCCGGCCGGGGCTGGG + Intronic
1175280642 20:57801823-57801845 TGTGCGCCCAGCCCAGGGCCAGG - Intergenic
1175443781 20:59007211-59007233 GCTGGGCCGAGGCCGAGGCCGGG - Exonic
1175812351 20:61865070-61865092 GGAGAGGCCAGGCAGGGGTCGGG - Intronic
1175818519 20:61896147-61896169 GGTGAGGCCAGGGTGCGGCCAGG + Intronic
1175826147 20:61937660-61937682 GAGGAGCTCAGGCAGGGGCCTGG + Exonic
1175875578 20:62227804-62227826 GGTCAGCATAGGCAGGGGCCTGG + Intergenic
1175931466 20:62495805-62495827 CGGGAGCCCGGGCCGGGGCTGGG - Intergenic
1175945233 20:62555547-62555569 GGGGTGCCCAGGCAGGGACCTGG - Intronic
1176143474 20:63555110-63555132 AGGGCGCCCAGGCCTGGGCCCGG - Exonic
1176144575 20:63559867-63559889 GGTGAGGCCAGGGCTGGGCTAGG - Intronic
1176147534 20:63572151-63572173 GGTGCTCCCAGGGCAGGGCCTGG + Exonic
1176178109 20:63738060-63738082 GGTGAGCAGAGGGCGGGGCGGGG + Exonic
1176382197 21:6119114-6119136 GAGGAGGCCAGGCAGGGGCCGGG + Exonic
1176592752 21:8659316-8659338 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1176865887 21:14054962-14054984 GGTCAGGCCAGGGAGGGGCCAGG - Intergenic
1179491818 21:41745967-41745989 GGTGAGCTCAGGCTGGGCCGAGG - Intronic
1179741275 21:43419125-43419147 GAGGAGGCCAGGCAGGGGCCGGG - Exonic
1179824506 21:43956691-43956713 GGTGAGCTGAGGCCAGGGCTGGG + Intronic
1179875799 21:44266797-44266819 GCTGGGCCCAGGCCAAGGCCAGG - Intergenic
1179929402 21:44557534-44557556 GCTGAGCCCAGGGAGAGGCCGGG + Intronic
1179976879 21:44873433-44873455 GGTGGGTCCAGGTCGGGGTCGGG - Intronic
1180057079 21:45364614-45364636 TGTGAGCTCAGCCCGGGACCTGG + Intergenic
1180159915 21:45994390-45994412 GGTGAGGCGCGGCCTGGGCCGGG + Intronic
1180205283 21:46255916-46255938 TGTGAGGCCAGGGCTGGGCCTGG - Intronic
1180275605 22:10636458-10636480 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1180550083 22:16531398-16531420 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1180858720 22:19064543-19064565 GCTGAGCGCAGGCAGGGGGCTGG - Intronic
1180876049 22:19175722-19175744 GGTGAAGCCAGGCCGAGGCCCGG + Exonic
1180980704 22:19876817-19876839 GCTGTGGCCAGGCCGGGGTCTGG + Intronic
1180984033 22:19893584-19893606 CCTGTGCCCAGGCCTGGGCCGGG - Intronic
1181028911 22:20140708-20140730 GGTGAGGCCCGGCCTGGGCAGGG + Exonic
1181045200 22:20211040-20211062 GGTGGGCTCAGGCCTGGGCGGGG + Intergenic
1181164652 22:20976812-20976834 TGAGAGCCCAGCCAGGGGCCGGG - Intronic
1181265535 22:21628810-21628832 GGTGGGACCAGGCCGGGCCATGG + Intronic
1181276176 22:21688617-21688639 GCTGAGCCCAGCCTGGGGCAGGG - Intronic
1181334521 22:22117872-22117894 CCTGAGCCCGAGCCGGGGCCTGG - Intergenic
1181433800 22:22898879-22898901 GGGGATCCCAGGCCTGGGGCAGG - Intergenic
1181434742 22:22904248-22904270 GGGGATCCCAGGCCTGGGGCAGG - Intergenic
1181472548 22:23149836-23149858 GGCGAGCCCAGGCAGGGACTTGG - Intronic
1181519044 22:23434830-23434852 GGAGAGGCCAGGCCGAGGTCAGG + Intergenic
1181534471 22:23534389-23534411 GGTGGGCCTAGGCTGGGGCCTGG + Intergenic
1181635563 22:24172832-24172854 GTTCAGCTCAGGCCTGGGCCAGG + Intronic
1182663793 22:31943521-31943543 GGGCAGCCCAGTCCAGGGCCTGG + Intronic
1182698352 22:32211555-32211577 GGGGATCCCAGGCCTGGGGCAGG - Intergenic
1183281125 22:36933300-36933322 GGTGCGCCCAGGCCAGGGCTCGG + Intronic
1183540515 22:38426923-38426945 GGTGGCCGCAGGCCTGGGCCTGG - Exonic
1183708826 22:39490816-39490838 GAAGAGGCCAGGCCTGGGCCTGG - Exonic
1183708972 22:39491429-39491451 GGAGGCCCCAGGCCAGGGCCTGG - Exonic
1183732998 22:39628807-39628829 GGGGAGCCGAGGCTGTGGCCTGG - Intronic
1184114443 22:42414226-42414248 GGGGAGCCCTGGAGGGGGCCCGG - Intronic
1184246573 22:43238743-43238765 GTTCAGCCCAGCCCTGGGCCCGG + Intronic
1184444427 22:44539144-44539166 GGTCAGCCCAAGCCAGGGCAGGG - Intergenic
1184496752 22:44846589-44846611 GGGCAGTCCAGGCCGGGGACAGG - Intronic
1184564644 22:45284885-45284907 GGCCAGCCCAGGCGGGGGCGGGG + Intergenic
1184724466 22:46335584-46335606 GGTGAGCGCAGGCCGGAGACAGG + Exonic
1184769087 22:46587580-46587602 AGGCAGCCCAGGCCGGGGCGGGG + Intronic
1185113471 22:48917745-48917767 GGGGTGCCCAGGCCCGGGCCAGG - Intergenic
1185213578 22:49585962-49585984 GGTGACCCCATCCCTGGGCCGGG + Intronic
1185244085 22:49763998-49764020 GGGGTGCCCAGGCTGGGGGCTGG - Intergenic
1185368397 22:50447300-50447322 CGTGAGCCTTGGCCGGGGCTTGG - Exonic
1185415937 22:50710296-50710318 GGTGAGCAAAGGCTGGTGCCTGG + Intergenic
950039129 3:9908551-9908573 GCTGAGGCCAGGTCTGGGCCAGG - Intronic
950097152 3:10337036-10337058 GGTGAGCCCAGGCCCGTGTCAGG + Intronic
950400956 3:12768905-12768927 GGCGGGCCGGGGCCGGGGCCGGG + Intronic
950491338 3:13307000-13307022 GGTGAACCCAGGCTGCTGCCCGG + Intergenic
950646286 3:14378779-14378801 TGTGTGCCCAGCCTGGGGCCTGG - Intergenic
953666492 3:44929646-44929668 GGGAAGCCCTGGCTGGGGCCTGG - Intronic
953901426 3:46846074-46846096 GGTGGGCCGGGGCCTGGGCCGGG - Intergenic
953913810 3:46905696-46905718 GGTGTCCCCAGGCCAGGGCCGGG + Intergenic
954374235 3:50185723-50185745 GGTGAGCCAAGGTTGGGGACAGG + Intronic
954441799 3:50526177-50526199 GCTGGGCTCAGGCTGGGGCCTGG + Intergenic
958592502 3:96175678-96175700 GCTCAGCCCACGCCTGGGCCGGG - Intergenic
960937596 3:122913103-122913125 GGGAGGCCCAGGCCGGGGTCGGG - Intronic
960974469 3:123161267-123161289 GGTGTCCCCAGGCTGAGGCCTGG - Intronic
961081878 3:124034160-124034182 GGGGAGCCAAGGGAGGGGCCGGG - Intergenic
961359414 3:126357545-126357567 GGCGGGGCCAGGGCGGGGCCAGG - Intergenic
961474036 3:127135982-127136004 GGGGAGCCCAGCTCGGTGCCTGG - Intergenic
961492722 3:127266489-127266511 GATCAGCCCAGGGCAGGGCCAGG + Intergenic
961594277 3:128004873-128004895 GCTGACCCCAGGACGGGGCTGGG - Intergenic
961655765 3:128440831-128440853 AATGAGCCCAGGCTGGGCCCCGG - Intergenic
967054958 3:185823783-185823805 GGGGGGCGCCGGCCGGGGCCCGG + Intronic
968276810 3:197446529-197446551 GGAGAGCCCAGGAAGAGGCCGGG + Intergenic
968365505 3:198182337-198182359 GCTGAGCCCAAGCCAGGGGCAGG - Intergenic
968451905 4:679831-679853 GGTGACCCCAGCACAGGGCCAGG - Intronic
968451997 4:680266-680288 GGTCAGCCCAGGCCTGGAGCTGG - Intronic
968549429 4:1214586-1214608 GGTGAGCCCAGGGTGGGGCTGGG - Intronic
968593403 4:1470927-1470949 GCTGGGCCCACGCCAGGGCCTGG - Intergenic
968726725 4:2251315-2251337 GGGGCACCCAGGCCTGGGCCCGG + Intronic
968761207 4:2443458-2443480 AGGGAGCCCAGGCTGGGGCTTGG - Intronic
968905721 4:3449721-3449743 GCTGAGCCCCGGCCTGGGGCTGG - Intergenic
968926437 4:3550989-3551011 GGTGAGGCCAGGGCGAGGCCAGG - Intergenic
968936618 4:3614425-3614447 GGTGAGCCCAGTTCAGGGCCAGG - Intergenic
969455748 4:7298784-7298806 GCTGTGCCCAGGCCGGGTGCTGG + Intronic
969590402 4:8118706-8118728 TGGGAGCCCAGGCTGGTGCCAGG - Intronic
969626389 4:8307798-8307820 GGAGAGCCCAGGCCGCAGGCGGG - Intergenic
969647508 4:8441036-8441058 GGGGAACCCTGGCCGGGTCCCGG - Exonic
969715776 4:8867544-8867566 CGGGAGCGCAGGCCGCGGCCGGG - Exonic
969788965 4:9478859-9478881 GTGGGGCCCAGGCCGAGGCCGGG + Intergenic
973292442 4:48483686-48483708 GCTGAGCCCAGGGCCGGGGCCGG - Exonic
974016800 4:56655807-56655829 GCTCAGCCCAGGCAGGGGTCGGG + Intronic
979254542 4:118597504-118597526 GCTGAGCCCAAGCCAGGGGCAGG - Intergenic
979334423 4:119448527-119448549 GCTGAGCCCAAGCCAGGGGCAGG + Intergenic
980035748 4:127881108-127881130 GGAGAACCCAGGCCAGAGCCTGG + Exonic
982503771 4:156193306-156193328 TGTGAGCCCAGGGCAGAGCCAGG + Intergenic
984367942 4:178822329-178822351 GCTGAGCCCAGGGCTGGGCACGG + Intergenic
984908129 4:184648977-184648999 GGGGAACCGAGCCCGGGGCCGGG - Intronic
984908204 4:184649180-184649202 CGGGAGCCTGGGCCGGGGCCGGG - Intronic
985540742 5:486286-486308 AGTGAGGCCAGCCCTGGGCCCGG - Intronic
985622648 5:963523-963545 GCTGAGCACAGGCCAGGCCCGGG - Intergenic
985845104 5:2338749-2338771 AGCGAGCCCAGGCCGCAGCCTGG + Intergenic
985845108 5:2338756-2338778 GGCCAGCCCAGGCTGCGGCCTGG - Intergenic
985950428 5:3218320-3218342 GGTGGGGCCAGGCTGGAGCCAGG + Intergenic
985955572 5:3263086-3263108 GGAGAGGCCAGGAAGGGGCCAGG + Intergenic
986317246 5:6598003-6598025 GGTGTCCCCAGTCCAGGGCCTGG + Intergenic
988497557 5:31758039-31758061 GATGAGCCCCGGCCTGGGCAGGG - Intronic
992111580 5:73498849-73498871 GCCGAGGCCAGGCCAGGGCCAGG + Intronic
998092618 5:139380107-139380129 TGGGAGGCCAGGCTGGGGCCAGG + Intronic
998459082 5:142296106-142296128 CCTGAGCCCAGGCCTGTGCCTGG + Intergenic
998849331 5:146338786-146338808 GGAGAGGCCAGGCCAGGCCCGGG + Intronic
1000373163 5:160556401-160556423 GTTGGCCCCAGGCCAGGGCCAGG + Intergenic
1001397332 5:171426683-171426705 AGTGAGCCCAGGACAGAGCCAGG - Intronic
1001890476 5:175334017-175334039 GGCCAGCCCAGGCCAGAGCCAGG + Intergenic
1002051797 5:176575592-176575614 GGTGTCCCCAGGCCAGGGCTGGG + Intronic
1002170327 5:177371061-177371083 GGCGGGGCCGGGCCGGGGCCGGG + Intronic
1002535896 5:179875214-179875236 GGTGAGCCCACCCTGTGGCCTGG + Intronic
1003218420 6:4135758-4135780 GCAGAGCCCAGGCAGGAGCCTGG + Intergenic
1003528755 6:6920283-6920305 GGTGAGCGCTGGCAGTGGCCAGG - Intergenic
1003569747 6:7248041-7248063 GGTGGGCCCTGCCCTGGGCCTGG + Intronic
1003649029 6:7941256-7941278 TGAGAGCCCAGGGCCGGGCCCGG - Intronic
1004931878 6:20470222-20470244 AGTGAGCCCAGGGTGGGTCCAGG - Intronic
1005946682 6:30600982-30601004 GGTGAGCCCACGCTGGGGGAGGG + Exonic
1005960169 6:30688209-30688231 GGTGAGGCAAGGTTGGGGCCTGG + Exonic
1006021128 6:31118256-31118278 TGAGAGCCCAGGCTGGGGTCAGG + Intronic
1006047185 6:31308091-31308113 GGTGAGCCGGAGGCGGGGCCAGG + Intronic
1006516821 6:34549981-34550003 GGTGAGGCCAGGTCTTGGCCAGG + Intronic
1007482379 6:42158522-42158544 GGTGGGCCCAAGCCAGGGCCTGG + Intronic
1007581169 6:42960973-42960995 GGTGAGCCCAGGCCGGGGCCGGG + Exonic
1007633429 6:43285044-43285066 CCTGGGCCCAGGCCGCGGCCAGG - Exonic
1007633437 6:43285066-43285088 GGCGAGCCCAAGCCGGAGCCAGG + Exonic
1009533240 6:64847590-64847612 GGTGAGCTCAGGCAGTTGCCAGG - Intronic
1013349234 6:109290692-109290714 GGGAAGCCGGGGCCGGGGCCAGG - Intergenic
1015523376 6:134153024-134153046 GGTGAGGCCTGGTGGGGGCCAGG - Intergenic
1016657941 6:146543362-146543384 GCTGAGCCCCCCCCGGGGCCGGG - Intergenic
1017760209 6:157562650-157562672 GGTGAGCTCAGGACTGGGCCTGG - Intronic
1017947368 6:159106593-159106615 GGTGCGCCCAGACCAGGTCCAGG + Intergenic
1017992913 6:159506028-159506050 AGTGGGCCCAGCCCTGGGCCTGG + Intergenic
1018762362 6:166903534-166903556 GGTGGGCCGAGGAAGGGGCCGGG - Intronic
1018826947 6:167415583-167415605 TGTGAGCCCTGGACCGGGCCTGG - Intergenic
1018949664 6:168370897-168370919 GGCGAGTCCAGGCTGGGCCCTGG + Intergenic
1019349021 7:544517-544539 GGTGAGCTCAGGTGGGGCCCAGG - Intergenic
1019424441 7:967545-967567 GGAGTGCCCAGGCCCGGGTCGGG - Exonic
1019560633 7:1654849-1654871 GGTGAGCAGAGCCCGAGGCCTGG + Intergenic
1019592237 7:1841496-1841518 GGAGAGGCCAGGCCGAGGTCAGG - Intronic
1020070541 7:5224076-5224098 GCTGAACCAAGGCAGGGGCCTGG - Intronic
1020265555 7:6557680-6557702 GGTGAGCCACGGCTGGGGCCTGG + Intergenic
1021450340 7:20778279-20778301 GGCGGGCCCGGGCCGGGGCCAGG + Intergenic
1022247005 7:28570389-28570411 GGTGGGGCCATGACGGGGCCCGG + Exonic
1022500315 7:30878526-30878548 GGTGAGCCTTGTCCTGGGCCAGG - Intronic
1023599216 7:41865062-41865084 GGTGAGGCCCGGCATGGGCCAGG + Intergenic
1023852872 7:44159857-44159879 GGTGAGCCCAAGGAGAGGCCTGG - Intronic
1024069633 7:45775170-45775192 GCTGAGCCCAAGCCAGGGACAGG - Intergenic
1025713567 7:63932415-63932437 GGTGAAACCAGGCCGAGGCCTGG - Intergenic
1026827890 7:73595566-73595588 GGTGAGACCAGGCTGGGCCTGGG - Intronic
1026840381 7:73667623-73667645 GGTGAGCCAGGGCCGGTGCTGGG + Intergenic
1026909638 7:74084358-74084380 GGTGGCCCCAGGGCGAGGCCCGG - Intronic
1028477503 7:91266846-91266868 GCTGCGCCCCGGCCGAGGCCTGG - Exonic
1029495901 7:100895445-100895467 GGGGTGCCCAGCCCGGCGCCGGG + Intronic
1032047020 7:128619456-128619478 GCTGAGCCCAAGCCAGGGGCAGG - Intergenic
1033045044 7:137954385-137954407 GGTGGACCCAGGCAGGGGGCAGG + Intronic
1033319047 7:140323033-140323055 GATAAGCCCAGGCCTGGCCCAGG - Intronic
1033345895 7:140525610-140525632 TGTGACCCCAGGACGGGGCTGGG - Intronic
1034347672 7:150397257-150397279 GGTGGGGCCAGCCCGGGGCCCGG + Exonic
1034483611 7:151341985-151342007 GCTGGGCCGGGGCCGGGGCCGGG + Intronic
1035019763 7:155794003-155794025 GGTGTGCCCAGCCAGGGCCCGGG + Intergenic
1035244584 7:157554013-157554035 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244602 7:157554068-157554090 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244620 7:157554123-157554145 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244638 7:157554178-157554200 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244656 7:157554233-157554255 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244674 7:157554288-157554310 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244692 7:157554343-157554365 GGTGCGGCCAGGCCGGGCGCTGG + Intronic
1035266597 7:157693019-157693041 GGCGACCCCAGGCCCGGCCCTGG + Intronic
1035283581 7:157792689-157792711 CGTCTGCCCAGGCTGGGGCCGGG + Intronic
1036082076 8:5568056-5568078 AGTGAGCCCAGGCCCGAGCAAGG - Intergenic
1036223227 8:6938485-6938507 GGTCAGCCCTGGCCAGGCCCAGG + Intergenic
1036227315 8:6970758-6970780 GGTCAGCCCTGGCCAGGCCCAGG + Intergenic
1036228457 8:6980265-6980287 GGTCAGCCCTGGCCAGGCCCAGG + Intergenic
1036230910 8:6999375-6999397 GGTCAGCCCTGGCCAGGCCCAGG + Intronic
1036233356 8:7018474-7018496 GGTCAGCCCTGGCCAGGCCCAGG + Intergenic
1036236114 8:7041220-7041242 GGTCAGCCCTGGCCAGGCCCAGG + Intergenic
1037661927 8:20935240-20935262 GGTGGGCCTGGGCCTGGGCCTGG - Intergenic
1037883035 8:22582070-22582092 GGTGGGGCCAGGGTGGGGCCTGG + Intronic
1037886471 8:22598866-22598888 GGCGTCCCCAGGCGGGGGCCGGG + Intronic
1038646427 8:29365914-29365936 GGTCTGCCCAGGCAGGGCCCAGG + Intergenic
1038808004 8:30812490-30812512 GCGGCGCCCGGGCCGGGGCCGGG - Exonic
1039846307 8:41328158-41328180 TGTGAGCCCAGGCCAGGGCGGGG - Intergenic
1039881693 8:41629207-41629229 GGAGGGCCCAGCCTGGGGCCGGG + Intergenic
1040552549 8:48449676-48449698 GGACAGCCCAGGCCTGTGCCGGG + Intergenic
1041383833 8:57278970-57278992 GCTGAGCCCAGGCGGAGGCTGGG - Intergenic
1045551794 8:103179712-103179734 TGTGAGCCCAGCGCAGGGCCTGG - Intronic
1047259220 8:123241148-123241170 GAGGGGCCGAGGCCGGGGCCGGG + Intronic
1048345329 8:133571284-133571306 GGAGATCCCAGCCCGGCGCCGGG + Intronic
1048345697 8:133572641-133572663 GCTGGGCCAGGGCCGGGGCCGGG - Intergenic
1048669052 8:136695895-136695917 GGGGACCCCAGGCCAGGCCCAGG - Intergenic
1049044691 8:140140108-140140130 GGTGAGCACACGCAGGGGCAGGG + Intronic
1049273581 8:141708723-141708745 TGTGAGCCCAAGGCAGGGCCAGG + Intergenic
1049367826 8:142249252-142249274 GGTGGACCCAGGCCTGTGCCAGG + Intronic
1049396397 8:142403062-142403084 GCTGGGGCCTGGCCGGGGCCGGG - Intronic
1049419569 8:142510817-142510839 GGCGGGCCGGGGCCGGGGCCGGG + Intronic
1049494095 8:142921655-142921677 GGTGAGCCCAGACCCGGCCTCGG - Intergenic
1049509729 8:143021479-143021501 GCTGAGCCCCGGCCCGGGCTAGG - Intronic
1049542510 8:143214980-143215002 GGCGGGCTCAGGCCGAGGCCGGG - Intergenic
1049582047 8:143417209-143417231 GTTGAGCCCAGTTCTGGGCCTGG - Intergenic
1049645583 8:143734239-143734261 GTCGAGCCCCGGGCGGGGCCGGG + Intergenic
1049654129 8:143790312-143790334 GGTGAGGCCAGGGTGGGGCTAGG - Intergenic
1049710492 8:144060892-144060914 GGCGAGCCCAGGCCCGGCGCCGG - Intronic
1049716371 8:144095003-144095025 GGGGAGCGCGGGGCGGGGCCGGG - Intergenic
1050075059 9:1854581-1854603 GGTGATACCTGGCCAGGGCCTGG + Intergenic
1050090882 9:2015985-2016007 GGGGAGCCCAGGCTGGCGGCGGG + Intronic
1051160430 9:14201306-14201328 AGTGAGGCTAGGCTGGGGCCAGG - Intronic
1053427008 9:38016847-38016869 GGGGAGCTCAGGCAGGGCCCTGG - Intronic
1053692136 9:40591985-40592007 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1053801363 9:41766371-41766393 GGTGAGGCCAGGGCGAGGCCAGG - Intergenic
1054143838 9:61548452-61548474 GGTGAGGCCAGGGCGAGGCCAGG + Intergenic
1054189793 9:61978525-61978547 GGTGAGGCCAGGGCGAGGCCAGG - Intergenic
1054272664 9:63045500-63045522 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
1054303394 9:63392951-63392973 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1054402174 9:64719461-64719483 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1054435779 9:65203776-65203798 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1054456245 9:65431914-65431936 GGTGGGCCCAGCCCGAGGACAGG - Intergenic
1054463614 9:65479792-65479814 GGTGAGGCCAGGGTGAGGCCAGG + Intergenic
1054494614 9:65817911-65817933 GGTCAGGCCAGGAAGGGGCCAGG - Intergenic
1054648721 9:67610067-67610089 GGTGAGGCCAGGGCGAGGCCAGG + Intergenic
1056381637 9:86062209-86062231 GGTGACCCCAGGGCGGGTCCTGG - Intronic
1057747628 9:97764406-97764428 GTTGAGCACGGGCCGGGGGCGGG - Intergenic
1058842194 9:108920618-108920640 GGAGAGCCCAGGCAGGGAACAGG + Intronic
1059341493 9:113599941-113599963 AGGGAGCCCAGGCAGGGCCCAGG - Intergenic
1060229024 9:121813566-121813588 GGTGAGCCCAGGGCAGGCCTCGG + Intergenic
1060263102 9:122092941-122092963 GCTGCGCCGGGGCCGGGGCCAGG + Exonic
1060596694 9:124853029-124853051 GGTGAGCCAAGCACAGGGCCTGG - Intergenic
1060658430 9:125388526-125388548 GTTGCGCCCAGCCCAGGGCCTGG - Intergenic
1060723379 9:125992625-125992647 GGAGAGCCCTGGCCGGGGTTGGG - Intergenic
1060780447 9:126408454-126408476 AGTGGGCCCAGGCAGGGGGCTGG + Intronic
1060826071 9:126688790-126688812 GGTGAGCTGAGGCTGAGGCCAGG - Intronic
1060827138 9:126693812-126693834 GGTGAGCCGGGGCCGGGGCAGGG + Exonic
1060827153 9:126693845-126693867 GGTGAGCTGGGGCCGGGGCCAGG + Exonic
1060827179 9:126693911-126693933 GGTGAGCCTGGGCCAGGGCTGGG + Intronic
1061084884 9:128393013-128393035 GGAGATCCCAGGCTGGGGGCAGG - Intergenic
1061128086 9:128689350-128689372 CAGGAGCCCGGGCCGGGGCCCGG + Intronic
1061179153 9:129013816-129013838 AGTGTGCCCAGGGCGAGGCCAGG - Intronic
1061203399 9:129149898-129149920 GGAGAGCTCAGGCCTGGGCCTGG + Intergenic
1061245952 9:129401436-129401458 GGTGGGCCTAGGCTAGGGCCCGG - Intergenic
1061324134 9:129852539-129852561 GGTGAGCCCAGGCCAGGATGGGG + Exonic
1061372878 9:130207695-130207717 GGAGAGCACAGGCCAGGGCACGG + Intronic
1061415400 9:130444726-130444748 GGTGAGCCGGCGCCGGGCCCAGG + Intergenic
1061548033 9:131315943-131315965 GGTGAGGGCAGGGCGGGGACAGG + Intergenic
1061559645 9:131394263-131394285 GGTGGGTCGGGGCCGGGGCCGGG + Intronic
1061610106 9:131740227-131740249 GGAGTCCCCACGCCGGGGCCTGG + Intergenic
1061708110 9:132468477-132468499 GGTGGGCCCAGGGCAGGGGCTGG - Intronic
1061802668 9:133120876-133120898 GGCGAGCCCCGGACGGGGCCGGG - Intronic
1061862428 9:133474931-133474953 GGTGGGCGCCGGCCGGGGCTGGG + Intronic
1061874818 9:133538424-133538446 GGTGAGGCCCGGCCCGGGCAGGG + Exonic
1062030631 9:134360369-134360391 GGCAAGCCCAGGCCTGGGCACGG - Intronic
1062042079 9:134408796-134408818 TCTGAGCCCAGGCAGGGGTCTGG + Intronic
1062060341 9:134492107-134492129 GGGTAGCCCAGGCAAGGGCCAGG - Intergenic
1062128697 9:134880878-134880900 GGAGAGCCCAGGCCATGCCCAGG - Exonic
1062208090 9:135348286-135348308 GGTGAGGACCAGCCGGGGCCAGG - Intergenic
1062261866 9:135666839-135666861 GCTGAGCCCAGGGAGGGGACAGG - Intergenic
1062345591 9:136113169-136113191 TTTGAGCCCAGGCCGGGGAGGGG - Intergenic
1062358899 9:136178191-136178213 GAAGAGCCCAGCTCGGGGCCTGG - Intergenic
1062394727 9:136348211-136348233 GGGCAGCCCAGGCCAGGGTCGGG - Intronic
1062464969 9:136676905-136676927 GGTGGGGCCTGGGCGGGGCCAGG - Intronic
1062491838 9:136808492-136808514 GGAGAGGCCAGGCCAGGGCCGGG + Intronic
1062528914 9:136991301-136991323 GGAGATCCCAGGCGGAGGCCTGG - Intergenic
1062547783 9:137071357-137071379 GGTGAGACCAGGCCTTAGCCTGG + Intergenic
1062556221 9:137114433-137114455 GGGGCGGCCGGGCCGGGGCCGGG + Intronic
1062575491 9:137205422-137205444 GTTGAGCGCGGGCCGGGGCCCGG + Exonic
1062584312 9:137242021-137242043 GGTGAGCCGTGGCTGGGGACTGG + Exonic
1062596946 9:137303789-137303811 GTGGAGCCCAGGCCCGGGGCAGG + Intergenic
1062623725 9:137433864-137433886 GGTGAGCCAAGGGCGAGGCAGGG + Exonic
1062749873 9:138245204-138245226 GCTGAGCCCAAGCCAGGGGCAGG - Intergenic
1203622797 Un_KI270749v1:138122-138144 GGTCAGGCCAGGAAGGGGCCAGG + Intergenic
1186107933 X:6226783-6226805 GGAGGGCGCAGGCCGGGACCTGG + Intronic
1187013595 X:15304533-15304555 GTTGATCCCAGGTCTGGGCCAGG + Intronic
1189226889 X:39420539-39420561 GGAGAGCCCAGGGCAGGGCTTGG - Intergenic
1189308739 X:40005929-40005951 GGTGCGCCCTGGCCAGGGCGTGG + Intergenic
1189308780 X:40006061-40006083 GGTGCGCCCTGGCCGGGGCCTGG - Intergenic
1190260526 X:48794069-48794091 GGTGAGCCCAGTAGGGGTCCAGG - Exonic
1192181793 X:68920775-68920797 GCTGAGCCCAGGCCGGGGCTGGG + Intergenic
1192194841 X:69021336-69021358 GCTGAGCCCAGGCCTGCGGCAGG - Intergenic
1193472643 X:81925826-81925848 GGTGTGGCCAGGCAGGGGCATGG - Intergenic
1198182561 X:134223904-134223926 TGTGAGCTCAGGGAGGGGCCAGG - Intergenic
1199990286 X:152983926-152983948 GGTGATCCCAGGCCAGGAACAGG + Intergenic
1200033376 X:153313400-153313422 GGTGATCCCAGGCCAGGAACAGG + Intergenic
1200108081 X:153725383-153725405 GAAGACCCCTGGCCGGGGCCAGG - Exonic
1200232175 X:154449583-154449605 GGAGAGCCCATGCTGGGGCTGGG - Intronic
1200247591 X:154534316-154534338 GGTGGGGCCAAGCCTGGGCCGGG - Exonic