ID: 1007581176

View in Genome Browser
Species Human (GRCh38)
Location 6:42960991-42961013
Sequence CCGGGGGCGTTGCATGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581159_1007581176 27 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG 0: 1
1: 0
2: 0
3: 5
4: 32
1007581163_1007581176 7 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG 0: 1
1: 0
2: 0
3: 5
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581176 Original CRISPR CCGGGGGCGTTGCATGAGAT CGG Intronic
907403219 1:54238477-54238499 CAGGGGGCGTTGCCCGAGGTCGG - Intronic
917247587 1:173021450-173021472 CAGGAGGAGTTGCATGAGATGGG - Intergenic
918008153 1:180561406-180561428 CAGGTGGTGTTGCAGGAGATGGG + Intergenic
1070961511 10:80503097-80503119 CTGGGGGCCTTGAATAAGATGGG + Intronic
1072981398 10:100100860-100100882 CCGAGGCCGTGGCAGGAGATGGG - Intergenic
1074877577 10:117626101-117626123 CAGGGGGTGCTGCAGGAGATGGG + Intergenic
1099365067 12:81758578-81758600 CCGGTGGCGTGGCAGGAGCTCGG + Intronic
1103906972 12:124332809-124332831 CCGGGGGCGATGGGTGAGGTGGG - Intronic
1105830586 13:24160632-24160654 CCGGGGGCGTGGCCTGATATGGG + Intronic
1107058398 13:36130909-36130931 CCGGGGGCGTTGCGTGCGGGCGG - Intronic
1114417121 14:22552385-22552407 CCCGTGGCGTGGCATGAGAGTGG - Intergenic
1116282422 14:42926456-42926478 CAGGTGTCATTGCATGAGATGGG + Intergenic
1118900238 14:69980216-69980238 CCAGGGGCGATGCAGGAAATGGG + Intronic
1122792250 14:104188977-104188999 CCGGAGGAGTTCCCTGAGATGGG + Intergenic
1122851809 14:104537483-104537505 CCTGGGGCCCTGCATGAGAAGGG + Intronic
1132915742 16:2342125-2342147 CCCGGGGCGTTGCATTAGGTCGG - Intergenic
1139619261 16:68123889-68123911 GCGGGAGCATTGCCTGAGATGGG + Intronic
1142526850 17:548762-548784 CCTGGGATGTTGAATGAGATTGG + Intronic
1145754815 17:27382649-27382671 CCAGGGGCTTCGCATGTGATTGG + Intergenic
1152630962 17:81410528-81410550 CCTGGGGCGTTGGATGTGACTGG + Intronic
1154177427 18:12094392-12094414 TGGGGGGCGTTGGATGTGATGGG + Intronic
1154177482 18:12094538-12094560 TGGGGGGCGTTGGATGTGATGGG + Intronic
1163848400 19:19650221-19650243 TAGGGGGCCTTGCATGAGGTGGG - Intronic
1167052839 19:47090150-47090172 GCAGGGGCGTGGCATGCGATGGG + Exonic
936154071 2:110036999-110037021 CCTGGGACATTGCATGACATTGG - Intergenic
936190613 2:110334416-110334438 CCTGGGACATTGCATGACATTGG + Intergenic
937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG + Intergenic
946627447 2:221628972-221628994 CTGGGGGTGTTACATGAGACCGG + Intergenic
998457366 5:142283686-142283708 CCGGGGCTGTTGGATGACATGGG + Intergenic
1006065976 6:31462969-31462991 CCGAGGGCGGTGCCTGGGATGGG + Intergenic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1029371813 7:100155230-100155252 CAGGGGGCGTGGCATGGGACCGG - Intronic
1033713934 7:143980264-143980286 CTGGGCCCCTTGCATGAGATAGG + Intergenic
1035404281 7:158587884-158587906 CCGGGGGCGTGGCCTGAGGGCGG - Intergenic
1048992552 8:139769945-139769967 CCTGGGGAGTTGCAGGAGCTAGG - Intronic
1062385699 9:136310695-136310717 CCGAGGGCGTTGCAGGGGCTGGG - Intergenic
1200124686 X:153807713-153807735 CTGGGGGCGTTGCATGAGTGGGG - Intronic
1200165515 X:154032638-154032660 CCTGGGGCCTTGCATGTGGTGGG - Intronic