ID: 1007581171

View in Genome Browser
Species Human (GRCh38)
Location 6:42960975-42960997
Sequence TGAGCCCAGGCCGGGGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1011
Summary {0: 1, 1: 0, 2: 4, 3: 100, 4: 906}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581158_1007581171 23 Left 1007581158 6:42960929-42960951 CCAGCACGGCTGCCAGCGGGTGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 100
4: 906
1007581159_1007581171 11 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 100
4: 906
1007581163_1007581171 -9 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 100
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581171 Original CRISPR TGAGCCCAGGCCGGGGCCGG GGG Intronic
900103342 1:972011-972033 TGAGGCCAGGCGGGGCCCCGGGG + Intronic
900103533 1:972793-972815 TGGGTCCAGGCAGGGGCGGGTGG + Intronic
900227469 1:1539973-1539995 GGAGCGCAGGCCGGGGTGGGGGG + Intronic
900353173 1:2246933-2246955 TGGGCACAGGCCGGGCACGGTGG + Intronic
900457438 1:2784029-2784051 TGAGGCCAGGCGAGGGCAGGGGG + Intronic
900650605 1:3728274-3728296 TGAGCCCAGGCTGGGCCATGGGG + Intronic
901026696 1:6282167-6282189 GGAGCCCAGGCCGGGGAGGGTGG - Intronic
901270351 1:7948381-7948403 TGAGCATAGGCCGGGTGCGGTGG + Intergenic
901376441 1:8842970-8842992 TTAGTCCAGGCCGGGCACGGTGG - Intergenic
901468933 1:9442053-9442075 TGAGCTCTGGCTGGGGGCGGGGG + Intergenic
901506576 1:9689446-9689468 TGGGGCGGGGCCGGGGCCGGCGG - Intronic
901574353 1:10188853-10188875 TGACCGCAGGCCGGGTGCGGTGG - Intergenic
901642103 1:10697891-10697913 TGAGCCCGCTCCGGGGCCGATGG + Intronic
901650857 1:10742482-10742504 TGAGGCCAGGCCAGGGACTGGGG - Intronic
901662372 1:10806579-10806601 AGAGCCCTGGCTGGGGCCAGAGG - Intergenic
901765099 1:11494971-11494993 TGAGGCCTGGCAGGGGCCTGGGG + Intronic
901787749 1:11635935-11635957 AGAGCCCCGGCCGGGCGCGGTGG - Intergenic
901841717 1:11957951-11957973 TGCGCCCAGGCCTGTGCCTGAGG + Intronic
902067248 1:13698927-13698949 TGAGGCTAGGCCGGGCGCGGTGG - Intergenic
902350064 1:15847790-15847812 TGCGCCCGGGCAGGGGCGGGCGG - Intergenic
902427273 1:16334144-16334166 TGATTCTAGGCCGGGCCCGGTGG + Intronic
902518723 1:17003947-17003969 TGAGCTCAGGCTGGGTGCGGTGG - Intronic
902638179 1:17748686-17748708 AGAGTCCAGGCCGGGCGCGGTGG - Intergenic
902837730 1:19057897-19057919 TGAGCCCAGGCAGGCGGGGGTGG - Intergenic
902881049 1:19371962-19371984 GGAGCCCAGGCCGGGGGGTGGGG + Intronic
903150115 1:21401541-21401563 TGAGACCAGGCCGGGCGTGGTGG + Intergenic
903168911 1:21540223-21540245 AGTGCCCAGGCAGGGGTCGGGGG - Intronic
903246913 1:22022950-22022972 TGAGCATAGGCCGGGCACGGTGG - Intergenic
903328476 1:22584979-22585001 TGAGGCCAAGCAGGGGCCGCAGG + Intronic
903614230 1:24640698-24640720 TTTGCCCAGGCCGGGCACGGTGG + Intronic
903643349 1:24875425-24875447 TTATTCCAGGCCGGGGCCAGAGG - Intergenic
903784122 1:25846130-25846152 TGCTCCCAGGCCGGGTGCGGCGG + Intronic
903903520 1:26666375-26666397 TGAACCCAGGCCAGGCGCGGTGG - Intergenic
904138096 1:28329573-28329595 AGAGCCAAGGCCGGGCGCGGTGG - Intronic
904300185 1:29549169-29549191 TGAGCCCAGGGCCAGGCAGGTGG + Intergenic
904664358 1:32108437-32108459 TGCGCCCAGACTGGGGCTGGGGG + Intronic
904690767 1:32292042-32292064 TGAGCCCAGGAGGGGACGGGCGG + Intergenic
904703698 1:32374863-32374885 GGAGCTCAGGCCGGGCACGGTGG + Intronic
905281047 1:36849692-36849714 TGAGCTCATGCGGGGGCAGGAGG - Intronic
905432863 1:37937023-37937045 TGAGGCCAGGCCGGGCGCGGTGG + Intronic
905819806 1:40980284-40980306 TGAGCCCGCGCCGAGGCCGGAGG - Intronic
906240913 1:44241728-44241750 GGAGGCGAGGCCGGGGCCTGGGG + Intronic
906616641 1:47237346-47237368 AAAGCACAGGCCGGGGGCGGTGG - Intergenic
906674137 1:47681120-47681142 TCAGCCCAGGGCAGGGCAGGGGG - Intergenic
906751660 1:48268036-48268058 TGAGACCTGGCCGGGCGCGGTGG - Intergenic
906769597 1:48472125-48472147 GGCCCCCAGGCCGGGGCCCGCGG + Exonic
907145786 1:52230153-52230175 TGAGCCTAGGCAGGGCGCGGAGG - Intronic
907364117 1:53945820-53945842 TGAGGGCAGGGCGGGGCCTGTGG - Exonic
907545316 1:55254619-55254641 TGAGTTCAGGCCGGGCCTGGTGG - Intergenic
908201897 1:61806330-61806352 TGAGTCAAGGCCGGGCGCGGTGG + Intronic
908299998 1:62753847-62753869 GGAGCCCGTGCCGGGGCCGTGGG - Intergenic
910514661 1:88046698-88046720 AGACCCCAGGCCGGGTGCGGTGG + Intergenic
910606591 1:89092072-89092094 TGGACCCAGGCCGGGTGCGGTGG - Intergenic
911548841 1:99255081-99255103 CCAGCCCAGGCCGGGCGCGGTGG + Intergenic
912763917 1:112391704-112391726 TCAGTCCAGGCCGGGCGCGGTGG + Intergenic
912795013 1:112688043-112688065 TGAGCCCAGTCTGGGGGCAGAGG - Intronic
914424237 1:147560300-147560322 TAAGGCCAGGCCGGGCGCGGTGG + Intronic
914432199 1:147629015-147629037 TAAGCCTAGGCCGGGCGCGGTGG + Intergenic
914902925 1:151721467-151721489 TGGGGGCAGGGCGGGGCCGGGGG + Intronic
915347344 1:155204300-155204322 CGAGACCAGGCCGGGCGCGGTGG + Intronic
915454425 1:156030077-156030099 TGGGTCCAGGCCGGGCGCGGTGG + Intergenic
915536969 1:156542475-156542497 TGTCCCCAGGCCGGGCCTGGTGG - Intronic
915558063 1:156670875-156670897 TGAGCCAGGCCCGGGGCAGGGGG - Exonic
915590237 1:156866521-156866543 AGAGCCCAGGACGGGGCCAGAGG - Intronic
916531239 1:165658749-165658771 GGAGTCCAGGCCGGGTGCGGTGG + Intronic
916729349 1:167552757-167552779 GGAGCCCAGGCAGGGCGCGGTGG + Intronic
917087425 1:171318026-171318048 TGGGACCAGGCCGGGCACGGTGG + Intronic
918046030 1:180941496-180941518 TGACCCCAGGCCTGGGCGGCTGG - Intronic
918253385 1:182724843-182724865 TTAGCCTAGGCCGGGCGCGGTGG - Intergenic
918288386 1:183081173-183081195 TGAGAACAGGCCGGGCGCGGTGG - Intronic
918472134 1:184885460-184885482 TGTGCCCAGGCTGGGCGCGGTGG - Intronic
918519074 1:185394961-185394983 TAAGCCCAGGCTGGGTGCGGGGG + Intergenic
919801415 1:201356831-201356853 TGTGCCCAGGCCGAGCGCGGTGG - Intergenic
920307270 1:205026894-205026916 TGAGCCCCGGCCAGGGCTGAGGG - Intergenic
920313989 1:205065022-205065044 TGGGCCCAGGCCGGGTCCGCAGG - Intronic
920528342 1:206684914-206684936 TGTACCCAGCCCCGGGCCGGCGG - Intergenic
921072992 1:211677455-211677477 AGAGCCCTGGCCGGGCACGGTGG + Intergenic
921893954 1:220379895-220379917 TGAGACCCGGCCGGGCGCGGTGG - Intergenic
923171412 1:231421349-231421371 TGAGCCCCGGCGGCGGCCTGCGG - Exonic
923748816 1:236727711-236727733 TGAGGTCAGGCCGGTGTCGGTGG - Exonic
923768541 1:236915932-236915954 TGACCCCACGCCGGGTGCGGTGG + Intergenic
924160875 1:241230499-241230521 TGTGCCCTGGCCGGGTGCGGTGG - Intronic
924309203 1:242722407-242722429 GGAGCCAAGGCCGGGGCAGGGGG - Intergenic
924523914 1:244829508-244829530 TGATTCCAGGCCGGGCGCGGTGG - Intergenic
1063857580 10:10272108-10272130 TGAGCCCAGGCAGGGTGAGGAGG + Intergenic
1064106741 10:12506803-12506825 AGAGCCCAGGCCGGGCGCGGTGG - Intronic
1064255658 10:13741160-13741182 GGAGCCCAGGCCGGGTGCAGTGG + Intronic
1064678919 10:17789733-17789755 TGAGCCAGGGCCGGGCACGGTGG + Intronic
1066326788 10:34368383-34368405 TGAGAGCAGGCCGGGCGCGGTGG + Intronic
1066697296 10:38090743-38090765 TGGGCCCAGGCTGGGCACGGTGG + Intergenic
1067154099 10:43760483-43760505 TGAGCTCAGGCTGGGTCCTGAGG + Intergenic
1067205221 10:44207050-44207072 TCTGCCCAGGCCTGGGCCAGAGG + Intergenic
1067432186 10:46251947-46251969 TGTGGCCAGCCCGGGGCAGGAGG + Intergenic
1067441043 10:46309397-46309419 TGTGGCCAGCCCGGGGCAGGAGG - Intronic
1067485138 10:46641912-46641934 TGAGCCCAGGCTGGGGGATGAGG - Intergenic
1067609619 10:47699746-47699768 TGAGCCCAGGCTGGGGGATGAGG + Intergenic
1067735054 10:48844302-48844324 TGAGTCCAGGCCGGGTGCAGTGG + Intronic
1068382390 10:56273799-56273821 TAAGCTCAGGCCGGGCGCGGTGG + Intergenic
1069517845 10:69093588-69093610 TGAAACCAGGCCGGGCGCGGTGG + Intronic
1069570148 10:69489840-69489862 TGACCCCAGCCAGGGGCTGGAGG + Intronic
1069626891 10:69873698-69873720 GGACCCCAGGCCAGGGCGGGTGG - Intronic
1069674346 10:70236843-70236865 TGAGACTAGGCCGGGCGCGGTGG + Intergenic
1069888835 10:71640460-71640482 TGGGCCCAGTCCGGGAGCGGTGG + Intronic
1069889186 10:71642685-71642707 CGGGCCCAGGCCGGGTGCGGTGG - Intronic
1070119337 10:73560365-73560387 TGAGACCAGGCCGGGCATGGTGG + Intronic
1070240958 10:74680025-74680047 TGAGTACAGGCCGGGCACGGTGG + Intronic
1070447631 10:76523226-76523248 TGAGCTCAGGTCGGGGCTGGAGG - Intronic
1070669521 10:78368278-78368300 TCTGCCCAGGCTGGGGCTGGCGG + Intergenic
1070777535 10:79118586-79118608 TGTGCCAAGGCCGGAGCCAGGGG + Intronic
1071527458 10:86366635-86366657 TGAGCCCAGGCCGGCGCGGCGGG + Intergenic
1071625209 10:87161359-87161381 TGAGCCCAGGCTGGGGGATGAGG + Intronic
1073447488 10:103590176-103590198 TGACCCCAGGTCTGGGCCAGTGG + Exonic
1075095357 10:119467628-119467650 GGAGCCCAGGCTGGGCGCGGTGG - Intergenic
1075528118 10:123202967-123202989 GGAGCCTAGGCAGGGGCCTGAGG + Intergenic
1075902449 10:126053992-126054014 TGAGACCAGGCCAGGTACGGTGG - Intronic
1076168373 10:128300434-128300456 ACAGCCCAGGCCTGGACCGGAGG - Intergenic
1076201055 10:128558273-128558295 TGATCCCAGGCCGGGCATGGTGG - Intergenic
1076319934 10:129570417-129570439 TGGGCACAGACCGTGGCCGGAGG - Intronic
1076652160 10:131997216-131997238 AGAGCCCAGGCTGGAGCAGGAGG + Intergenic
1076659944 10:132048925-132048947 CAAGCCCAGGCCGGGCGCGGTGG - Intergenic
1076740727 10:132482874-132482896 AGAGCCCAGGCTGGGCACGGTGG + Intergenic
1076792813 10:132785954-132785976 GGAGCCCGGGCCGGCGGCGGCGG - Exonic
1076816275 10:132916503-132916525 TGAGCACCGCCCGGGGCCGTGGG - Intronic
1076857585 10:133124829-133124851 GGGGCCGGGGCCGGGGCCGGGGG - Intronic
1076878675 10:133229841-133229863 TGAGCCCGGGCGGGGGCGGCGGG + Intergenic
1077038002 11:504474-504496 TCCGCCCAGGCGGGGGCGGGCGG + Intronic
1077150846 11:1072531-1072553 TGAGTCCCAGCCGGGGCCTGAGG + Intergenic
1077154707 11:1086095-1086117 TGAGCCCAGGCCAGGGGGAGTGG + Intergenic
1077178796 11:1203190-1203212 GGAGCCCAGGCCTGAGCCGACGG - Intergenic
1077263783 11:1638581-1638603 GGAGCCCAGCCCAGGGTCGGGGG - Intergenic
1077281363 11:1747643-1747665 TGAGCCCGGGCGGTGGCAGGGGG - Intronic
1077307361 11:1874229-1874251 TGAGGGCAGGCCGGGGACAGTGG + Intronic
1077307381 11:1874269-1874291 TGGGGGCAGGCCGGGGACGGGGG + Intronic
1077307394 11:1874309-1874331 TGAGGGCAGGCCGGGGACAGTGG + Intronic
1077327762 11:1971087-1971109 TGTGGCCAGGCCGGGGCCCCGGG - Intronic
1077393537 11:2310477-2310499 TGACCCCAGGCAGGGGACTGGGG + Intronic
1077411721 11:2406847-2406869 AGAGCCCAGGCCTGGTCCCGGGG + Intronic
1077414367 11:2417959-2417981 TGGTCCCAGGCCGGGCCCGGTGG - Intronic
1077434427 11:2531966-2531988 TGAGCCCAGGCTGGGTGAGGTGG - Intronic
1077635813 11:3840870-3840892 TGAGGCCCGGCCGGGGCTGGCGG - Intronic
1077808929 11:5617775-5617797 TGAGCCCAGGCCATGCGCGGTGG - Intronic
1078542773 11:12224797-12224819 TGAGCTCAGGCCGGAAGCGGTGG - Exonic
1078771770 11:14358637-14358659 CGGGCCCGGGCCGGGGCCAGGGG - Intronic
1080503794 11:32893225-32893247 TACGCCCAGGCTGGGGCGGGGGG - Exonic
1082013021 11:47463349-47463371 TGACCCAAGGCCGGGCACGGTGG - Intergenic
1082882789 11:58054677-58054699 TGATCCCAGGCCGAGGTGGGCGG + Intronic
1083364879 11:62136082-62136104 TGGGCCAAGGCCGGGTGCGGTGG - Intronic
1083408913 11:62478303-62478325 TGAGCCCTGTCAGGGGCTGGAGG - Intronic
1083661597 11:64254044-64254066 TGAGCCCAGGATGGGGGCTGGGG + Intronic
1083932317 11:65852802-65852824 TGGCCCCAGGCTGGGGCTGGGGG - Intronic
1083951048 11:65956422-65956444 TGAGCCTCGGCCGGGCGCGGTGG - Intronic
1083955205 11:65979037-65979059 TGAGGCAGGGCCGGGGCGGGAGG - Exonic
1083990723 11:66244305-66244327 TGGGCCCAGGCTGGGGCCTAAGG - Exonic
1084154399 11:67305473-67305495 TCTGCCCAGGCCGGGCGCGGTGG - Intronic
1084218312 11:67663460-67663482 TGTGCCCTGGCCGGGGCAGTGGG - Intronic
1084244810 11:67849793-67849815 GGGGCCCTGGCCGAGGCCGGTGG - Intergenic
1084295920 11:68213407-68213429 CGAGCCGAGGCCGGGGGCGCGGG - Exonic
1084445405 11:69200682-69200704 GGAGCCCTGGCCCGTGCCGGAGG - Intergenic
1084462292 11:69302659-69302681 TGGGGCCAGGCTGGGGCTGGTGG + Intronic
1084608298 11:70185305-70185327 TGAGCCCACGGCTGGGCCTGGGG + Intronic
1084811443 11:71614121-71614143 GGGGCCCTGGCCGAGGCCGGTGG + Intergenic
1084827876 11:71744764-71744786 GGGGCCCTGGCCGAGGCCGGTGG + Intergenic
1084844510 11:71888580-71888602 GGGGCCCAGGCCGAGGCTGGGGG + Intronic
1084847362 11:71911036-71911058 GGGGCCCAGGCCGAGGCCAGTGG + Intronic
1084930738 11:72553710-72553732 TGAGCCCAGGGCTGGGGCTGGGG + Intergenic
1084931531 11:72560291-72560313 TGAGCCCAGCGTGGGGCCTGAGG + Intergenic
1085106798 11:73850961-73850983 ATAGCCCAGGCCGGGCGCGGTGG - Intronic
1085123507 11:73982297-73982319 TTAGCACAGGCCGGACCCGGAGG + Intronic
1085388468 11:76170464-76170486 TCAGCCCTGGCCGGGTGCGGTGG - Intergenic
1085400352 11:76232357-76232379 TGAGAGCAGGGCGGGGCCAGGGG - Intergenic
1085607770 11:77918142-77918164 TGAGCCTAGGCCGGGCACAGTGG + Intronic
1086370578 11:86151885-86151907 CCAGCCCAGGCTGGGGCTGGAGG - Intergenic
1087744026 11:101922070-101922092 TGAGCTCAGGCTGGGCGCGGTGG - Intronic
1090375160 11:126283155-126283177 TGAGCCCGGGGCGGGGTCGCGGG + Intronic
1090999485 11:131896973-131896995 TAAGCCTAGGCCGGGCGCGGTGG - Intronic
1091110560 11:132962661-132962683 AGAGCCAAGGCTGGGGTCGGTGG - Intronic
1091246098 11:134096220-134096242 TAATCCCAGGCCGAGGCAGGAGG - Intronic
1091247336 11:134109247-134109269 TGAGAGCAGGCCGGGCACGGTGG - Intronic
1091434014 12:459898-459920 TGTGCCCGGGGCGGGGGCGGGGG + Intergenic
1091434041 12:459969-459991 GGAGCCCGGTCCGGGGCTGGCGG + Intergenic
1091569842 12:1675184-1675206 TGAACCCGGGGCGGGGGCGGAGG + Intergenic
1091730528 12:2877089-2877111 GGGTCCCGGGCCGGGGCCGGGGG + Intronic
1091781081 12:3215014-3215036 GGAGCGCAGGCCAGGGCCAGGGG - Intronic
1091964869 12:4731121-4731143 TCATCTCAGGCCGGGGGCGGTGG - Intronic
1092143596 12:6200257-6200279 TGCGGCCCGGGCGGGGCCGGTGG + Intronic
1092248223 12:6875604-6875626 TCAGCCCAGGCTGGGCGCGGTGG - Intronic
1092644090 12:10550895-10550917 TGAGCCTCGGCCGGGCGCGGTGG + Intergenic
1092877808 12:12863824-12863846 TGAGTTCAGGCCGGGCACGGTGG + Intergenic
1093728704 12:22544203-22544225 TGCGCCGAGCGCGGGGCCGGCGG + Intronic
1093793753 12:23286204-23286226 GGAGCCCACGGCGGGGGCGGGGG - Intergenic
1094575849 12:31684756-31684778 GGATCCCAGGCCGGGCGCGGTGG - Intronic
1094626374 12:32128189-32128211 TTAGCTCAGGCCGGGTGCGGTGG - Intronic
1094627650 12:32139845-32139867 TGTGCCCAGGCCAGGAGCGGTGG - Intronic
1094634250 12:32209106-32209128 TGAGCCCAGACTGGGCGCGGTGG - Intronic
1095429937 12:42122300-42122322 TGAACCCTGGCCGGGCACGGTGG + Intronic
1095958517 12:47819675-47819697 GGAGCCGGGGCCAGGGCCGGAGG + Intronic
1095968772 12:47887022-47887044 GGAGCCCTGGCCGGGCGCGGTGG + Intronic
1096175440 12:49513867-49513889 TGAGTACAGGCCGGGCGCGGTGG + Intronic
1096550703 12:52369957-52369979 TGAGCCCAGGGCTGGGGCTGGGG + Intergenic
1096619300 12:52852729-52852751 TGAGACCAGGCCGGGCACGGTGG + Intergenic
1096622098 12:52871416-52871438 TGAGCCAAGGCAGGGGCGGTGGG - Intergenic
1097116555 12:56701638-56701660 TCATCCCAGGCCGAGGCGGGTGG + Intergenic
1099245642 12:80190498-80190520 TGAATCCAGGCCGGGCGCGGTGG + Intergenic
1099574432 12:84362291-84362313 TGTGCCCAGGGCAGGGCGGGTGG - Intergenic
1101272815 12:103165752-103165774 TGAAACCAGGCCGGGCGCGGTGG + Intronic
1102024575 12:109706966-109706988 TGAGCCCAGGTCTGGGGCTGCGG + Intergenic
1102112694 12:110376833-110376855 TGAGCCGAGGCTGGGCACGGTGG + Intronic
1102197236 12:111034279-111034301 TGCGCCCAGGGCGCGCCCGGGGG - Intronic
1102236724 12:111298450-111298472 TGGGCTCAGGCAGGGGCTGGGGG + Intronic
1102349483 12:112181745-112181767 TTACCCCAGGCCGGGCACGGTGG - Intronic
1102644624 12:114396140-114396162 CGAGCCGCGGCCGGGGGCGGGGG + Intronic
1102841504 12:116129619-116129641 TCAGCACAGGCCGGGCACGGTGG + Intronic
1103479423 12:121241504-121241526 AGAGCCCAGGCTGGAGCCGCCGG + Intronic
1103563425 12:121804154-121804176 GGAGCCGAGGCCGGGGCGGCCGG - Intergenic
1103563472 12:121804287-121804309 CGGGCCAGGGCCGGGGCCGGGGG - Intronic
1103600771 12:122053281-122053303 GGAGCCCTGGCCGGGCGCGGCGG - Intronic
1104128726 12:125872452-125872474 AGGGCCCAGGCCGGGCGCGGTGG + Intergenic
1104386732 12:128357407-128357429 GGAGCCCAGGCCGGGCACGGTGG + Intronic
1104488458 12:129172862-129172884 TGAGGCCAGGCCGGGTGCAGTGG - Intronic
1104512367 12:129392343-129392365 TGAGGCCAGGCAGGGGGCGGTGG - Intronic
1104607361 12:130199872-130199894 CTAGCCCAGGCCGGGGAGGGTGG + Intergenic
1104715057 12:131011012-131011034 TGGGCACAGGACGGGGCGGGTGG + Intronic
1104939857 12:132390004-132390026 TGAGCCCAGGTGGGGGGCGGGGG - Intergenic
1104961874 12:132491917-132491939 TGGGCCCAGGACGGGGTGGGTGG + Intronic
1105005065 12:132716514-132716536 AGAGGCCAGGCCGGGCGCGGTGG - Intronic
1105028116 12:132863181-132863203 TGAGGTCAGGCCGGGCGCGGTGG - Intronic
1105031414 12:132887169-132887191 GGGGCTGAGGCCGGGGCCGGGGG - Intronic
1105274521 13:18906823-18906845 TCAGGCCAGGCTGGGCCCGGTGG - Intergenic
1105935665 13:25096122-25096144 AGAGCGCGTGCCGGGGCCGGGGG - Exonic
1106040486 13:26085472-26085494 TCAGTCCAGGCCGGGCACGGTGG - Intergenic
1106127406 13:26911664-26911686 TGAGCAGAGGCCGGGCGCGGTGG + Intergenic
1107530951 13:41281847-41281869 TCTGCCCAGGCCGGGCACGGTGG + Intergenic
1107598368 13:41987151-41987173 AGAGCGCAGGCCGGGCGCGGTGG - Intergenic
1107657838 13:42610037-42610059 AGACCCCAGGCCGGGCGCGGTGG + Intergenic
1108270797 13:48757559-48757581 TGAGCCCAGGCATGGGCAGCAGG - Intergenic
1108588430 13:51891547-51891569 TGAGCCCAGGCTGGGGGAGGTGG + Intergenic
1108618521 13:52159233-52159255 TGAGCCGGGGCCGGCGCCCGCGG + Intronic
1109545763 13:63838520-63838542 GGAGCCCTGGCTGAGGCCGGTGG + Intergenic
1110356751 13:74575885-74575907 TGGGGCCGGGCCGGGGCGGGCGG - Intergenic
1110451326 13:75640243-75640265 AGAGCCCAGGCCAGGTGCGGTGG - Intronic
1110927525 13:81173415-81173437 TGAGCTGAGGCCGGGCGCGGTGG - Intergenic
1111129512 13:83956188-83956210 GAAGCCCAGGCCGGGTGCGGTGG - Intergenic
1111979649 13:95002971-95002993 CGATCACAGGCCGGGGCCCGGGG - Intergenic
1112196819 13:97234485-97234507 TGAGCACAGTGCGGGGGCGGGGG + Intronic
1112480465 13:99770602-99770624 TGAGACCAGACCGGGCGCGGTGG - Intronic
1113004990 13:105690701-105690723 TGTACCCAGGCTGGGGCAGGAGG - Intergenic
1113114006 13:106855511-106855533 TGAGACTAGGACGGGCCCGGTGG + Intergenic
1113967699 13:114163771-114163793 TGGGCCCAGGCCGAGGGCAGGGG + Intergenic
1114063322 14:19038737-19038759 TTAGTCCAGGGCGGAGCCGGGGG + Intergenic
1114098934 14:19361259-19361281 TTAGTCCAGGGCGGAGCCGGGGG - Intergenic
1114751256 14:25207152-25207174 AGAGTCCAGGCCGGGCGCGGTGG - Intergenic
1115285892 14:31712420-31712442 TGCGCCCAGTGCGGGGCCTGTGG + Intronic
1115509787 14:34128343-34128365 TGAGCCCAGGACAGGGCCCTGGG + Intronic
1116477728 14:45360939-45360961 AGAGCCCAGGCCGGGCATGGTGG - Intergenic
1116817915 14:49599929-49599951 TGAGCCCGGGGCCGGGGCGGGGG + Intronic
1116918550 14:50548795-50548817 TGAGACCAGGCCGGGTGCAGTGG - Intronic
1117029175 14:51651697-51651719 TGGGTCCAGGGCGGGGCGGGCGG + Intronic
1117038711 14:51751144-51751166 GGGGCCCTGGCCGAGGCCGGTGG + Intergenic
1117048503 14:51837144-51837166 TGAGATCAGGCCGGGTGCGGTGG - Intronic
1117135611 14:52731720-52731742 TGAACCTAGGCCGGGCGCGGTGG - Intronic
1117465944 14:55994196-55994218 TGAGGCCAGTCAGGGGCTGGTGG - Intergenic
1118220808 14:63853240-63853262 TGAGCCGGGGGCGGGGGCGGCGG + Intronic
1118577629 14:67259321-67259343 TAAGGCCAGGCTGGGGGCGGTGG + Intronic
1118608736 14:67523035-67523057 GGAGCCCAGGCTGGGCGCGGTGG + Intronic
1118831453 14:69437152-69437174 GGATCCCAGGCCGGGCGCGGTGG - Intronic
1119021461 14:71119710-71119732 TTAGGCCAGGCCGGGCACGGTGG - Intergenic
1119426184 14:74535896-74535918 TGAGCCCAGCCCTGGCCCTGGGG + Intronic
1119492949 14:75052229-75052251 TGAGCAAAGGCCGGGTGCGGTGG - Intergenic
1119785897 14:77313994-77314016 GGAGCCCAGGCTGGGTGCGGTGG - Intronic
1119853255 14:77881210-77881232 GGAGGCCTGGCAGGGGCCGGAGG + Intronic
1119917254 14:78413567-78413589 TTAGCCCAGGCCAGGTGCGGTGG - Intronic
1120167239 14:81214356-81214378 TGAGACCCGGCCGGGAGCGGTGG + Intronic
1122016084 14:98797864-98797886 TGAGACCAGCCAGGGGCCTGAGG - Intergenic
1122347773 14:101071160-101071182 TGAACCAAGGCCTGGGGCGGGGG + Intergenic
1122469855 14:101959006-101959028 TCAGCCCAGGCCGGGCGTGGTGG + Intergenic
1122504354 14:102222243-102222265 AGGGCCCAGGCCGAGGTCGGGGG - Intronic
1122659932 14:103288285-103288307 TCAGCCCCGCCCGGGGCCGCAGG + Intergenic
1122723062 14:103732768-103732790 TGAGCCCAGGCCAGGGAGGCTGG + Intronic
1122737907 14:103854422-103854444 TAAGTCCAGGCCGGGCGCGGTGG + Intergenic
1122744813 14:103891407-103891429 AGTGCCCAGGCCAGGGCCGAAGG - Intergenic
1122916813 14:104863246-104863268 GGAGCCCAGGACCGAGCCGGGGG - Intergenic
1122930982 14:104933012-104933034 GAAGCCCAGGCCGGGGTCAGAGG - Exonic
1123044817 14:105506559-105506581 AGAGCCCAGGCCGGGCGCAGTGG - Intergenic
1123064595 14:105611057-105611079 TGAGCCAAGGCTGGAGCCAGAGG - Intergenic
1123073897 14:105656698-105656720 TGAGCCAAGGCTGGAGCCAGAGG - Intergenic
1123087897 14:105726281-105726303 TGAGCCAAGGCTGGAGCCAGAGG - Intergenic
1123093856 14:105755654-105755676 TGAGCCAAGGCTGGAGCCAGAGG - Intergenic
1123110275 14:105863938-105863960 TGAGCCCGGGGAGGGCCCGGGGG + Intergenic
1123463541 15:20496022-20496044 TAATCCCAGGCCGAGGCGGGTGG - Intergenic
1123654521 15:22504403-22504425 TAATCCCAGGCCGAGGCGGGTGG + Intergenic
1123737889 15:23202638-23202660 TGAGCACAGGCCGGGCGCGGTGG - Intergenic
1123866692 15:24526640-24526662 TGAGACCAGGCAGGAGCAGGTGG + Intergenic
1124274385 15:28313420-28313442 TAATCCCAGGCCGAGGCGGGTGG - Intronic
1124289097 15:28431307-28431329 TGAGCACAGGCCGGGCGCGGTGG - Intergenic
1124294125 15:28486003-28486025 TGAGCACAGGCCGGGCGCGGTGG + Intergenic
1124308431 15:28599599-28599621 TAATCCCAGGCCGAGGCGGGTGG + Intergenic
1124435364 15:29644513-29644535 TGAGTCCTGGCCGGGCGCGGTGG + Intergenic
1124473211 15:30007358-30007380 TGAGCTCAGGCCTGGGGCTGGGG + Intergenic
1124500451 15:30223309-30223331 GGGGCCGGGGCCGGGGCCGGCGG + Intergenic
1124743123 15:32315358-32315380 GGGGCCGGGGCCGGGGCCGGCGG - Intergenic
1125138161 15:36368595-36368617 TCAGCACAGGCCGGGCGCGGTGG + Intergenic
1125485609 15:40108821-40108843 CGGGCACAGGCCGGGGCGGGAGG + Exonic
1125672865 15:41486313-41486335 GGCGCCCAGGCCGGTGCGGGGGG - Intergenic
1125929503 15:43590148-43590170 TGAGTGAAGGCCGGGGGCGGTGG - Intronic
1125942670 15:43689980-43690002 TGAGTGAAGGCCGGGGGCGGTGG - Intergenic
1126001114 15:44210876-44210898 TCAGCCCAGGCTGGGTGCGGTGG - Intergenic
1127382191 15:58439727-58439749 TAAGCCCTGGCCGGGGGCGGTGG - Intronic
1127819339 15:62641327-62641349 CAAGCCCAGGCCGGGCACGGTGG + Intronic
1127995747 15:64152346-64152368 AGAGGCTGGGCCGGGGCCGGTGG - Intronic
1128099845 15:64989748-64989770 TGGGCCCGGGTCGGGGCGGGCGG + Exonic
1128298065 15:66542161-66542183 GTAGCCCAGGCCGGGCACGGTGG + Intronic
1128318946 15:66679405-66679427 TGAGCCCTGGCCAGGCCCAGTGG + Intronic
1128683518 15:69667815-69667837 GGAGCCCAGGACGGTGCTGGTGG + Intergenic
1128881147 15:71244070-71244092 TGAGCACAGGCCAGGTGCGGTGG - Intronic
1129275309 15:74441639-74441661 TGAGCCCAGCCCAGGGCCAGAGG + Intergenic
1130540225 15:84817000-84817022 CGAGGCCTGGCCGGGGCCAGGGG - Exonic
1131074509 15:89486775-89486797 TGAGCGCAGGGCGGGCCCCGGGG - Intronic
1131257300 15:90871316-90871338 AGAGCCGAGCCCGGGGGCGGGGG + Intronic
1131281435 15:91024488-91024510 TGAACCCAGACCGAGGCAGGTGG + Intergenic
1131676159 15:94672779-94672801 TGTGGCCAGGTCGGGGCAGGGGG + Intergenic
1132407088 15:101549798-101549820 TCATCCCAAGCCGGGGCCAGAGG + Intergenic
1132497207 16:269479-269501 TGAGCCCAGGCAGTGCCCTGTGG - Intronic
1132559904 16:588954-588976 CGACCCCACGCCGGGGCCCGCGG + Intergenic
1132575245 16:661005-661027 TGAGGCCGGGCCGGGGGGGGGGG - Intronic
1132590412 16:724016-724038 TGAGCCCAGGATGAGGCCTGGGG + Intronic
1132619039 16:855743-855765 TGAGCCCAGGCAGGTGCCAGAGG + Intronic
1132637372 16:958597-958619 AGTGCCCAGGCCGGGCGCGGTGG + Intronic
1132683578 16:1153343-1153365 GGGGCCGGGGCCGGGGCCGGGGG + Exonic
1132735984 16:1386263-1386285 TTAGCCAAGGCCGGGCGCGGTGG + Intronic
1132736596 16:1389055-1389077 GGGGCCGGGGCCGGGGCCGGGGG - Intronic
1132889415 16:2196571-2196593 CGAGCCCAAGCCGGAGCCCGAGG - Intergenic
1132892195 16:2209913-2209935 TGGGCGCAGGCCCGGGCCAGGGG - Intronic
1132915199 16:2340372-2340394 GGAGCCGAGGCCGCGGCAGGAGG + Intronic
1132952582 16:2572166-2572188 TGACTCCAGGCCGGGCGCGGTGG + Intronic
1132961769 16:2628004-2628026 TGACTCCAGGCCGGGCGCGGTGG - Intergenic
1133055449 16:3143399-3143421 TGAGGGGAGGCGGGGGCCGGTGG + Intergenic
1133273173 16:4621067-4621089 TGAATCCAGGCCGGGCACGGTGG + Intronic
1133498712 16:6344950-6344972 TAAGACCAGGCCGGGCTCGGTGG - Intronic
1133574530 16:7075865-7075887 CAAGCCCAGGCCGGGCGCGGTGG - Intronic
1134061503 16:11202239-11202261 TGAGGCCAGGAAGGGGCCAGGGG - Intergenic
1134508170 16:14824633-14824655 TGAGCCCTGCGCGGGGCAGGGGG - Intronic
1134691780 16:16195598-16195620 TGAGACCAGGCGGGGCACGGTGG - Intronic
1134695868 16:16223398-16223420 TGAGCCCTGCGCGGGGCAGGGGG - Exonic
1134876414 16:17703439-17703461 TGAGACTAGGCCGGGCACGGTGG + Intergenic
1134975958 16:18571290-18571312 TGAGCCCTGCGCGGGGCAGGGGG + Intergenic
1136153456 16:28366911-28366933 CCAGCCCAGGCCGAGGCGGGAGG + Intergenic
1136209630 16:28748356-28748378 CCAGCCCAGGCCGAGGCGGGAGG - Intergenic
1136223107 16:28841333-28841355 TGAGCCGAGGCCAGGCACGGTGG - Intergenic
1136237827 16:28925337-28925359 GGGGCCGGGGCCGGGGCCGGGGG - Exonic
1136266206 16:29120636-29120658 TGAGTCCCGGCTGGGGGCGGTGG - Intergenic
1136406891 16:30053352-30053374 TGAGGCCATGGCTGGGCCGGAGG - Intronic
1136709479 16:32224324-32224346 TGAGCACAGGCCGGGCGCGGTGG + Intergenic
1136758430 16:32705095-32705117 TGAGCACAGGCCGGGCGCGGTGG - Intergenic
1136779094 16:32885942-32885964 CGGGCCCCGGTCGGGGCCGGGGG - Intergenic
1136784279 16:32925515-32925537 GGAGCCCGGGCCGGCGGCGGCGG + Intergenic
1136809678 16:33165284-33165306 TGAGCACAGGCCGGGCGCGGTGG + Intergenic
1136816154 16:33275364-33275386 TGAGCACAGGCCGGGCGCGGTGG + Intronic
1136885505 16:33928291-33928313 GGAGCCCGGGCCGGCGGCGGCGG - Intergenic
1136891523 16:33975576-33975598 CGGGCCCCGGCCGGGGCCGGGGG + Intergenic
1137807217 16:51319004-51319026 AGAGCCCTGGCCGGGTGCGGTGG + Intergenic
1138116174 16:54362403-54362425 TGTGGCCAGGCTGGGGCTGGGGG + Intergenic
1138163272 16:54776119-54776141 TGAGACCAGGCCGGGTGCAGTGG - Intergenic
1138390691 16:56668164-56668186 ACAGCCCAGGCCGGGACCGCGGG - Intronic
1138550190 16:57743655-57743677 TGAGCCAGGGCAGGGGCCCGGGG - Intronic
1138583554 16:57956801-57956823 TGAGACCAGGAAGGGGCTGGAGG - Intronic
1138589274 16:57990811-57990833 TGAGCCCAGGGCGGGCCAGAGGG - Intergenic
1139164503 16:64550178-64550200 TGAATCCAGGCCGGGCACGGTGG + Intergenic
1139310806 16:66026512-66026534 TGAGCCCTGGCCGGGCATGGTGG + Intergenic
1139527174 16:67524290-67524312 AGAGTCCAGGCTGGGGCTGGAGG + Intronic
1139540258 16:67609911-67609933 TCAGGCCAGGCCGGGCACGGTGG - Intronic
1139582303 16:67880799-67880821 CGGGCCCTGGCCGGGGCCGTGGG - Exonic
1139761444 16:69187420-69187442 GGAGCCCAAGCCGCGGCCTGGGG + Exonic
1140416536 16:74777637-74777659 TGAGGCCAGGCCGGGCGCGGTGG + Intergenic
1140563581 16:76012846-76012868 TGTGGCCAGGTCAGGGCCGGAGG - Intergenic
1141425494 16:83942053-83942075 TGATTCCAGGCCGGGCGCGGTGG - Intronic
1141593662 16:85084848-85084870 TGAGTTCAGGCCGGGTGCGGTGG - Intronic
1141769669 16:86082136-86082158 TCATCCCAGGCCGGGCGCGGTGG - Intergenic
1141871509 16:86789678-86789700 TGACTCCAGGCAGGGGCCGACGG - Intergenic
1141897056 16:86964910-86964932 GGAGGGCAGGCAGGGGCCGGCGG - Intergenic
1141934236 16:87226681-87226703 TGAGGCTAGGCCGGGCGCGGTGG + Intronic
1142055013 16:87988550-87988572 TGAGTCCCGGCCGGGGGCGGTGG - Intronic
1142194848 16:88734626-88734648 TGAGTCCAGGCTGGGGCGGTGGG - Intronic
1142234826 16:88917155-88917177 TGACCCCAGGCCCGGGCTGCAGG + Intronic
1142297548 16:89235869-89235891 CAAGCCCAGGCCGGGGGCGGTGG + Exonic
1142362103 16:89632338-89632360 TGACCCCCGGCCGGGCGCGGTGG - Intronic
1203060584 16_KI270728v1_random:965429-965451 TGAGCACAGGCCGGGCGCGGTGG - Intergenic
1203081509 16_KI270728v1_random:1148030-1148052 CGGGCCCCGGCCGGGGCCGGGGG - Intergenic
1142593694 17:1019376-1019398 TGAGGCCAGGCCTGGGCCAGGGG + Intronic
1142688556 17:1591579-1591601 TGAGCCCTTCCCGGGGCCGGAGG - Exonic
1142879024 17:2870055-2870077 TGAGGCCATGCCGGGGTCAGGGG - Intronic
1143016382 17:3893102-3893124 TGAGCGCCGGCCGGGCGCGGCGG - Intronic
1143022757 17:3925249-3925271 AGACCCCAGGACGGGGCCCGGGG + Intronic
1143023642 17:3929093-3929115 TGTGCCCAGGCTGGGGTGGGAGG - Intronic
1143120582 17:4604130-4604152 TGAGTTCAGGCCGGGCGCGGTGG - Intronic
1143400761 17:6640613-6640635 TGGGCTCGGGCCGGGGCTGGGGG - Intronic
1143454270 17:7055977-7055999 TAATCCCAGGCCGGGTCCGGTGG + Intergenic
1143505507 17:7362509-7362531 AGAGGCCAGGCCGGGCGCGGTGG + Intergenic
1143582250 17:7834260-7834282 TTCTCCCAGGCCGGGGCTGGGGG - Intergenic
1143661812 17:8329236-8329258 CGAGACCAGGCCGGGCGCGGTGG + Intergenic
1143747358 17:9003942-9003964 GGAGCCGAGGCCGAGGCCGGCGG - Intergenic
1143747378 17:9004013-9004035 TGGACCCAGGCGGGGGCCGAGGG + Intergenic
1143787753 17:9268898-9268920 TGAGGCCAGGCCGGGTGCAGTGG + Intronic
1143863077 17:9905239-9905261 TGAGCCCAGCCTGCGGCCAGGGG - Exonic
1144237060 17:13271894-13271916 TGAGTCTTGGCCGGGGGCGGTGG - Intergenic
1144250498 17:13411917-13411939 TGAGGGCAGGCCGGGCACGGTGG + Intergenic
1144252744 17:13436065-13436087 TTAGCACAGGCCGGGCGCGGTGG - Intergenic
1144346796 17:14356691-14356713 TGAGGGCTGGCCGGGCCCGGTGG + Intergenic
1144858292 17:18283124-18283146 TAATCCCAGGCCGAGGCGGGCGG + Intronic
1145210823 17:21011716-21011738 CGTGCCCAGGCCAGGCCCGGTGG + Intronic
1145819013 17:27817022-27817044 TGAGACTAGGCCGGGTGCGGTGG - Intronic
1146305460 17:31726719-31726741 TGAGTTCAGGCCAGGGACGGTGG - Intergenic
1146383508 17:32349107-32349129 TGGGCCAAGGCCGAGGCAGGCGG - Intronic
1147015128 17:37485638-37485660 TGAGCTCAGGCCGGGCGCGGTGG - Intergenic
1147144570 17:38477662-38477684 GGAGCCCGGGCCGGCGGCGGCGG + Exonic
1147227506 17:38991011-38991033 TGAGTCAAGGCCGGGCGCGGTGG - Intergenic
1147368867 17:39977577-39977599 TAAGCACAGGCCGGGCACGGTGG - Exonic
1147443002 17:40458781-40458803 GGAGCCCAGGCCAAGGCCTGTGG + Intergenic
1147650547 17:42059343-42059365 TGAGCCCAGCACAGGGCTGGAGG + Intronic
1147769612 17:42858432-42858454 GAAGCCCAGGCCAGGGCAGGAGG + Intergenic
1147934515 17:44004283-44004305 TGAGCACAGGGCTGGGCAGGGGG - Intronic
1147971166 17:44219713-44219735 CGAGCTGAGGCCGGGGCCGGCGG - Intronic
1148486104 17:47991743-47991765 GGAGCCCAGGCAGGGGACAGGGG + Intergenic
1148615540 17:48997583-48997605 CGAGCCCAGGGCGGGGAAGGCGG - Exonic
1149250216 17:54759625-54759647 TGAGCTGAGGCCGGGCACGGTGG - Intergenic
1149890245 17:60382958-60382980 TAAGCACAGGCCGGGCGCGGTGG + Intronic
1149994628 17:61400130-61400152 GGGGCCGGGGCCGGGGCCGGGGG - Exonic
1150108535 17:62478948-62478970 AGGGCCCAGGCCGGGCCAGGAGG - Intronic
1150123872 17:62624216-62624238 TGAGACCAGGCCGGGTGTGGTGG + Intergenic
1150249892 17:63699642-63699664 TGAGGGGAGGTCGGGGCCGGCGG + Intronic
1151259287 17:72904143-72904165 TGAGCCCAAGCCGGGCGCGGTGG + Intronic
1151306648 17:73266968-73266990 TGATCCCAGGCCGGGGGCATGGG - Intergenic
1151537704 17:74748327-74748349 GGAAACCAGGCCGGAGCCGGCGG + Intergenic
1151632753 17:75322084-75322106 AGAGTCCAGGCCGGGTGCGGTGG + Intronic
1151664436 17:75537404-75537426 TGATCCCAGGCTGGGTGCGGTGG + Intronic
1151729308 17:75901467-75901489 TGTGCCAAGGCCGGGCCAGGAGG + Intronic
1151753368 17:76055252-76055274 TCAGCCTAGGCCGGGTGCGGTGG - Intronic
1151759738 17:76093830-76093852 TGATGAGAGGCCGGGGCCGGTGG - Intronic
1152173551 17:78770658-78770680 TAATCCCAGGCCGAGGCAGGCGG - Intronic
1152184151 17:78843657-78843679 GCAGCCCAGGCCCGGGCAGGTGG + Intergenic
1152198237 17:78930020-78930042 TGAATCCTGTCCGGGGCCGGAGG + Intergenic
1152626525 17:81390278-81390300 TCAGCCCAGGCCTGGTCGGGAGG + Intergenic
1152650289 17:81489387-81489409 GGAGGCCAGGCCAGGGCCGTGGG - Intergenic
1152690666 17:81716396-81716418 AGACCCCAGGCCGTGGCAGGAGG - Intronic
1152851016 17:82635843-82635865 GGAGGCCAGGCCGAGGCAGGTGG + Intronic
1152930105 17:83104985-83105007 TGAGCCCCCGCCTGGACCGGTGG - Intergenic
1153031877 18:721248-721270 TGACCACAGGCCGGGCGCGGTGG + Intergenic
1153901567 18:9621904-9621926 TTAGCCTAGGCCGGGCGCGGTGG + Intergenic
1154156503 18:11948021-11948043 ACAGCCCAGGCCGGCGCCCGAGG + Intergenic
1154466206 18:14644072-14644094 TCAGGCCAGGCTGGGCCCGGTGG - Intergenic
1155268404 18:24116253-24116275 TCAGCCCAGGCCGGGCACGGTGG + Intronic
1158644871 18:59237161-59237183 TCAGCTCAGGCCGGGCGCGGTGG + Intergenic
1159582667 18:70250509-70250531 TGAGAGCAGGCCGGGCGCGGTGG + Intergenic
1159927107 18:74279238-74279260 TGAGACAAGGCCGGGCGCGGTGG + Intronic
1160044376 18:75373102-75373124 TGAGCCCAGGCCTGCTCAGGTGG + Intergenic
1160462259 18:79048019-79048041 TCAGCCCTGCCCGGGGCCGCTGG - Intergenic
1160719300 19:590347-590369 CGCGCCGGGGCCGGGGCCGGCGG + Exonic
1160739636 19:680005-680027 TGCGCGCGGGCCGGGGCGGGGGG - Intronic
1160744994 19:707133-707155 TGAGACCAGGCCGGGCGCGGTGG - Intergenic
1160806500 19:994422-994444 AGAGTCCAGGCCTGGGCTGGTGG - Exonic
1160813819 19:1026443-1026465 TGTGCCCAGGCGGGGGTCCGGGG + Intergenic
1160935417 19:1592423-1592445 GGGGCCCAGGCCGCGGCCCGGGG + Intronic
1160946935 19:1648048-1648070 TCAGCCCAGGCCAGTGCTGGCGG + Intronic
1160958228 19:1705093-1705115 TGAGCCAAGGCCAGGCGCGGTGG - Intergenic
1161092026 19:2365667-2365689 AGAGCCCAGACCGAGGCTGGGGG + Intergenic
1161182694 19:2895496-2895518 TGAGGACAGGCCGGGCACGGGGG + Intergenic
1161255442 19:3306478-3306500 TGAGCCCAGGCCGGGCGTGGTGG - Intergenic
1161363493 19:3865034-3865056 TGAGCGCAGGCCGGGCACGGTGG - Intronic
1161400556 19:4065107-4065129 TGAGCCCGGGCAGGGGAGGGGGG - Intronic
1161408355 19:4102756-4102778 CCAGCCCAAGCCGCGGCCGGGGG + Intronic
1161413258 19:4129153-4129175 TGACACCAGGCCGGGTGCGGTGG - Intergenic
1161485714 19:4534750-4534772 TGGGCCCAGGCAGGGGCCGCAGG - Intronic
1161605814 19:5214336-5214358 GGGGCCCAGGCTGGGGCTGGGGG - Intronic
1161706049 19:5822302-5822324 TGAGCCGAGCCCAGGCCCGGAGG + Intergenic
1161721194 19:5903588-5903610 TGAGCGCCGGCCGGGCCCCGAGG - Intronic
1161806957 19:6449935-6449957 TGAACCCAGGGCGGGGCATGGGG - Intronic
1162066071 19:8126195-8126217 AGACTCCAGGGCGGGGCCGGAGG + Intronic
1162079360 19:8209302-8209324 GGAGCCCGGGGCGGGGCCGTGGG - Intronic
1162109074 19:8390538-8390560 TGGGCCCAGGCCGGAGCCCGGGG + Intronic
1162939267 19:13998195-13998217 TGAGATCAGGCCGGGCACGGTGG + Intronic
1162961872 19:14132875-14132897 TAATCCCAGGCCGAGGCGGGCGG + Intronic
1163105729 19:15122190-15122212 AGAGCCCAGGCCGGGTGCGGTGG - Intronic
1163151644 19:15418600-15418622 GGAGCGCAGGCCAGGGACGGAGG + Intronic
1163443559 19:17333869-17333891 GGAGCCCTGGCGGGGGCAGGAGG - Intronic
1163485939 19:17586082-17586104 TGAACCCAGGGTGGGGGCGGAGG - Intergenic
1163588073 19:18174584-18174606 TGGGCCAAGGCCGGAGGCGGTGG + Intronic
1163676850 19:18659742-18659764 TGAGGCCAGCCCGGGGCCGGAGG + Intronic
1163724263 19:18913583-18913605 TGAGCCCAGGCCAGGGAGGGAGG + Intronic
1163834424 19:19564504-19564526 TAATCCCAGGCCGAGGCGGGCGG - Intronic
1164179549 19:22807142-22807164 TGAGCCCAGCCCCTGCCCGGCGG - Intergenic
1164408638 19:27977416-27977438 TGAACCCATCCAGGGGCCGGGGG + Intergenic
1164685771 19:30165654-30165676 TGACCCCAGGCAGGGGACAGAGG + Intergenic
1165144828 19:33724415-33724437 TGAGCCCGGATGGGGGCCGGGGG - Intronic
1165246844 19:34502839-34502861 GGAGCCCAGGCCAGGCACGGTGG - Exonic
1165448319 19:35868785-35868807 TGAGGCCGGGCCGGGTCCTGGGG + Intronic
1165779804 19:38425797-38425819 TCAGCCCAGGCCAGGGATGGAGG + Intronic
1165861211 19:38910580-38910602 TGAGCCCAGGCAGGAGAAGGAGG - Exonic
1165939168 19:39406774-39406796 GGGGCCGGGGCCGGGGCCGGGGG - Intergenic
1165950742 19:39472855-39472877 TGAGCAGGGGCCGGGGCCGGAGG + Exonic
1166046499 19:40233621-40233643 ACAGCCCAGGCCTGGGCGGGAGG + Exonic
1166385174 19:42376618-42376640 TGACCCCAGGCAGGCGCCGTTGG - Exonic
1166524968 19:43504911-43504933 TGGGGCCGGGCCGGGGCCGGTGG - Exonic
1166713254 19:44950637-44950659 TCAGCCCAGGCCTGGTGCGGTGG - Intronic
1166846333 19:45730823-45730845 AGAGCCCAGGCGCGGGCCGGGGG - Intronic
1166852882 19:45768805-45768827 GGAGCCGAGCGCGGGGCCGGCGG - Exonic
1166952300 19:46437598-46437620 TTAGCCAAGGCCGGGCGCGGTGG - Intergenic
1167085651 19:47307925-47307947 TGAACCCAGGCCGGGCGCAGTGG + Intronic
1167411333 19:49345739-49345761 TGAGCCCAGGCCAGGCACTGTGG + Intronic
1167615562 19:50531033-50531055 TGAGCCTAGGCTGGGCACGGTGG - Intronic
1167986130 19:53317837-53317859 TGAGGCAAGGCCGGGCGCGGTGG - Intergenic
1168072225 19:53959613-53959635 TGAGGTCAGGCTGGGGCTGGGGG - Intergenic
1168078127 19:53991630-53991652 GGAGGCCAGGCCGGTGGCGGTGG + Intergenic
1168145303 19:54416828-54416850 TGGGCCGAGGCCGGAGCCGGTGG - Intronic
1168339597 19:55615518-55615540 TGCGCCCTGGCCGGGGCAGCCGG + Exonic
1168359354 19:55725737-55725759 GGAACCCAGGCCGGGCGCGGTGG + Intronic
1168504613 19:56922789-56922811 TGAGCTCTGGCCTGGGCCTGTGG + Intergenic
1168577794 19:57527640-57527662 TGACCCCAGTCCGGGGCCTCAGG - Intronic
925189033 2:1868248-1868270 AGAGCCAAGGCCGGGCGCGGTGG - Intronic
925287992 2:2728397-2728419 ACAGCCCAGGCCGGGCACGGTGG + Intergenic
925351268 2:3202222-3202244 TGAACCTAGGCCGGGTGCGGTGG - Intronic
925923893 2:8657243-8657265 TGAGCTCAGGGTGGGGGCGGGGG - Intergenic
926246628 2:11126395-11126417 TGGGCCCAGGCCGGGCATGGTGG + Intergenic
926340212 2:11898995-11899017 TGGGCCAGGGCCAGGGCCGGAGG + Intergenic
926749861 2:16190136-16190158 AGATGCCAGGCCGGGGGCGGTGG + Intergenic
927501167 2:23584265-23584287 AGAGCCCATACCGGGGCAGGCGG + Intronic
927594771 2:24386668-24386690 AGAGACCAGGCCGGGCGCGGTGG - Intergenic
927595363 2:24392181-24392203 GGAGTTCTGGCCGGGGCCGGTGG + Intergenic
928022177 2:27713929-27713951 TGACCACAGGCCGGGCACGGTGG + Intronic
928696747 2:33856859-33856881 TGACCCCAGGCCGGGCACGGTGG - Intergenic
929576851 2:43057436-43057458 TGAGCCCTGCCAGGGGCCAGTGG + Intergenic
929828554 2:45329345-45329367 TGAGCCCAGGCTGGGTTGGGAGG - Intergenic
929966908 2:46542985-46543007 TGAGCCCGGGGCCGGGGCGGGGG + Exonic
930651347 2:53967983-53968005 TTAGTCCAGGCCGGGTGCGGTGG + Intronic
930824884 2:55686925-55686947 TGAGACCAGGCCAGGCGCGGTGG + Intronic
931224792 2:60320500-60320522 GGAGCCCAGGCCAGGACAGGAGG + Intergenic
931623837 2:64237117-64237139 TGATCCCAGGCTGGGCACGGTGG - Intergenic
932353346 2:71049088-71049110 GGGGCCCTGGCCGAGGCCGGTGG + Intergenic
932435157 2:71699066-71699088 TGTGCCCAGCCTGGGGCTGGAGG - Intergenic
932442593 2:71747212-71747234 TGGGCCCAGGGCGGGGCTGGGGG - Intergenic
933548739 2:83746947-83746969 TGAGTTCTGGCCGGGCCCGGTGG - Intergenic
933847460 2:86337411-86337433 CGCGCGCAGCCCGGGGCCGGGGG + Intronic
934718431 2:96556520-96556542 TGACCCCTGGCTGGGGGCGGGGG - Intergenic
934947738 2:98554221-98554243 TGAGCCCAGGCCAGGGGCTGGGG - Intronic
935130085 2:100255138-100255160 AGAGGCCAGGCCGGGTCCTGAGG - Intergenic
935164972 2:100562594-100562616 TGATCCCAGGCCGAGGCGGGCGG - Intergenic
935261915 2:101362960-101362982 TGAGCACAGTCAGGGTCCGGAGG - Intronic
935291075 2:101611540-101611562 TGATCCCAGGCCGGGCGTGGTGG + Intergenic
935342129 2:102067851-102067873 TGAGGCCAGGCCGGGCACGGTGG + Intronic
936512144 2:113157301-113157323 TGAGGCCGGGCCGGGGTTGGGGG - Intergenic
936985771 2:118310478-118310500 GGAGCCCGGGAGGGGGCCGGTGG - Intergenic
937672571 2:124553944-124553966 TGAGCCAAGGCAGGTGCCGATGG + Intronic
937943839 2:127312880-127312902 TGAACCCAGGGTGGGGGCGGAGG + Intronic
938197087 2:129337962-129337984 TCAGCCAAGGCCGGGCGCGGTGG + Intergenic
938343411 2:130549846-130549868 AGCGCTCAGGCCAGGGCCGGCGG - Exonic
938346422 2:130570876-130570898 AGCGCTCAGGCCAGGGCCGGCGG + Exonic
938407465 2:131040453-131040475 AGCGCCCAGGTAGGGGCCGGGGG - Intronic
938455665 2:131460937-131460959 TGAGCCCGGGGCCGGGGCGGGGG + Intergenic
938727597 2:134121143-134121165 TGAGGCGAGGCAGGGGCCAGGGG - Intronic
939683751 2:145171610-145171632 AGAGCCCAGGCTGGGTGCGGTGG - Intergenic
941905975 2:170716380-170716402 TGAGCCCAGCGCGGGGTCGTAGG - Exonic
944431210 2:199635610-199635632 TGATCTCAGGCCGGGCGCGGTGG - Intergenic
944770860 2:202912633-202912655 CGAGCCCCGTCCCGGGCCGGGGG - Intronic
945041032 2:205744029-205744051 AGAGTCCAGGCCGGGCGCGGTGG - Intronic
945094129 2:206203027-206203049 AGAGCCCAGGCCGGGCACGGTGG + Intronic
945506310 2:210645505-210645527 TGAGTTCAGGCCGGGGATGGTGG + Intronic
945885903 2:215375232-215375254 TGACACCAGGGCGGGGCCGAGGG + Exonic
946422206 2:219571292-219571314 CGAGCCGAGGCCCGGGGCGGCGG + Intronic
946434313 2:219641792-219641814 AGAGCCCAGCCCTGGGCTGGGGG + Exonic
946578405 2:221101203-221101225 AGAGTCCAGGCCGGGTGCGGTGG + Intergenic
946664501 2:222034949-222034971 TTAGCCGAGGCCGGGCGCGGTGG - Intergenic
946728914 2:222689965-222689987 AGAGTCCAGGCCGGGCGCGGTGG + Intronic
947399244 2:229714993-229715015 TGAGGCAAGGCCGGGCCCCGCGG - Intergenic
947518736 2:230828480-230828502 TGAGCCCTGGGTGGGGCCAGGGG - Intergenic
947704709 2:232264897-232264919 CGAGCCCAGGCTGGGGAAGGAGG - Intronic
947800761 2:232927691-232927713 TGAGCCCCGGCCCGGGCCCCTGG - Intronic
947810585 2:233001462-233001484 TGAGCCCAGGAGTGGGCTGGAGG + Intronic
948138148 2:235652602-235652624 TGATCCTAGGCCGGGTGCGGTGG + Intronic
948297079 2:236868661-236868683 TAAGACCAGGCCGGGCGCGGTGG - Intergenic
948598586 2:239095892-239095914 CCAGCCCAGGAAGGGGCCGGGGG - Intronic
948615401 2:239195305-239195327 TGAGCAATGGCCGTGGCCGGAGG - Intronic
948684214 2:239659932-239659954 TGAGGCCAGGCCAGGCGCGGTGG - Intergenic
948742196 2:240055400-240055422 GGAGCGCAGGCCAGGGCAGGAGG + Intergenic
948803592 2:240443617-240443639 TGAGCCCAGCACGGGGCAGTGGG + Intronic
948893366 2:240917434-240917456 TGACCTCAGGCCTGGGCTGGTGG - Intergenic
948981541 2:241497194-241497216 TGTGCCCAGGGCGTGGCCAGCGG - Intronic
949009768 2:241671795-241671817 CGAGCCCAGGCCGGCTCCTGCGG - Intronic
1168765472 20:379380-379402 TGGACCCAGGCCGGGCGCGGTGG + Intronic
1168769755 20:407954-407976 GGGGCCGGGGCCGGGGCCGGGGG - Intronic
1168839394 20:899538-899560 TTGTCCCAGGCCGGGGGCGGTGG - Intronic
1170026034 20:11890871-11890893 AGTGCCCCGGCCGGGGCCTGAGG + Exonic
1170380922 20:15758860-15758882 GGACCCCAGGCCGGGCACGGTGG + Intronic
1170791313 20:19511612-19511634 TAAGCCCAGGCCGGGCGCGGTGG - Intronic
1170889345 20:20365304-20365326 TGCGCCAAGGCCGGCGTCGGGGG + Intergenic
1170933867 20:20793161-20793183 CGAGTCCCGGCCGGGGGCGGTGG - Intergenic
1171408460 20:24929597-24929619 GGGGCCCTGGCCGAGGCCGGTGG + Intergenic
1171425640 20:25046939-25046961 GGAGCCCTGGCCGAGGCTGGTGG + Intronic
1171480685 20:25453761-25453783 TGACCCAAGGCCGGGGGCAGTGG + Intronic
1171488603 20:25501082-25501104 TGAGCACAGGCTGGGGAGGGTGG - Intronic
1171978368 20:31609675-31609697 TGAACACAGGCCGGGCACGGTGG - Intergenic
1172655119 20:36532131-36532153 TAAACCCAGGCCGGGCACGGTGG + Intergenic
1173223222 20:41146184-41146206 TGAGCCCAGGCCTGGCACAGAGG + Intronic
1173462836 20:43257881-43257903 GGAGCCAAGGCCGGGCACGGTGG + Intergenic
1173525011 20:43725337-43725359 CAAGTCCAGGCCGGGCCCGGTGG - Intergenic
1173864573 20:46306105-46306127 TGCTCCCAGGCCAGTGCCGGAGG - Intronic
1173898901 20:46572395-46572417 TGAGCCCAGCCCTGGGCAGCTGG - Intronic
1174231714 20:49050696-49050718 TGGGCTCAGGCCGGGCGCGGTGG - Intronic
1174407738 20:50313009-50313031 TGTTCCCAGGCCGGGGGCCGGGG + Intergenic
1175095166 20:56535302-56535324 TGAACCCCGGCCGGGGGTGGTGG + Intronic
1175127657 20:56764406-56764428 TGGGCGCAGGCCGGGCCTGGTGG - Intergenic
1175248345 20:57594510-57594532 TCAGCCCAGGCCGGGGTCCACGG + Intergenic
1175823972 20:61926583-61926605 TGAGCCCGGGCCAGGCCCCGTGG + Intronic
1176150734 20:63589454-63589476 TGAGCACCGGCTGGGGGCGGGGG + Exonic
1176182554 20:63757824-63757846 TGAGCCCTGGACGGGGCGGGTGG - Intronic
1176182580 20:63757915-63757937 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176182589 20:63757946-63757968 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176182649 20:63758158-63758180 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176182660 20:63758189-63758211 TGAGCTCTGGACGGGGCGGGTGG - Intronic
1176262611 20:64190384-64190406 TGACCCCAGGCTGGGCCCGGTGG + Intronic
1176784490 21:13238616-13238638 TGAACCCAGGCCGGGCACAGTGG + Intergenic
1176808381 21:13514524-13514546 TCAGGCCAGGCTGGGCCCGGTGG + Intergenic
1177789146 21:25703137-25703159 TGAGGACAGGCCGGGTACGGTGG - Intronic
1177982540 21:27932468-27932490 TGAACCCAGGCCGGGCACGGTGG + Intergenic
1178264242 21:31127701-31127723 TGAGTTCAGGCCGGGCGCGGTGG - Intronic
1178441104 21:32599056-32599078 TGAGCCCTGTCCAGGGCCAGTGG + Intronic
1178491684 21:33056549-33056571 GAGGCCGAGGCCGGGGCCGGAGG + Intergenic
1178583029 21:33851684-33851706 AGAGCCCAGGCCGGGTGCAGTGG - Intronic
1178931984 21:36827279-36827301 TGAGCTGAGGCCGGGCACGGTGG + Intronic
1179424140 21:41260075-41260097 GGAGGCCACGGCGGGGCCGGGGG - Intronic
1179442308 21:41403824-41403846 TCTGCCCAGGCCTGGGCTGGTGG + Intronic
1179792967 21:43766096-43766118 TGAGCCTGGGCGGGGGCCGGGGG + Intergenic
1180057081 21:45364616-45364638 TGAGCTCAGCCCGGGACCTGGGG + Intergenic
1180180307 21:46115963-46115985 TGAGCCCAGCCCTGGGGCGCTGG - Intronic
1180232104 21:46433092-46433114 TGAGAGCAGGCCGGGCACGGTGG + Intronic
1180481818 22:15761371-15761393 TTAGTCCAGGGCGGAGCCGGGGG + Intergenic
1180858718 22:19064541-19064563 TGAGCGCAGGCAGGGGGCTGGGG - Intronic
1180980706 22:19876819-19876841 TGTGGCCAGGCCGGGGTCTGGGG + Intronic
1181180770 22:21066705-21066727 TCAGCACAGGCCGGGCGCGGTGG - Intergenic
1181572856 22:23777133-23777155 TAAGCCCAGGCCGGGCGCGGTGG + Intronic
1182693020 22:32176574-32176596 TCAGGCCAGGGCGGGGCCGCGGG + Intergenic
1182765811 22:32757582-32757604 GGAGCCCAGGCCGGGCACGGTGG - Intronic
1182979681 22:34657242-34657264 TCAGCCCAGGCTGGGGGTGGTGG - Intergenic
1183215570 22:36477493-36477515 AGGGCCCAGGCCGGGCGCGGTGG - Intronic
1183333903 22:37235898-37235920 TGAGGCCAGGCAGGGGGCTGAGG + Intronic
1183355329 22:37355710-37355732 TGAGTGCAGTCCGTGGCCGGGGG + Intergenic
1183403991 22:37620946-37620968 TGAGCCCAGGTGGGGGTCCGTGG + Intronic
1183607056 22:38872065-38872087 GCAGCCGGGGCCGGGGCCGGGGG - Intronic
1183665572 22:39244129-39244151 GGAGCCGGGGCCGGGGGCGGCGG - Exonic
1183690849 22:39387652-39387674 TGAACCGAGGCCGGGCACGGTGG + Intergenic
1183829403 22:40409844-40409866 AGAGCCCTGGCCGGGGCCGCGGG + Exonic
1184019980 22:41814276-41814298 TGAGGACAGGCCGGGCACGGTGG + Intronic
1184037915 22:41927205-41927227 AGAGGCCAGGCCGGGTGCGGTGG - Intergenic
1184047682 22:41981691-41981713 TGAGCCCAGGCCTAAGCCAGCGG + Exonic
1184219230 22:43088628-43088650 TGGGCCCCGGCCGGGCACGGTGG - Intronic
1184276400 22:43411754-43411776 CGAGCCCGGGCGGGGGCCGAGGG + Intronic
1184611270 22:45605290-45605312 TGAGATCAGGCCGGGCGCGGTGG - Intergenic
1184693888 22:46129410-46129432 TCAGCCCAGGCAAGGGCTGGCGG + Intergenic
1184724468 22:46335586-46335608 TGAGCGCAGGCCGGAGACAGGGG + Exonic
1184733263 22:46382561-46382583 TGGGTCCAGGCCGGGCGCGGTGG - Intronic
1184769089 22:46587582-46587604 GCAGCCCAGGCCGGGGCGGGGGG + Intronic
1185107310 22:48881339-48881361 AGGGCGCAGGCCGGGCCCGGTGG - Intergenic
1185388403 22:50546914-50546936 TGGGGAGAGGCCGGGGCCGGCGG + Intergenic
949303217 3:2608722-2608744 GGAGGCCAGGCCGAGGCTGGTGG - Intronic
949552242 3:5121086-5121108 TTAGCCCAGGCCGGGTGCAGTGG - Intergenic
950098414 3:10343313-10343335 GGAGCCCATGCCGGAGGCGGTGG - Intronic
950185980 3:10945788-10945810 TGAGCCCAGGACTGGGATGGAGG - Intergenic
950252706 3:11480216-11480238 TGATTCCAGGCCGGGTGCGGTGG - Intronic
950343354 3:12269054-12269076 TGAGCCAAAGCCGAGGCAGGTGG - Intergenic
950939929 3:16883356-16883378 TGGGCCCAGGCCTGGGGCGTGGG + Intronic
951333640 3:21394953-21394975 TGAGTCAAGGCCGGGCGCGGTGG - Intergenic
951665982 3:25124085-25124107 TGAGTCCAGGCCGGGCGCGGTGG + Intergenic
951824290 3:26850776-26850798 TGAGCCCAGGCAGAGCCCAGTGG - Intergenic
953901420 3:46846066-46846088 GGGGCCTGGGCCGGGGCCGGGGG - Intergenic
954233826 3:49239946-49239968 TGAGCCCAGGCTGGGCACAGTGG - Intronic
954290740 3:49648692-49648714 TGAGCCCAGGGCCTGGCCAGTGG + Intronic
954508633 3:51101405-51101427 TAAGCCGAGGCCGGGCGCGGTGG - Intronic
954581792 3:51706994-51707016 TGGGGGCGGGCCGGGGCCGGGGG + Intergenic
954590861 3:51780105-51780127 TGAGTCTAGGCCGGGCGCGGTGG - Intergenic
954713608 3:52516593-52516615 TGGGCCCAGCCTGGGGCGGGTGG + Intronic
955219743 3:57013283-57013305 GGATCCCATGCCAGGGCCGGGGG - Intronic
955325062 3:58003619-58003641 ATAGCACAGGCCGGGGGCGGTGG + Intergenic
955732352 3:62000007-62000029 TGTGCCCAGCCCGGGCCTGGGGG - Intronic
955915651 3:63905494-63905516 AGAGCCAAGGCCGGGTGCGGTGG - Intronic
956664009 3:71625027-71625049 TGAGCCCAGGACGGGGAGGCTGG + Intergenic
957044489 3:75363359-75363381 GGGGCCCTGGCCGAGGCCGGTGG - Intergenic
957193562 3:77039934-77039956 AGAGCCCAGCCCGGGCGCGGCGG - Intronic
958519496 3:95166422-95166444 TGACACCAGGCCGGGCGCGGTGG + Intergenic
960465951 3:117997013-117997035 TGCGCCCAGGCTGGGTCCTGAGG - Intergenic
960536650 3:118822788-118822810 TGATCCCAGGCTGGGCACGGTGG + Intergenic
961013475 3:123450037-123450059 GGAGCCCTGGCCGGGGGCGGGGG - Intergenic
961165611 3:124761549-124761571 TGTGCCCAGGCCAGGCGCGGTGG + Intergenic
961655242 3:128438292-128438314 TGGGCCCAGGGCTGGGCCAGAGG - Intergenic
961701304 3:128746814-128746836 TGAACCCCGGCCGGGCCGGGTGG - Intronic
961809702 3:129514766-129514788 AGGGCTGAGGCCGGGGCCGGGGG - Intronic
961876485 3:130027395-130027417 AGGGCCCTGGCCGAGGCCGGTGG - Intergenic
964337245 3:155668603-155668625 TGAGCCTAGGCTGGGTGCGGTGG + Intronic
964614499 3:158648389-158648411 TGAGCCTGGGCCGGGCGCGGTGG + Intronic
965958875 3:174405353-174405375 TGAGCCCAGGCCGGGCGTGGTGG + Intergenic
966417274 3:179702304-179702326 GGAGACCAGGCCGGGCGCGGTGG - Intronic
966489540 3:180512446-180512468 TGAGCTCAGGCAGTGGCAGGAGG - Intergenic
967217729 3:187224631-187224653 TCAGCACAGGCCGGGCGCGGTGG - Intronic
967946907 3:194811285-194811307 TGAGCCCAGGACGGGCCCCACGG + Intergenic
967982641 3:195074962-195074984 TGTTCCCAGGCCGGGAGCGGTGG + Intronic
968092621 3:195908556-195908578 TGAGGGCAGGCCGCGGCCGGCGG - Intronic
968226324 3:196974611-196974633 TGAGCCTTGGCCGGGCACGGTGG - Intergenic
968276812 3:197446531-197446553 AGAGCCCAGGAAGAGGCCGGGGG + Intergenic
968285008 3:197503366-197503388 AGAGTCCAGGCCGGGCGCGGTGG + Intergenic
968440576 4:621978-622000 AGAGCCCAGGCCGAGGGCCGCGG + Intergenic
968506459 4:973390-973412 TGAGCCCAGCACGGGGCTGCAGG + Exonic
968593401 4:1470925-1470947 TGGGCCCACGCCAGGGCCTGGGG - Intergenic
968622644 4:1610718-1610740 TGACCCCAGGCCAAGGCTGGAGG + Intergenic
968770837 4:2505610-2505632 TGACCCAAGGCCGGGCGCGGTGG - Intronic
968795337 4:2700024-2700046 AGAGCCCAGGCCAGGGCTAGGGG + Exonic
968861656 4:3176312-3176334 AGACCCCAGGCCGGGCGCGGTGG - Intronic
968965046 4:3765596-3765618 TGCGCCCATGCCTGCGCCGGGGG + Intergenic
968988753 4:3894600-3894622 GGGGCCCTGGCCGAGGCCGGTGG - Intergenic
969025343 4:4168190-4168212 GGGGCCCTGGCCGAGGCCGGTGG - Intergenic
969344743 4:6563681-6563703 TGAGCGCGGGCCCGGGGCGGGGG + Intergenic
969619077 4:8269915-8269937 GGAGACCGGGCGGGGGCCGGCGG - Exonic
969785553 4:9454455-9454477 GGGGCCCAGGCCGAGGCAGGTGG + Intergenic
969788967 4:9478861-9478883 GGGGCCCAGGCCGAGGCCGGGGG + Intergenic
969793707 4:9509628-9509650 GGGGCCCTGGCCGAGGCCGGTGG + Intergenic
969873178 4:10116987-10117009 GGAGGCGGGGCCGGGGCCGGCGG - Intergenic
971635144 4:29047804-29047826 GGAGCCCACGGCGGGGGCGGCGG - Intergenic
971823191 4:31586311-31586333 AAAGCCCAGGATGGGGCCGGGGG + Intergenic
972456547 4:39261277-39261299 AGAGACCAGGCCGGGCGCGGTGG - Intronic
973613698 4:52659363-52659385 GGAGCCTGGGCCGCGGCCGGCGG + Intergenic
974052466 4:56953634-56953656 TGAATCCAGGCCGGGCACGGTGG - Intergenic
974660367 4:64880709-64880731 TGGGGCCAGGCCGGGCGCGGTGG + Intergenic
975440597 4:74406165-74406187 TGAGTACAGGCCGGGCACGGTGG + Intergenic
975485799 4:74933290-74933312 GGTGCCCAGCCCGGGGCGGGCGG - Exonic
975498553 4:75059430-75059452 TGAGTCCAGGCTGGGCGCGGTGG - Intergenic
976595485 4:86891940-86891962 AGTGCCCGGGCCGGGGCGGGTGG - Intronic
977273726 4:94949601-94949623 TGAGTTCAGGCCGGGCGCGGTGG - Intronic
977579494 4:98709121-98709143 TTAGCCCTGGCCGGGGATGGCGG - Intergenic
977606894 4:98993567-98993589 GGAGCCCACGGTGGGGCCGGGGG + Intergenic
977687062 4:99859201-99859223 TGAGGCCAGGCCAGGCACGGAGG - Intronic
978072675 4:104491760-104491782 GGAGCCCGGGCCGAGCCCGGAGG - Exonic
979253084 4:118585594-118585616 AGAGCCCAGGCCAGGCGCGGTGG - Intergenic
981053269 4:140332662-140332684 TGACTCCAGGCCGGGCGCGGTGG - Intronic
981119712 4:141035863-141035885 TGGGGCCAGGCCTGGGGCGGGGG + Intronic
981180355 4:141735137-141735159 TGAGCCCAGGCCGGGCACGGTGG + Intergenic
981497568 4:145411238-145411260 TCACCTCAGGCCGGGGGCGGTGG + Intergenic
982088693 4:151861973-151861995 TGAGTCCCGGCGGGGGCAGGAGG + Intergenic
983959193 4:173732030-173732052 TGATCCCAGGCCTGGCACGGTGG + Intergenic
984644242 4:182202926-182202948 TGGGCTCAGGCCGGGTGCGGTGG + Intronic
984823909 4:183906978-183907000 TGCCCCCGGGCCGGGGCCGCGGG + Intronic
985026177 4:185741649-185741671 TGAGGACAGGCCGGGTGCGGTGG - Intronic
985527558 5:414963-414985 AGGGCCCAGGCGGGGGCCGTTGG + Intronic
985660792 5:1155747-1155769 GGGGTCCAGGCCGGGGTCGGGGG + Intergenic
985774249 5:1832537-1832559 TGAGCCCTGGGCGTGCCCGGGGG - Intergenic
985903830 5:2817749-2817771 TAAGGCCAGGCTGGGGCTGGTGG + Intergenic
985936386 5:3101148-3101170 AGAGCCGAGGCTGGGGCCTGGGG - Intergenic
986354224 5:6908065-6908087 TGAGCCCAGGGCTTGGCAGGTGG - Intergenic
986912510 5:12574597-12574619 GGAGCCCACGGCGGGGGCGGGGG + Intergenic
987771849 5:22315247-22315269 ACAGCCCAGGCCGGGCGCGGTGG - Intronic
988530761 5:32025236-32025258 TGAGCCCTGGCCGGGTGCGGTGG + Intronic
988536334 5:32072441-32072463 GGAGACCAGGCCGGGCGCGGTGG + Intronic
988583178 5:32486080-32486102 TAAGCCCTGGCCGGGTGCGGTGG - Intergenic
989178885 5:38556725-38556747 TGGGGCGGGGCCGGGGCCGGGGG - Intronic
991600981 5:68351065-68351087 TGAGCCCAGGCCGGGCGTGGTGG - Intergenic
991926719 5:71712734-71712756 TGAGTTCAGGCCAGGGGCGGTGG - Intergenic
992048942 5:72925905-72925927 GGATCCCACGCCGGGGCCGTGGG - Intergenic
992111583 5:73498851-73498873 CGAGGCCAGGCCAGGGCCAGGGG + Intronic
994229599 5:97298220-97298242 TTAGACCAGCCCTGGGCCGGAGG - Intergenic
994260599 5:97654166-97654188 AGAGCCCAGGCCGGGCGCGGTGG - Intergenic
994477643 5:100290888-100290910 TGAGTCCCGGCCGGGCGCGGTGG - Intergenic
995913547 5:117216090-117216112 TCAGTCCAGGCCGGGCCTGGTGG + Intergenic
996299819 5:121967753-121967775 TGAGCCCGGGAGGGGGACGGAGG + Intronic
997961634 5:138326626-138326648 TTAGCCCCGGCCGGGTGCGGTGG - Intronic
997995905 5:138586307-138586329 TGATCCCAGGCTGGGTGCGGTGG + Intergenic
998406680 5:141878269-141878291 GCAGCCCAGGCCGGGGCCGGCGG - Exonic
999008758 5:148011380-148011402 TATGCCCAGGCCGGGCACGGTGG - Intergenic
999132449 5:149294817-149294839 GGAGGCCAGGCTGGGGCTGGGGG - Intronic
999242142 5:150133852-150133874 TGGGGCCAGGCAGGGGTCGGAGG - Intronic
999821674 5:155234909-155234931 TGATCCCAGGCTGGGCACGGTGG + Intergenic
1001365504 5:171134674-171134696 TAAGCCCAGGTCGAGGCAGGTGG + Intronic
1001643277 5:173260743-173260765 TTAGCCCAGGCTGGGTGCGGTGG - Intergenic
1002507148 5:179687388-179687410 AGAGCACAGGCCGGGCGCGGTGG - Intronic
1002927856 6:1615070-1615092 TGCGGCCAGGCCGAGGCGGGTGG - Intergenic
1003039025 6:2670076-2670098 TAAGACCAGGCCAGGCCCGGTGG + Intronic
1003218422 6:4135760-4135782 AGAGCCCAGGCAGGAGCCTGGGG + Intergenic
1003545065 6:7052037-7052059 GGAGTCCCGGCCGGGGCCGCAGG - Intergenic
1003864568 6:10351274-10351296 TAATCCCAGGCCGAGGCGGGAGG + Intergenic
1004230945 6:13832568-13832590 TGAGCCTAGGCCGGGCGCGGTGG - Intergenic
1004274976 6:14228261-14228283 TGAACCCAGGCCGGGCACAGTGG + Intergenic
1005098142 6:22141063-22141085 TGAGCTAAGGCCGGGCGCGGTGG - Intergenic
1005531242 6:26708869-26708891 TAAGCCCAGGCCGGGCGCAGTGG + Intergenic
1005539554 6:26792767-26792789 TAAGCCCAGGCCGGGCGCAGTGG - Intergenic
1005620359 6:27614393-27614415 GGAGCCTAGGCCGGGCGCGGTGG + Intergenic
1005736461 6:28752393-28752415 TGAGCACTGGCCGGGCCTGGTGG + Intergenic
1006499517 6:34448963-34448985 TCAGGCCAGGCCGGGCGCGGTGG - Intergenic
1006573109 6:35021696-35021718 AGAGCTCAGGCCGGGTGCGGTGG + Intronic
1006649272 6:35537453-35537475 GGAGCCCTGGCCGGGAGCGGTGG - Intergenic
1006764736 6:36494872-36494894 AGAGCCCAGGCCTAGGCAGGAGG - Exonic
1006793063 6:36716180-36716202 GGAGCCCTGGCCGGGCACGGTGG + Intronic
1006947743 6:37796675-37796697 TGACCCTAGGCCGGGTACGGTGG + Intergenic
1007161153 6:39792639-39792661 GGAGCCCACTCCGGGGTCGGCGG - Intronic
1007581171 6:42960975-42960997 TGAGCCCAGGCCGGGGCCGGGGG + Intronic
1007633019 6:43283301-43283323 GGTGCCCAGGTCGGGGTCGGGGG - Exonic
1008990815 6:57599231-57599253 AGAGCTCAGGCCGGGCGCGGTGG - Intronic
1009010378 6:57834940-57834962 TAAGCCCAGGCCGGGCGCAGTGG - Intergenic
1009968194 6:70599662-70599684 TAATCCCAGGCCGGGTGCGGTGG + Intergenic
1010526956 6:76912626-76912648 TGAGACCAGGCCTGGCACGGTGG - Intergenic
1010686617 6:78860812-78860834 TGAGCCAAGGCCGGGCACGGTGG + Intergenic
1013365041 6:109430710-109430732 TGAACACAGGCCGGGCGCGGTGG - Intronic
1014436438 6:121426011-121426033 TGAGAACAGGCCGGGCGCGGTGG + Intergenic
1014551636 6:122795428-122795450 TGAGCTCAGGCCGGGCGCGGTGG - Intronic
1015019097 6:128450026-128450048 TGAACCCAGGTTGGGGGCGGGGG + Intronic
1015314653 6:131805096-131805118 TGAGCCAAGGCCGGGCACGGTGG - Intergenic
1015750112 6:136550502-136550524 TGAGCGCAGTCCGGGGATGGCGG + Intronic
1015859068 6:137656548-137656570 TAAAACAAGGCCGGGGCCGGGGG - Intergenic
1016399589 6:143665084-143665106 TGAACCCAGGCTGGGTGCGGTGG - Intronic
1016803306 6:148188476-148188498 AGAGCACAGGCAGGGGCCTGGGG - Intergenic
1016871372 6:148820561-148820583 TTATCCCAGGCCGGGCACGGTGG + Intronic
1017409506 6:154153394-154153416 AGAGCCCCGGCCAGGACCGGTGG + Intronic
1017482434 6:154871079-154871101 TGAGCACAGGCCGGGTGTGGTGG - Intronic
1017992915 6:159506030-159506052 TGGGCCCAGCCCTGGGCCTGGGG + Intergenic
1018825058 6:167402483-167402505 TGAGCCCAGCCTGGGGTCTGGGG + Intergenic
1019104713 6:169658972-169658994 TGAGCTCTGGCCGGGCGCGGTGG - Intronic
1019234449 6:170598017-170598039 TGAGACCTGGCCGGGCACGGTGG - Intergenic
1019308240 7:346591-346613 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019308260 7:346659-346681 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019308279 7:346726-346748 TGAGCCCCGGGCGGCGGCGGTGG - Intergenic
1019470316 7:1216379-1216401 TGAGCTCAGGCCGGGCGCGGTGG - Intergenic
1019531895 7:1507492-1507514 TGATGCCAGGCCGGGCGCGGTGG - Intergenic
1019542672 7:1558622-1558644 TCAGCCCAGGGAGGGGCCCGAGG - Intronic
1019611539 7:1939277-1939299 TGGGCCAGGGCCGGGGCCAGCGG + Intronic
1019768888 7:2871020-2871042 TGACCAAATGCCGGGGCCGGTGG + Intergenic
1020004130 7:4772832-4772854 TCAGCCCAGGCTGGGCGCGGTGG + Intronic
1020070539 7:5224074-5224096 TGAACCAAGGCAGGGGCCTGGGG - Intronic
1020087878 7:5321208-5321230 TGAGGCGAGGCTGGAGCCGGGGG + Intronic
1020123101 7:5516653-5516675 TGAGCCCTGGCCGGGTGCGGTGG - Intergenic
1020137178 7:5593973-5593995 TGATCCCAGCCCGGGGTGGGAGG - Intronic
1020174119 7:5868773-5868795 TGAGTCCAGGCCGAGCACGGTGG + Intergenic
1020262345 7:6537254-6537276 TGAGAGCAGGCCGGGCACGGTGG + Intronic
1020307120 7:6843871-6843893 GGGGCCCTGGCCGAGGCCGGTGG - Intergenic
1020803650 7:12761787-12761809 TGAGAACAGGCCGGGTGCGGTGG - Intergenic
1021188796 7:17596559-17596581 TGAGCCAAGGCCGGGCACGGTGG + Intergenic
1022297309 7:29068300-29068322 TGAATACAGGCCGGGGGCGGTGG - Intronic
1023681684 7:42693941-42693963 CGAACCCAGGCTGGGGCCTGAGG - Intergenic
1023902177 7:44490356-44490378 TCAGGGCAGGCCGGGGGCGGCGG + Intronic
1025094511 7:56087062-56087084 GGAGCCCAGGCAGGGGCAGCCGG + Intronic
1025732420 7:64118387-64118409 TGAGAACAGGCCGGGCACGGTGG - Intronic
1025845187 7:65189813-65189835 TGAGCCTAGGCCGGGCACAGTGG - Intergenic
1025895464 7:65695843-65695865 TGAGCCTAGGCCGGGCACAGTGG - Intergenic
1026415060 7:70170891-70170913 TGTGCCCCGGCCGGGGGCGGTGG - Intronic
1026430261 7:70339148-70339170 TGAGGCCAGGCCGGGCGCGGTGG - Intronic
1026588579 7:71677800-71677822 TGAGCCTTGGCCGGGCACGGTGG - Intronic
1026629712 7:72027768-72027790 TGAGACCTGGCCGGGCGCGGTGG + Intronic
1026837480 7:73648170-73648192 CGAGCCCAGCCCGCGGCTGGGGG - Intergenic
1026846951 7:73703900-73703922 GGAGCCCGGGCCTGGGACGGAGG - Intronic
1026851289 7:73725105-73725127 TGAGGCCAGGCCGGGCACAGTGG + Intergenic
1027130446 7:75586679-75586701 TGAGCCCAGGGAGGGGCTGAAGG + Intronic
1027684333 7:81264080-81264102 TGAGCCCAAGCCGAGGTCTGAGG + Intergenic
1028567164 7:92246090-92246112 TGAGCCGGAGCCGGAGCCGGAGG + Exonic
1028869833 7:95757254-95757276 TGAGCAGAGGCCGGGCGCGGTGG - Intergenic
1029023591 7:97390822-97390844 TGATCCCAGGCTGGGCACGGTGG - Intergenic
1029080697 7:97971998-97972020 TGAGCCCGGGCCGGGGGCTGCGG - Intergenic
1029092198 7:98057102-98057124 TGAGGCCAGGCCGGGCACTGTGG + Intergenic
1029202280 7:98847142-98847164 TGAGTCAAGGCCGGGCGCGGTGG - Exonic
1029250247 7:99231190-99231212 TAATCCCAGGCCGAGGCGGGCGG - Intergenic
1029269979 7:99371489-99371511 TGAGTCCAGGCCGGGTATGGTGG - Intronic
1029280987 7:99435349-99435371 TGGGCCCAGGCCAGGCGCGGTGG + Intronic
1029604929 7:101592809-101592831 TTAGCCAAGGCCGGGCACGGTGG + Intergenic
1029645781 7:101855020-101855042 TGAGTCCAGGCCGGGCGAGGTGG - Intronic
1029654174 7:101913506-101913528 TCAGCCCAGGGAGGGGCAGGTGG + Intronic
1030049108 7:105522304-105522326 TGGGCCGGGGGCGGGGCCGGCGG - Intergenic
1030271745 7:107675857-107675879 TGCTCCCAGGCCGGGCGCGGTGG - Intronic
1030696500 7:112590724-112590746 TGACTCCAGGCCGGGCTCGGTGG + Intergenic
1031585945 7:123532823-123532845 CGAGCCCCGTCCCGGGCCGGGGG + Exonic
1032037571 7:128531489-128531511 AGGGCCCAGGCCGGGCCAGGAGG - Intergenic
1032117387 7:129128131-129128153 TGAGTCCAGGCCAGGCACGGTGG + Intergenic
1032130722 7:129225255-129225277 CGAGCCCGGGCCGGGGACCGGGG - Exonic
1032368688 7:131325450-131325472 GGAGGCCAGGCCGAGGCAGGAGG + Intronic
1033337750 7:140467713-140467735 AGAGCCCAGGCAGGGGGCTGTGG + Intronic
1033461077 7:141548108-141548130 TGAGCCCAGACCAGGCACGGTGG + Intergenic
1033794463 7:144831394-144831416 TGAGGCCAGGCCGGGCGCAGTGG + Intronic
1034675645 7:152891041-152891063 TAAGCCCAGGCTGGGCCAGGTGG - Intergenic
1034947152 7:155269853-155269875 GGAGCCCAGCCAGGGGCCTGGGG + Intergenic
1035130863 7:156651909-156651931 GGAGCCCGGGGAGGGGCCGGGGG - Intronic
1035168478 7:157005369-157005391 CTCGCCCAGGCCGGGGCTGGAGG - Exonic
1035262047 7:157668122-157668144 TGTGCCCAGGCCGGGGCCCTGGG + Intronic
1035283583 7:157792691-157792713 TCTGCCCAGGCTGGGGCCGGGGG + Intronic
1035335902 7:158126767-158126789 TGAGCCGAGGAAGGGGCTGGGGG + Intronic
1035361855 7:158318551-158318573 TAATCCTAGGCCAGGGCCGGCGG + Intronic
1035564455 8:631854-631876 TGAGCAAAGGCCTGGGGCGGGGG - Intronic
1035569055 8:660121-660143 TGACCCCGGGCAGGGGCCAGGGG - Intronic
1035821585 8:2598674-2598696 TCTGCCCAGGCCGGGCACGGTGG + Intergenic
1035866076 8:3083737-3083759 TGAGCCCAGGCAGGAGGCAGAGG - Intronic
1036903595 8:12689875-12689897 GGGGCCCTGGCCGAGGCCGGTGG - Intergenic
1037653250 8:20859957-20859979 TGATCACAGGCCGGGCGCGGTGG - Intergenic
1037859044 8:22391853-22391875 GGAGCCCTGGCCGGGAGCGGTGG - Intronic
1038566332 8:28622692-28622714 TGAGCCGAGGGCGGGGCCTCAGG + Intronic
1038799036 8:30732737-30732759 GGGGCCCTGGCCGAGGCCGGTGG + Intronic
1038808002 8:30812488-30812510 GGCGCCCGGGCCGGGGCCGGGGG - Exonic
1039045685 8:33447159-33447181 TGATTCCAGGCCGGGCGCGGTGG + Intronic
1039310884 8:36316865-36316887 TGAGCCAAGGCCGGGCGCGGTGG + Intergenic
1039514407 8:38119829-38119851 TAACCCCAGGCCGGGCACGGTGG + Intronic
1039703372 8:39983574-39983596 TGTGCCCCGGCCGGGCCCGGTGG + Intronic
1039721864 8:40173284-40173306 TGAGACCAGGCCGGGCACGGTGG + Intergenic
1040012877 8:42676896-42676918 TGATACCAGGCAGGGGTCGGTGG - Intergenic
1041068567 8:54104473-54104495 GGAGCCCACGGCGGGGGCGGGGG - Intergenic
1041107654 8:54458295-54458317 GGAGCACCGGCCGGGGCCGCGGG + Exonic
1041739073 8:61139546-61139568 CGAGCGGAGGCCGGGGGCGGGGG + Intronic
1042007261 8:64194760-64194782 TGAGTCTAGGCCGGGCGCGGTGG - Intergenic
1042141301 8:65681197-65681219 TGAACCCAGGCCGGGCGCGGTGG - Intronic
1042611747 8:70608017-70608039 GGAGCCCGGGCCCGGGCTGGAGG + Intronic
1044667136 8:94642104-94642126 TGGGCCCAGGCTGGGGTGGGTGG - Intronic
1044837478 8:96310447-96310469 AGAGCCAAGGCCGGGTGCGGTGG - Intronic
1044989166 8:97780135-97780157 AGAGTCCAGGCCGGGTACGGTGG + Intronic
1045304991 8:100951245-100951267 GGAGCCCAGGCCTGGCGCGGCGG - Intronic
1045432051 8:102123815-102123837 GGGGCCGGGGCCGGGGCCGGGGG - Intronic
1045457585 8:102396991-102397013 TGAGACCAGGCCGGGCGTGGTGG - Intronic
1045478714 8:102575755-102575777 TAATCCCAGGCCGGGTACGGGGG + Intergenic
1045867299 8:106882503-106882525 GGAGACCAGGCCGGGTGCGGTGG - Intergenic
1046840109 8:118846914-118846936 TGAACACAGGCCGGGCGCGGTGG + Intergenic
1047124788 8:121948357-121948379 GGAGCCCATGGCGGGGGCGGGGG - Intergenic
1047277483 8:123416816-123416838 TGGGCCAGGGCCCGGGCCGGAGG - Exonic
1047938808 8:129807746-129807768 TGAGCCAAGGCTGGAGCTGGAGG - Intergenic
1048975683 8:139671915-139671937 TGAGGACAGGTGGGGGCCGGTGG - Intronic
1049032482 8:140047958-140047980 TGAGCTCTGGCTGGGGCCTGTGG - Intronic
1049184776 8:141244279-141244301 CCAGCCCATGCCTGGGCCGGAGG + Intronic
1049194678 8:141308604-141308626 GGGGCCGGGGCCGGGGCCGGGGG - Intergenic
1049217659 8:141415424-141415446 AGAGCCCAGGCCAGCGCTGGAGG + Intronic
1049264476 8:141660107-141660129 TGATCACAGGCCGGAGCCGGAGG - Intergenic
1049536795 8:143186229-143186251 CGAGCCCTGGCGCGGGCCGGAGG - Intergenic
1049640755 8:143714362-143714384 AGTGCCCAGGCCGGGGTGGGTGG + Intergenic
1049791859 8:144475842-144475864 TGAGGCCGGGCTGGGGCAGGCGG + Exonic
1050565049 9:6873238-6873260 TAATCCCAGGCCGAGGCGGGTGG - Intronic
1052045004 9:23783905-23783927 TGGGCACAGGCCGGGCGCGGTGG + Intronic
1052608243 9:30733074-30733096 TGAGACCTGGCCGGGTGCGGTGG - Intergenic
1053118234 9:35524682-35524704 TGATCCCAGGCCGGGTGCAGTGG + Intronic
1053434567 9:38066859-38066881 TTTGCCCAGGCCTGGGCTGGGGG - Intronic
1056170671 9:83981084-83981106 TCAGTCAAGGCCGGGCCCGGGGG + Intronic
1056825014 9:89870989-89871011 TCAGCCCTGGCCGGGCGCGGTGG - Intergenic
1057353619 9:94318912-94318934 GGTCCCCAGGCCGGGGCAGGTGG + Exonic
1057442512 9:95092302-95092324 TGGGCCCAGGCGGGGGTGGGAGG - Intergenic
1057501618 9:95601100-95601122 TGAGCCCAGGGCCCGGCCTGCGG - Intergenic
1057654132 9:96938680-96938702 GGTCCCCAGGCCGGGGCAGGTGG - Exonic
1057747626 9:97764404-97764426 TGAGCACGGGCCGGGGGCGGGGG - Intergenic
1058858310 9:109088574-109088596 TAATCCCAGGCCGAGGCGGGCGG + Intronic
1058992073 9:110263906-110263928 TTAGCCAAGGCCGGGCGCGGTGG + Intergenic
1060283482 9:122228860-122228882 TGAGGCCGGGCCCGGGGCGGCGG - Intronic
1060283491 9:122228884-122228906 TGCGCGCGGGCCGGGGGCGGGGG - Intronic
1060780449 9:126408456-126408478 TGGGCCCAGGCAGGGGGCTGGGG + Intronic
1060827155 9:126693847-126693869 TGAGCTGGGGCCGGGGCCAGGGG + Intronic
1060921184 9:127421704-127421726 TGAGCCAAGGCCGGGTGTGGTGG - Intergenic
1061221226 9:129253383-129253405 CGAGCCCAGGGCGGGGCCGCAGG - Intergenic
1061257445 9:129460787-129460809 AGAACCCAGGCAGCGGCCGGGGG - Intergenic
1061494463 9:130963769-130963791 TGGGCCTAGGCCGGGCACGGTGG + Intergenic
1061660641 9:132127969-132127991 TGAGCCGAGGCCGGGTGGGGCGG + Intergenic
1061717803 9:132531776-132531798 AGAACCCAGGCTGGGGCCGTTGG + Intronic
1061778400 9:132981691-132981713 TGAGCCCAGGTCAGGCCCAGGGG - Intronic
1061778894 9:132984394-132984416 TGAACACAGGCTCGGGCCGGGGG - Intronic
1061967699 9:134025465-134025487 GGCTCCCAGGGCGGGGCCGGCGG - Intergenic
1061989926 9:134153316-134153338 TGAGCCCAGGGTGGGGACGGAGG + Intronic
1062102076 9:134733628-134733650 TGAGCCCAGGCCTGGCTCTGAGG - Intronic
1062137634 9:134938136-134938158 AGACCCCAGGCTGGGGTCGGTGG + Intergenic
1062160256 9:135075900-135075922 GGCGCCCAGGCCGGGGGCGCGGG - Intronic
1062224255 9:135440456-135440478 GGGGCCCTGGCCGAGGCCGGTGG - Intergenic
1062275564 9:135728729-135728751 TGAGCACATGCCGGGGCCGCTGG - Intronic
1062305842 9:135906944-135906966 GGGGCGCGGGCCGGGGCCGGGGG - Intronic
1062347676 9:136122908-136122930 TGTGGCCAGGCCGGGGGCGCAGG - Intergenic
1062479080 9:136743158-136743180 TGACCCCAGGCCGGGCACTGAGG - Intronic
1062479965 9:136746604-136746626 TGAGGCCAGGCCTGGCCCGGGGG + Intronic
1062481637 9:136755102-136755124 TCAGCACAGGCCAGGGTCGGGGG + Intronic
1062584269 9:137241869-137241891 TCAGCCAAGGCAGGGGCCGCGGG - Intronic
1062592492 9:137280580-137280602 TAAGCCCAAGCCAGGGCTGGCGG - Exonic
1062622961 9:137430858-137430880 TGAGGCCAGGCAGGGGTCTGAGG - Intronic
1185566582 X:1099659-1099681 TGAACCCAGGCCAGGGCCACAGG - Intergenic
1185604364 X:1359342-1359364 AGATCCCAGGCAGGGGCTGGGGG - Intronic
1185636204 X:1553958-1553980 GGACCCCAGGCCGGGTGCGGTGG + Intergenic
1186670629 X:11764227-11764249 AGAGCACAGGCCGGGGAGGGTGG + Intronic
1187566155 X:20451574-20451596 TGAAACCAGGCCGGGTGCGGTGG - Intergenic
1187870511 X:23761108-23761130 TGAGGCCAGGCCGGGTGTGGTGG - Intronic
1189294473 X:39908986-39909008 TGATCCCAGGGCGGGGGTGGGGG - Intergenic
1189308778 X:40006059-40006081 TGCGCCCTGGCCGGGGCCTGGGG - Intergenic
1189310500 X:40014360-40014382 TTCGCCCCGGCCGAGGCCGGGGG - Intergenic
1189512449 X:41676565-41676587 AGAGCCCAGGCCCGGCCCAGCGG - Intronic
1190042042 X:47079245-47079267 TGGGCTCAGGCCGGTGCTGGTGG - Intronic
1190106571 X:47565141-47565163 TGAGCCCAGCCTGGGGTGGGTGG + Intronic
1190191453 X:48280490-48280512 AGACCCAAGGCCGAGGCCGGAGG - Intergenic
1190268331 X:48843178-48843200 TGAGCCAAGGCCAGGTGCGGTGG + Intergenic
1190492686 X:50998985-50999007 TAAGGCCAGGCCGGGCGCGGTGG + Intergenic
1190692350 X:52921856-52921878 TGAGACCAGGCCGGGCCCGGTGG - Intergenic
1190737840 X:53267266-53267288 TGAGCCCAGGCTGGGTGTGGGGG - Intronic
1190881629 X:54495934-54495956 GCAGCCGAGGCCGGGGGCGGAGG + Exonic
1191797146 X:65033799-65033821 TTAGCTCAGGCCGGGCACGGTGG + Intronic
1191818158 X:65271925-65271947 AGAGCCTAGGCCGGGTGCGGTGG + Intergenic
1192195680 X:69026339-69026361 TGAGCCTTGGCCTGGGCTGGGGG + Intergenic
1192272346 X:69593799-69593821 AGAGCCCAGGCCGGGCACGGTGG + Intergenic
1194784228 X:98062533-98062555 TGGGCCCTGGCCGGGTGCGGTGG + Intergenic
1194974902 X:100384869-100384891 TACTCCCAGGCCGGGCCCGGTGG + Intronic
1195160100 X:102162531-102162553 TGAGCCAAGGCTGGAGCCAGAGG + Intergenic
1195210773 X:102651284-102651306 CGAGCCCCAGCCGGGGCCTGCGG - Intergenic
1195927230 X:110038276-110038298 TGAGTCCAGGCCGGGCGCGGTGG - Intronic
1196645281 X:118111468-118111490 TGGGCCTAGGCCGGGGGAGGTGG + Intronic
1196746166 X:119073289-119073311 GGAGCGCAGGCCGAGGCCGTAGG + Intergenic
1196791518 X:119468819-119468841 TGAGTCTAGGAAGGGGCCGGGGG + Intronic
1197210302 X:123822680-123822702 TGAGCCCTGGCTGGGTGCGGTGG - Intergenic
1197213006 X:123843548-123843570 TGAGGCCAGGCCGGGTGTGGTGG - Intergenic
1197268707 X:124403231-124403253 TGAGCACTGGCCGGGCACGGTGG + Intronic
1198682191 X:139194855-139194877 GGAGCCCTGGCCCGGGCCCGCGG + Intronic
1199774606 X:150999997-151000019 TGAGTCCAGGCCGGGCATGGTGG + Intergenic
1200001909 X:153066517-153066539 TCAGAGCAGGCCGCGGCCGGTGG + Intergenic
1200005823 X:153083508-153083530 TCAGAGCAGGCCGCGGCCGGTGG - Intergenic
1200100696 X:153688106-153688128 CGGGCCCCGGCCGGGGCGGGGGG + Exonic
1200165421 X:154032108-154032130 TGTGCCCAGGGTGGGGTCGGGGG - Intronic
1200206244 X:154318410-154318432 CGAGACCAGGCCGGGTGCGGTGG + Intronic
1200247589 X:154534314-154534336 TGGGGCCAAGCCTGGGCCGGGGG - Intronic
1201797481 Y:17913864-17913886 TGAGACCTGGCCGGGCGCGGTGG + Intergenic
1201804072 Y:17992095-17992117 TGAGACCTGGCCGGGCGCGGTGG - Intergenic