ID: 1007581178

View in Genome Browser
Species Human (GRCh38)
Location 6:42960993-42961015
Sequence GGGGGCGTTGCATGAGATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007581163_1007581178 9 Left 1007581163 6:42960961-42960983 CCTGTGGCACTGGGTGAGCCCAG 0: 1
1: 1
2: 0
3: 33
4: 292
Right 1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1007581173_1007581178 -10 Left 1007581173 6:42960980-42961002 CCAGGCCGGGGCCGGGGGCGTTG 0: 1
1: 0
2: 5
3: 61
4: 461
Right 1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1007581172_1007581178 -9 Left 1007581172 6:42960979-42961001 CCCAGGCCGGGGCCGGGGGCGTT 0: 1
1: 0
2: 2
3: 34
4: 351
Right 1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 64
1007581159_1007581178 29 Left 1007581159 6:42960941-42960963 CCAGCGGGTGCTCGACGTAGCCT 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG 0: 1
1: 0
2: 0
3: 7
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007581178 Original CRISPR GGGGGCGTTGCATGAGATCG GGG Intronic
907403217 1:54238475-54238497 GGGGGCGTTGCCCGAGGTCGGGG - Intronic
908523306 1:64965768-64965790 GGGGGCGTTTCCCGAGTTCGCGG + Intronic
913355997 1:117922878-117922900 GGGGGCGTTGCAGGAGACTAGGG + Intronic
922967911 1:229707307-229707329 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG + Intergenic
1068071757 10:52205069-52205091 GGGGGCGCTGCAGGAGATTAGGG - Intronic
1069643013 10:69968454-69968476 GGGGGCGATGCAAGAGAAAGGGG - Intergenic
1076445406 10:130510582-130510604 GGGGGCGTTGTCTGGGAACGGGG - Intergenic
1077441054 11:2569450-2569472 GGGGGCGTGGCATGGGAGCAAGG + Intronic
1096035819 12:48469222-48469244 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1096330199 12:50705102-50705124 AGGGGCTTTGCATGACATCATGG + Intronic
1096752295 12:53768545-53768567 GGGGGCGTTGCATGAAAATTTGG - Intergenic
1098839142 12:75458115-75458137 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1105900989 13:24752950-24752972 GGGGGAGTAGCATGAGATGATGG - Intergenic
1110456962 13:75699868-75699890 GGGGGCGCTGCAGGAGACCAGGG + Intronic
1114759539 14:25297835-25297857 GAGGGCATTGCAAGAGATCCTGG - Intergenic
1115458906 14:33636665-33636687 GGGGGCCTTGCATCAAATCTTGG - Intronic
1117960113 14:61154159-61154181 GGGGGCGTTGAGTGAGTTTGGGG + Intergenic
1118872595 14:69755665-69755687 GGGGGCATCTCATGAGATCTGGG + Intronic
1122368928 14:101216887-101216909 GGGGGTGTTGCAAGAGTTCATGG - Intergenic
1132915739 16:2342123-2342145 CGGGGCGTTGCATTAGGTCGGGG - Intergenic
1133676847 16:8081380-8081402 GGGGGCTTCGCATGGGATTGTGG - Intergenic
1139664750 16:68447914-68447936 GGTGGTGATGGATGAGATCGCGG - Intronic
1141742377 16:85902425-85902447 GCGGGACTTGAATGAGATCGCGG + Intronic
1144300934 17:13922627-13922649 TGGGGCCTTGCCTGAGATCCCGG + Intergenic
1147948664 17:44094885-44094907 GGGAGGGTTGCTTGAGGTCGAGG - Intronic
1151712508 17:75814822-75814844 GGGGTAGTTGCCTGAGATTGTGG + Intronic
1152070591 17:78132008-78132030 GGGGGCGCTCTACGAGATCGGGG + Exonic
1154177429 18:12094394-12094416 GGGGGCGTTGGATGTGATGGGGG + Intronic
1154177484 18:12094540-12094562 GGGGGCGTTGGATGTGATGGGGG + Intronic
1154216593 18:12420625-12420647 GGGGGCCTTTCCTGAGATCAGGG + Intronic
1163848398 19:19650219-19650241 GGGGGCCTTGCATGAGGTGGGGG - Intronic
1164314597 19:24075774-24075796 GGGGGCGCTGCAGGAGACCAGGG + Intronic
1167052841 19:47090152-47090174 AGGGGCGTGGCATGCGATGGGGG + Exonic
932416637 2:71577507-71577529 GGGGGGGCTGCATGAGAGTGGGG - Intronic
935888359 2:107648846-107648868 GGGGGCCTTCCATGGGCTCGAGG - Intergenic
938858562 2:135341806-135341828 GGGGGCGCTGCAGGAGACCAGGG - Intronic
939146899 2:138426289-138426311 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
945357208 2:208854908-208854930 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
946374172 2:219298168-219298190 GGGGGTGTGGCATGGGACCGGGG - Intronic
1172188299 20:33045532-33045554 GGGGGCGCTGCAGGAGACCAGGG - Intergenic
1181728529 22:24828017-24828039 GGGGGCCTTTCAGGAGATAGGGG - Intronic
1184683476 22:46085479-46085501 GGAGGCACTGCATGAGATCCTGG + Intronic
949516453 3:4811895-4811917 GGGGGTGTTTCATCAGATCATGG + Intronic
950265629 3:11570814-11570836 GGGTGCTTTGGATGAGCTCGGGG - Intronic
961919206 3:130408361-130408383 GGGGGCGTTGCAGGAGACCAGGG - Intronic
967386486 3:188916612-188916634 GGGGACGTTGCGGGGGATCGAGG + Intergenic
971251913 4:24979718-24979740 GGAGGAGTTGCATGGGATGGTGG + Intronic
972167249 4:36302197-36302219 GAGGGCATTGCATCAGATCATGG + Intronic
980073287 4:128265716-128265738 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
984905963 4:184626047-184626069 GGGGGCGTTGCAGGAGGCCAGGG + Intergenic
997564182 5:134874544-134874566 GGGGGCGGTGCATGAGATGATGG + Intronic
998152445 5:139765059-139765081 GGGGGCGTTGGAAGGGTTCGTGG - Intergenic
1000735406 5:164893225-164893247 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1006809330 6:36809933-36809955 GAGGGGGTTAAATGAGATCGTGG - Intronic
1007581178 6:42960993-42961015 GGGGGCGTTGCATGAGATCGGGG + Intronic
1011888308 6:92125748-92125770 GGGGGCGGGGCAAGAGATTGGGG - Intergenic
1014469503 6:121797808-121797830 GGGGGCGCTGCAGGAGACCATGG - Intergenic
1019096642 6:169586628-169586650 GTGGGCGGATCATGAGATCGAGG + Intronic
1032852985 7:135811052-135811074 GGGGGATTTGGATTAGATCGGGG - Intergenic
1033677085 7:143553371-143553393 GGGGGCGTTGCAGGAGACTAGGG + Intergenic
1033694750 7:143776066-143776088 GGGGGCGTTGCAGGAGACTAGGG - Intergenic
1035572847 8:685071-685093 GGGGGCGCTGCAGGAGACCAGGG + Intronic
1035693255 8:1573363-1573385 GGGGGCGTCTGATGAGATGGAGG + Intronic
1044142289 8:88670893-88670915 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1044939118 8:97322446-97322468 GGGGGCCTGTCATGAGGTCGGGG - Intergenic
1055589980 9:77802252-77802274 AGGGGGGTTGCATGGGATTGGGG - Intronic
1188256299 X:27965535-27965557 GGGGGCGCTGCAGGAGACCAGGG + Intergenic
1190027706 X:46940990-46941012 GGGTTTGTTGCATGACATCGAGG + Intronic
1195363552 X:104107027-104107049 GGGGGGATAGAATGAGATCGTGG - Intronic
1199068344 X:143446893-143446915 GTGAGCTTTGCATGAGATTGTGG - Intergenic
1201222932 Y:11789368-11789390 CGAGGCGTTGCCTGACATCGTGG + Intergenic