ID: 1007582438

View in Genome Browser
Species Human (GRCh38)
Location 6:42967496-42967518
Sequence CTGTCTGCACATCAGCAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007582432_1007582438 18 Left 1007582432 6:42967455-42967477 CCCCTCTGACAGAGCAGGCACCT 0: 1
1: 0
2: 1
3: 27
4: 256
Right 1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 271
1007582430_1007582438 24 Left 1007582430 6:42967449-42967471 CCGCTGCCCCTCTGACAGAGCAG 0: 1
1: 0
2: 4
3: 32
4: 328
Right 1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 271
1007582433_1007582438 17 Left 1007582433 6:42967456-42967478 CCCTCTGACAGAGCAGGCACCTC 0: 1
1: 0
2: 0
3: 17
4: 193
Right 1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 271
1007582434_1007582438 16 Left 1007582434 6:42967457-42967479 CCTCTGACAGAGCAGGCACCTCG 0: 1
1: 1
2: 0
3: 12
4: 165
Right 1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 271
1007582436_1007582438 -2 Left 1007582436 6:42967475-42967497 CCTCGAGCTCATGAGGAAATGCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007582438 Original CRISPR CTGTCTGCACATCAGCAGGC AGG Exonic
902052747 1:13577136-13577158 CTGTCATCACCTCAGCTGGCAGG + Intergenic
902709138 1:18226826-18226848 ATGACTGGACATCAGCCGGCAGG + Intronic
903649520 1:24914346-24914368 CTGTCTACCCAGCAGCAGGGTGG + Intronic
904702493 1:32366193-32366215 CTGTCCATACATAAGCAGGCAGG - Intronic
905012323 1:34755708-34755730 CCGTCTGCACACAAACAGGCAGG + Intronic
907814855 1:57908473-57908495 CTGGCTGCCCATCAGGATGCGGG - Intronic
910447058 1:87309540-87309562 CTGAATGCACAGCAGCAGGCAGG - Intergenic
914004370 1:143719698-143719720 CAGACTGCACATCAGCAGATAGG - Intergenic
914521151 1:148417584-148417606 CTGCCTGCAGAGCAGGAGGCAGG - Intergenic
915163413 1:153934774-153934796 GTGTCAGCACATCAAGAGGCAGG - Exonic
916850726 1:168700672-168700694 CTCTCTGCTCTTGAGCAGGCTGG + Intronic
918075692 1:181169767-181169789 CTGTCTAAACATCATCAGGAGGG - Intergenic
918658653 1:187061920-187061942 CTCTCTGCAACTCACCAGGCTGG - Intergenic
919054979 1:192559320-192559342 CTTTCTCCACATCAGCAGTGAGG + Intergenic
919835963 1:201573548-201573570 CTGACTGCAAAACAGGAGGCAGG - Intergenic
921230069 1:213061012-213061034 CTGTATGCAAATCAGGAAGCGGG - Intronic
921325306 1:213982722-213982744 CTGTCCCCACAGCAACAGGCGGG + Intergenic
921737427 1:218643894-218643916 TTGTCTGCAGCTCAGCAAGCAGG + Intergenic
922462249 1:225822896-225822918 CCGTGTGCACATAAACAGGCTGG - Intronic
922874632 1:228930671-228930693 CTGTTTGCACCGCAGCAGACAGG - Intergenic
924801134 1:247330537-247330559 TTGTCTGCACACCAGCGGGGAGG - Intronic
1062886588 10:1021138-1021160 GTGTGTGCACATCTGCAGGAAGG - Intronic
1063145326 10:3290550-3290572 CTGTGTCAACACCAGCAGGCAGG - Intergenic
1063714945 10:8517537-8517559 CTGTGTGCATACCAGCAAGCCGG - Intergenic
1067150079 10:43724775-43724797 CTGTCTACAAACCAGAAGGCAGG + Intergenic
1067661874 10:48242190-48242212 TGGTCTCCACATCAGAAGGCTGG - Exonic
1067802636 10:49369660-49369682 TTGGCTGCACAACAGCAGGAAGG + Intronic
1068103356 10:52583009-52583031 CTTTCTGCACATCAGCAATAAGG - Intergenic
1069207496 10:65710129-65710151 CTTTCTCCACATCAGCAGTAAGG + Intergenic
1069660915 10:70122974-70122996 CTATCTGCCCAGCACCAGGCAGG + Intronic
1070697324 10:78572742-78572764 TTGTTTCCACATCAGCATGCTGG + Intergenic
1072438744 10:95436097-95436119 TTGTCTGCAAACAAGCAGGCAGG - Intronic
1074891197 10:117737836-117737858 CTGCCTGCACATCAGCACTTGGG - Intergenic
1075228369 10:120649957-120649979 CTGCCTCCCTATCAGCAGGCTGG - Intergenic
1075960203 10:126562038-126562060 CTGTCAGCACTTCAGCGGGAGGG - Intronic
1076046508 10:127298605-127298627 CTGTCTGCTCCTGAGCAAGCTGG + Intronic
1076734836 10:132454054-132454076 CTTTCTCCACATCAGCAAGGAGG - Intergenic
1077835856 11:5928065-5928087 ATGTGTGCAGAGCAGCAGGCTGG - Intronic
1078549092 11:12268299-12268321 GGGTCTGCACAGCAGCAGGTGGG + Intergenic
1079118684 11:17660168-17660190 CTCTCTGAAAATCAACAGGCTGG + Intergenic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1079975495 11:27085887-27085909 CTTTCTCCACATCAGCAGTAAGG - Intronic
1080184282 11:29461538-29461560 GAGTCTGCACATTAGCAGGATGG + Intergenic
1080612648 11:33918026-33918048 CTGCCTTCACTGCAGCAGGCTGG - Intergenic
1083245219 11:61421554-61421576 CTGTCAGCACATCATCATACAGG + Exonic
1083339823 11:61951859-61951881 CCGCCAGCACAGCAGCAGGCGGG - Intronic
1083989234 11:66236588-66236610 CTGTCTGTTCATCAGCAGCTGGG + Intronic
1083992228 11:66253584-66253606 CTGAGTGCCCATCAGCAGCCTGG + Intergenic
1085412561 11:76300164-76300186 ATCTCTGGACCTCAGCAGGCAGG - Intergenic
1085461867 11:76698930-76698952 CTGGGTGGACAGCAGCAGGCAGG - Intergenic
1086356028 11:86000696-86000718 CTGTATCCACCTCAGCAGGAGGG - Exonic
1086861729 11:91932312-91932334 CTGTCTGCCCCTCATTAGGCAGG - Intergenic
1088045081 11:105440605-105440627 CTGTGTGGAAAACAGCAGGCTGG + Intergenic
1088923793 11:114280859-114280881 CTGCCGGCAAATGAGCAGGCCGG - Intronic
1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG + Intergenic
1089779894 11:120866371-120866393 CTGTGTGCAAAGCACCAGGCAGG + Intronic
1090738034 11:129629308-129629330 CTTTCTGCACATCAGCAATAAGG + Intergenic
1092273831 12:7044210-7044232 CAGTGTGCACAGCAGCAGGGAGG - Intronic
1092576290 12:9786941-9786963 ATGTCCACACATCAGGAGGCAGG - Intergenic
1095375007 12:41516290-41516312 TTATCTGCACATCACCAGGAGGG + Intronic
1095940988 12:47726673-47726695 CTCTCTACACAGCAACAGGCTGG - Intergenic
1095972209 12:47910036-47910058 CTGTGTGCAGGCCAGCAGGCTGG - Intronic
1096623000 12:52876035-52876057 CTGTGTGTACATCAGTAGTCCGG - Intergenic
1099670145 12:85680945-85680967 CTGCCTGCAGTTCAGCAAGCAGG - Intergenic
1101562179 12:105867441-105867463 CTTTCTGCATATCAGCAAGAAGG - Intergenic
1101829471 12:108246187-108246209 CTGTCTGCTCCTCACCAGGGAGG - Intronic
1101860611 12:108479451-108479473 CTGCCTACACAGCAGCAGGAAGG + Intergenic
1102008717 12:109605241-109605263 CTGTCTTGACAACAGAAGGCAGG - Intergenic
1102040320 12:109796680-109796702 CTTTCAGCACATCATCCGGCGGG - Exonic
1102908246 12:116693895-116693917 TTGTCTGCAGATCGGCAAGCGGG + Intergenic
1103474906 12:121210899-121210921 TTGTCAGCAAATCAGCAGGATGG - Intronic
1103731688 12:123032087-123032109 CTGGCTGCACAGCTGCAGGAAGG + Intronic
1104601251 12:130155245-130155267 ATGTCTGCCCATCTGCTGGCAGG - Intergenic
1104664162 12:130635575-130635597 GTCACTGCACATCAGCAGGAAGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105328382 13:19391148-19391170 CTGGCTGCACAACAGAAGGTGGG + Intergenic
1105581645 13:21703373-21703395 CTTAATGCACATCAGCAGGAGGG - Exonic
1108872233 13:55001756-55001778 AAGTCTGAAAATCAGCAGGCTGG - Intergenic
1111107529 13:83666905-83666927 ATGACTGCACTTCAGCAGCCAGG + Intergenic
1112880527 13:104101545-104101567 CTGTCTGCACTTCAGCCCTCCGG - Intergenic
1113174460 13:107546200-107546222 CTGTCTGCAGAGCAGCAGGATGG - Intronic
1114519753 14:23325725-23325747 CTGGCTGGACAGGAGCAGGCAGG - Exonic
1115750921 14:36489002-36489024 GTGGCTGCTCATCAGCAGGCAGG - Intronic
1117333156 14:54734293-54734315 CTGTCTGCAAATCAGAAGCTTGG + Intronic
1118989575 14:70785626-70785648 CTGACTACACATCAGAAGGTTGG - Intronic
1119905392 14:78297607-78297629 CTTTCTGCCCAGCAGCAGGAAGG + Intronic
1120719362 14:87873578-87873600 GTATCTGCTCATCAGTAGGCAGG + Intronic
1121755605 14:96399673-96399695 CTGGCTTCACAGCAGCAGCCTGG + Intronic
1122641844 14:103164620-103164642 CTGACTGCCCATCAGGGGGCTGG + Intergenic
1123488104 15:20758984-20759006 CTGTATGCACCTCACCTGGCTGG - Intergenic
1123544604 15:21328057-21328079 CTGTATGCACCTCACCTGGCTGG - Intergenic
1124486622 15:30123060-30123082 CTGGCTGAAGATCAGTAGGCAGG + Intergenic
1124541698 15:30592039-30592061 CTGGCTGAAGATCAGTAGGCAGG + Intergenic
1124548358 15:30653834-30653856 CTGGCTGAAGATCAGTAGGCAGG + Intronic
1124692788 15:31839348-31839370 CTGTTTGCTCGTCAGCAGGATGG + Intronic
1124756908 15:32415258-32415280 CTGGCTGAAGATCAGTAGGCAGG - Intergenic
1125491164 15:40149565-40149587 CTGGCAGGACATCAGAAGGCGGG + Intergenic
1126096442 15:45094188-45094210 CTGTCAGCTCGTCAACAGGCAGG - Exonic
1126108984 15:45164841-45164863 CTGTCAGCTCATCAACAGGCAGG + Exonic
1126143521 15:45456252-45456274 CTGTCTGGACACCATCAGTCTGG + Intergenic
1126209151 15:46080135-46080157 ATGTCTGCCAAACAGCAGGCAGG - Intergenic
1126361376 15:47849696-47849718 CAGTCTGCACGCCAGGAGGCGGG + Intergenic
1126466204 15:48963430-48963452 CTGTGTGCAGAACAGAAGGCTGG - Exonic
1128565445 15:68697947-68697969 CTCCCAGCACCTCAGCAGGCAGG - Intronic
1129297791 15:74609328-74609350 CTGGCTGCACACTAGCAGGGGGG + Intronic
1129633703 15:77291132-77291154 CTGTCTGCAAATCTGAAAGCAGG - Intronic
1129718108 15:77863492-77863514 CTGTATGCCCAGCACCAGGCTGG - Intergenic
1130321689 15:82847780-82847802 TGGTCTGCCCAGCAGCAGGCTGG - Intronic
1130460807 15:84157279-84157301 CTGTATGCCCAGCACCAGGCTGG + Intergenic
1132420955 15:101668035-101668057 CTTTCTCCACATCAGCAAGAAGG + Intronic
1202952947 15_KI270727v1_random:55328-55350 CTGTATGCACCTCACCTGGCTGG - Intergenic
1132706281 16:1244802-1244824 CTGTCTGCACGCCAGCACGTGGG - Intergenic
1132781777 16:1630581-1630603 CCGCCTGCAAATGAGCAGGCAGG - Intronic
1133436365 16:5783721-5783743 GTTTTGGCACATCAGCAGGCTGG - Intergenic
1138124614 16:54428593-54428615 CTGTCTGCCCAGCAGCTGGAGGG + Intergenic
1140341993 16:74173604-74173626 CTGTCTGCAAATCAGGAAGAGGG - Intergenic
1140394740 16:74616908-74616930 CTGTCTACAGATCAGAATGCTGG - Intergenic
1140728650 16:77836453-77836475 GCATCTGCACATCAGCAGGAAGG + Intronic
1141119201 16:81338053-81338075 CTGTTTACAGATCAGCAGACGGG + Intronic
1141943290 16:87292903-87292925 ATTTCAGCACATTAGCAGGCTGG + Intronic
1142322326 16:89391469-89391491 CTTTCTGCCCAGCAGCAGGGAGG - Intronic
1143370394 17:6435678-6435700 CTCTCTCCACATCGCCAGGCTGG - Intergenic
1143875242 17:9986301-9986323 GTGTCTGCACATCAGCTGGTGGG - Intronic
1146392734 17:32437903-32437925 CTGTCTGCCCATCCGCATGTAGG + Intergenic
1147304219 17:39552153-39552175 CTGTCTGCAGTTAAGAAGGCAGG - Intronic
1149559270 17:57596540-57596562 CTCTGTGCACGGCAGCAGGCGGG - Intronic
1150212978 17:63451517-63451539 CAGGCTGCACATCAGCACGCAGG + Intergenic
1150912175 17:69399748-69399770 CTATCTTCACATCAGCAATCAGG - Intergenic
1151132538 17:71912474-71912496 GTGTCTTCACTTCAGCAGGTGGG - Intergenic
1152082841 17:78199214-78199236 CTGTCTCCACTTCAGCTGGATGG - Intronic
1152473049 17:80500811-80500833 CCGTCTGCAAATAAGGAGGCGGG - Intergenic
1153227455 18:2909505-2909527 CTGTCTGAGGATCAGCAGGCAGG - Intronic
1153815913 18:8790046-8790068 CTGCCTGCCCAACAGCAGACAGG - Intronic
1153823576 18:8854328-8854350 CTCACTGCACACCAGCAGACAGG + Intergenic
1155324441 18:24651756-24651778 CTGCCAGCAGATCAGCATGCAGG - Intergenic
1156812906 18:41274082-41274104 CTGCCTGGACATAGGCAGGCTGG - Intergenic
1157733194 18:50022606-50022628 CTTTCTCCACGGCAGCAGGCAGG - Intronic
1158408110 18:57178533-57178555 CTGGCTTCACAGCAGAAGGCAGG + Intergenic
1159762534 18:72446088-72446110 CAGTTTGCACATCATCAAGCTGG + Intergenic
1161726459 19:5932154-5932176 CTGTCTTCATAAAAGCAGGCCGG - Intronic
1162831199 19:13285752-13285774 CCGTGGGCACATAAGCAGGCTGG - Intronic
1163853073 19:19677533-19677555 CTGTCTGCACACCAGGTGGTGGG + Intronic
1165155015 19:33781643-33781665 CTCTCTGTAGATCTGCAGGCAGG + Intergenic
1165226284 19:34357503-34357525 CTGTCTCCACAACAGGAGGCAGG - Intergenic
1165256075 19:34577845-34577867 CCGCCTGCACATCAGCTGCCTGG - Intergenic
1167141316 19:47652498-47652520 CTGTATAGACATCAGCAGTCAGG + Intronic
1167239390 19:48334186-48334208 CTGCCCGAACATCTGCAGGCGGG + Exonic
925207985 2:2023459-2023481 CTCTCTCCACTTCAGGAGGCTGG + Intronic
925282747 2:2696196-2696218 AAGTCTGCAGACCAGCAGGCTGG - Intergenic
934988349 2:98903028-98903050 CCAACTGCACAGCAGCAGGCGGG + Intronic
935102969 2:100014478-100014500 TTGTCTTCTCATCAGCAGGATGG - Intronic
935400811 2:102658089-102658111 CTCTCTGCACCTCAACTGGCAGG + Intronic
937979251 2:127604444-127604466 CTGTCTCCATATCAGCAAGAAGG + Intronic
938581385 2:132649451-132649473 TTGTAGGCACTTCAGCAGGCAGG + Intronic
939101078 2:137895506-137895528 CTGTCTGCAAACCAGGAGGTGGG + Intergenic
940322170 2:152389280-152389302 CTGTCTCCAAACCAGGAGGCAGG - Intronic
944821715 2:203439540-203439562 CTGTCTGATCAACAGAAGGCTGG - Exonic
946057100 2:216911965-216911987 TTCTGTGCACTTCAGCAGGCAGG + Intergenic
946161166 2:217836874-217836896 CTGTCTGCTCTTCAGCTGGGAGG - Intronic
948164438 2:235850460-235850482 CTGGCAGGACATCAGCCGGCTGG + Intronic
948249012 2:236510440-236510462 CTGTCAGCACAGAAGAAGGCAGG + Intergenic
1168895646 20:1321578-1321600 CTGTCTGGAGAGCAGCAGGACGG - Intronic
1169281166 20:4268060-4268082 CTGTCTACAAGTCAGGAGGCAGG - Intergenic
1170101010 20:12699457-12699479 CTGTCTGTAGTTCAGCAGACTGG + Intergenic
1170823101 20:19770910-19770932 CTGTCAGCAGATCCGGAGGCCGG - Intergenic
1170839400 20:19911914-19911936 CTGGCTGCACATCTGTACGCTGG - Intronic
1172023274 20:31930949-31930971 CTGTCTCCTCCACAGCAGGCGGG + Intronic
1172967880 20:38851583-38851605 TAGTCTGGACATCATCAGGCTGG + Intronic
1173904272 20:46614398-46614420 CAGTCTGCACATAAGGATGCCGG - Intronic
1174321805 20:49747858-49747880 CTCTCAGCACATCACCAGCCAGG - Intergenic
1174501820 20:50990739-50990761 CTGTCTGCTCACCCGCATGCAGG - Intergenic
1176450233 21:6855609-6855631 CTGTATGCACCTCACCTGGCTGG + Intergenic
1176828402 21:13720627-13720649 CTGTATGCACCTCACCTGGCTGG + Intergenic
1177526489 21:22298483-22298505 CTGTCTGAACATCAGAAAGATGG + Intergenic
1178580139 21:33831463-33831485 TTGTCTGCCCATGAGCAGGACGG + Intronic
1179022710 21:37654804-37654826 CTGTCTGCACAGCCCCTGGCTGG + Intronic
1179110162 21:38439271-38439293 CTGTCTTCTCGTGAGCAGGCTGG - Intronic
1179304978 21:40145463-40145485 CCATCTTCACATCAGCAGGGTGG - Intronic
1180183299 21:46127485-46127507 CTGGCTGCCCTTCAGCAGGCGGG + Intronic
1184599470 22:45534020-45534042 CTGCCTGCTCATCTGCAGGAGGG + Intronic
1184912368 22:47544801-47544823 CTGATTGGACAGCAGCAGGCTGG + Intergenic
1185086082 22:48741762-48741784 CTGTCTGCAGCCCAGGAGGCTGG - Intronic
1185208560 22:49554004-49554026 CTCTCTGGACATCAGAAGGCCGG - Intronic
1185317146 22:50184186-50184208 CTGTCCACACGGCAGCAGGCTGG - Intergenic
950507843 3:13406770-13406792 TTCTCTGCACCTCAGCAGGTGGG + Intronic
950736772 3:15015645-15015667 CGGACTGCTCATCAGCTGGCTGG - Intronic
951333068 3:21388526-21388548 CTTTCTCCATATCAGCAGGAAGG - Intergenic
952606609 3:35154874-35154896 CCCTCTGCTCATCACCAGGCAGG + Intergenic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
954465093 3:50649589-50649611 CTGCCCGCCCTTCAGCAGGCTGG - Intergenic
954845903 3:53555713-53555735 CTGTTTGCATCTCAGCAGACGGG + Intronic
955526448 3:59825136-59825158 CCCTCTGCAAATCAGCAGGAAGG - Intronic
955830080 3:62992079-62992101 CTGTGAGCACATCAGCAGCAAGG + Intergenic
958621380 3:96566856-96566878 CTCTGTGGACATCAGAAGGCAGG + Intergenic
960147536 3:114218916-114218938 GTGACTGCACACCAGCTGGCTGG + Intergenic
961372367 3:126439543-126439565 CTGGCTTCACAGCTGCAGGCTGG - Intronic
961742172 3:129039766-129039788 CTGTCTCCGCAACAGCTGGCAGG - Exonic
962939813 3:140115609-140115631 ATCTCTGCCCCTCAGCAGGCAGG + Intronic
966734311 3:183176772-183176794 CTGAATGGGCATCAGCAGGCTGG - Intergenic
967816717 3:193805559-193805581 CTGTCTGTAAATAAGCAGGTTGG + Intergenic
967989213 3:195118923-195118945 TTAGCTGTACATCAGCAGGCAGG + Intronic
968506612 4:973866-973888 CTGTCTGCGCAGCCGCGGGCCGG - Intronic
968553437 4:1235928-1235950 TTTCCTGGACATCAGCAGGCTGG + Intronic
968940777 4:3636440-3636462 CTGTGTGCTCATGAGCTGGCTGG - Intergenic
969476518 4:7425303-7425325 CTGTCTCCACAGCCGCAGCCTGG + Intronic
969865796 4:10076314-10076336 CTCTGTCCACATCACCAGGCTGG + Intronic
969909369 4:10429103-10429125 CTCTCTGGACATAAGCAGGTTGG + Intergenic
969998264 4:11337439-11337461 GATTCTGCACATCAGCAGTCTGG + Intergenic
970870347 4:20809917-20809939 TTGTCAGCACTCCAGCAGGCCGG - Intronic
972969834 4:44559749-44559771 TTGTCAGCATATCAGCAGGTGGG + Intergenic
972997142 4:44894714-44894736 CTCTCTGCCCATCTGCAGACTGG - Intergenic
973672444 4:53235055-53235077 CTGGCTGCATTTCAGCAAGCAGG + Intronic
974094717 4:57350903-57350925 CCTTCTGCTCATCACCAGGCAGG - Intergenic
977299890 4:95255737-95255759 CTAACAGCACATCTGCAGGCTGG - Intronic
978853818 4:113370207-113370229 CTGTGTGCTCATCACCTGGCAGG - Intronic
981337352 4:143581997-143582019 CTCCCTGCCCATCACCAGGCAGG + Intronic
984890256 4:184485755-184485777 CTGTCTGCAAAGAAACAGGCTGG + Intergenic
985762274 5:1755671-1755693 CTGTTTGCACATCAACAGTATGG + Intergenic
988655549 5:33207613-33207635 CTTTCTCCACATCAGCAAGAAGG - Intergenic
991936210 5:71803322-71803344 CTTTCTCCACATCAGCAATCAGG + Intergenic
992845700 5:80744806-80744828 ATGTCTGCCAATCTGCAGGCAGG - Intronic
993844804 5:92927783-92927805 CTGGCTGGACATCAGGAGCCAGG + Intergenic
994141424 5:96345981-96346003 CAGTGTGAACATCAGAAGGCAGG + Intergenic
995836605 5:116405820-116405842 CTGTGTCCCCTTCAGCAGGCGGG - Intronic
998505373 5:142668009-142668031 CTGTCTGGAGCTGAGCAGGCAGG + Intronic
1000661192 5:163940693-163940715 CTTTCTCCACATCAGCAATCAGG - Intergenic
1001028505 5:168244542-168244564 CTGGCTGCCCAGCAGCGGGCTGG + Exonic
1003164226 6:3662053-3662075 GTGTCAGGGCATCAGCAGGCAGG - Intergenic
1005998523 6:30947375-30947397 GATTCTGCCCATCAGCAGGCAGG + Intronic
1007281811 6:40718520-40718542 CAGTCTGCCCATCTGCAAGCTGG + Intergenic
1007582438 6:42967496-42967518 CTGTCTGCACATCAGCAGGCAGG + Exonic
1007654101 6:43441864-43441886 CTGTCTGGTCTCCAGCAGGCAGG - Exonic
1008535450 6:52503509-52503531 CTGACTGCACTTTAGCAGGAGGG + Intronic
1011614574 6:89186135-89186157 CTGTTTACACATCAACAGGCTGG - Intronic
1011893642 6:92197396-92197418 CCATCTGCAAATCAGGAGGCAGG + Intergenic
1012409425 6:98938988-98939010 CTGTTTCCACCTCAGGAGGCTGG + Intronic
1013009085 6:106103938-106103960 CTGTCTGCACATCGCGAGGAAGG + Intronic
1013912016 6:115287294-115287316 CTGTCTACACCTCACCAGGCAGG + Intergenic
1016734328 6:147460157-147460179 CTATCTGCAAATCAGGAAGCAGG + Intergenic
1016764139 6:147773561-147773583 CTATCTGCATATCAGGAAGCAGG - Intergenic
1016984782 6:149887079-149887101 CTGTCTGGGCAGGAGCAGGCAGG - Intronic
1018475074 6:164132449-164132471 CTGTATGCACATGGGCAGCCAGG - Intergenic
1019612241 7:1942372-1942394 CTGTGGTCACAGCAGCAGGCTGG - Intronic
1020586287 7:10073499-10073521 GTGTCAGCACTTCAGAAGGCTGG - Intergenic
1022391468 7:29947898-29947920 CCGTCTGCAAACCAGCAAGCAGG + Intronic
1022690113 7:32641421-32641443 CTGTCTGCATATCAGCAATAAGG - Intergenic
1023100253 7:36710567-36710589 GTTTCTGCACATCAGAAGCCTGG - Intronic
1029188718 7:98756978-98757000 CTGTCTCCAGCTCTGCAGGCAGG - Intergenic
1032189965 7:129759275-129759297 CTCACTCCACCTCAGCAGGCTGG + Intergenic
1033046497 7:137967143-137967165 CTGTCTGCAAGTCAGGAAGCGGG + Intronic
1033144743 7:138861423-138861445 GTGTCTGCACATCGGCTGGGAGG + Exonic
1034303046 7:150032948-150032970 CCTTTTGCACATCAGCAAGCTGG - Intergenic
1034803003 7:154064321-154064343 CCTTTTGCACATCAGCAAGCTGG + Intronic
1035167084 7:156997781-156997803 CTCTCTCCACATCAGCAGTCAGG + Intronic
1035353837 7:158265426-158265448 CTGTGGGCACACCTGCAGGCAGG + Intronic
1035407064 7:158606043-158606065 CTGTCTGCCCCTCAGAGGGCAGG + Intergenic
1035715923 8:1754877-1754899 CTGCCTGCCCAGAAGCAGGCCGG + Intergenic
1038646818 8:29368994-29369016 CTGTCTGAACAACAGCAAGGAGG + Intergenic
1039431843 8:37530938-37530960 ATGTCTGCGGAGCAGCAGGCAGG - Intergenic
1040896057 8:52369512-52369534 CTGTCTGGGCATAAGTAGGCTGG - Intronic
1045568401 8:103344871-103344893 ATGTCTGCATACCAGCAGTCAGG - Intergenic
1047779780 8:128101663-128101685 CTGTCTTCAAAACAGCAGCCAGG + Intergenic
1049103521 8:140596951-140596973 CTGTCTGCACCTTGGCTGGCTGG - Intronic
1050209074 9:3233118-3233140 CTCACTGGACAACAGCAGGCTGG + Intronic
1051069440 9:13146247-13146269 CTGTCTTCACAACAGAAGGAAGG + Intronic
1055496804 9:76862944-76862966 CTGTGTGCAAAGCAGTAGGCTGG - Intronic
1057140783 9:92725689-92725711 CAGACTGCTCATCAGCAAGCAGG + Intronic
1057170852 9:92962237-92962259 CTGGCAGCACAGCAGCAGGCTGG - Intronic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1058500510 9:105610651-105610673 CTCTCTGCAGAACAGCAGCCAGG - Intronic
1060723801 9:125994714-125994736 CTCTCCGCACACCAGCAGGGTGG - Intergenic
1061541848 9:131281674-131281696 CTGGCTGCAAATCTGGAGGCTGG + Intergenic
1061620743 9:131809855-131809877 CTGTGTGCCCACCAGCAGGCTGG - Intergenic
1203785578 EBV:125740-125762 CTGTCCGCCCTTCAGCGGGCGGG + Intergenic
1203518949 Un_GL000213v1:28908-28930 CTGTATGCACCTCACCTGGCTGG - Intergenic
1186203785 X:7180487-7180509 CTGGCTGCACAGCAGGAGGTGGG - Intergenic
1186516000 X:10166531-10166553 CTTTCTCCACAACAGCAGGCAGG - Intronic
1188488899 X:30714726-30714748 GGGTATGCACATCAGGAGGCAGG + Intronic
1191122965 X:56925457-56925479 TTTTCTGCTCATCACCAGGCAGG - Intergenic
1192792683 X:74398639-74398661 CTGTATGAACATCATAAGGCAGG + Intergenic
1193997321 X:88382818-88382840 TTTTCTGCACTTCACCAGGCTGG - Intergenic
1195102297 X:101567122-101567144 CTGCCAGCACAGCAGCAGTCTGG + Intergenic
1196161611 X:112490627-112490649 AAGACTGCACATCAGCAGCCAGG - Intergenic
1197706195 X:129636343-129636365 CTGTCTGCACTTCTGCAAGGAGG + Intergenic
1199862710 X:151816228-151816250 AGGTCTGCTCAGCAGCAGGCAGG - Intergenic
1200133838 X:153865143-153865165 CTGCCAGCGCAGCAGCAGGCTGG + Exonic
1202378443 Y:24257901-24257923 CTGTATGCCCAGCACCAGGCTGG - Intergenic
1202492339 Y:25412220-25412242 CTGTATGCCCAGCACCAGGCTGG + Intergenic