ID: 1007589171

View in Genome Browser
Species Human (GRCh38)
Location 6:43011253-43011275
Sequence AGAGTTCCTAACTGCCAGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007589163_1007589171 25 Left 1007589163 6:43011205-43011227 CCAGGACGTGTACACCATCAAGG 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG 0: 1
1: 0
2: 4
3: 10
4: 143
1007589161_1007589171 27 Left 1007589161 6:43011203-43011225 CCCCAGGACGTGTACACCATCAA 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG 0: 1
1: 0
2: 4
3: 10
4: 143
1007589167_1007589171 11 Left 1007589167 6:43011219-43011241 CCATCAAGGCACTGGAGGCGCAC 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG 0: 1
1: 0
2: 4
3: 10
4: 143
1007589162_1007589171 26 Left 1007589162 6:43011204-43011226 CCCAGGACGTGTACACCATCAAG 0: 1
1: 0
2: 1
3: 9
4: 76
Right 1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG 0: 1
1: 0
2: 4
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007589171 Original CRISPR AGAGTTCCTAACTGCCAGCC AGG Exonic
900096117 1:940794-940816 AGAGTCCAGAAGTGCCAGCCAGG - Intronic
900913178 1:5616715-5616737 AAAGATTCTAACTTCCAGCCTGG + Intergenic
901821773 1:11834954-11834976 AGAATGCCCTACTGCCAGCCGGG + Intronic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
905969919 1:42133930-42133952 AGAACTCCCAACTGCCTGCCAGG - Intergenic
906669282 1:47643080-47643102 AGAGGTCCTGACTACCAGCAAGG + Intergenic
906790107 1:48651779-48651801 AGATCTCCTGACAGCCAGCCAGG - Intronic
906963340 1:50432839-50432861 AAAGTTCCTGACTGCCCACCTGG + Intergenic
907157973 1:52351856-52351878 AGAGTAGCTCTCTGCCAGCCAGG - Exonic
913017350 1:114752489-114752511 AGTGTTTCTGACTTCCAGCCAGG + Intronic
916235933 1:162588107-162588129 CTAGTTTCTAAATGCCAGCCTGG - Intronic
916760467 1:167811798-167811820 AGAGTTTTTAACTCCCAGACCGG - Intronic
917343044 1:173999939-173999961 AGAGTTTCAAAGTACCAGCCTGG - Intronic
919201172 1:194357199-194357221 AGAGTTTCTAACTGACAGCCAGG + Intergenic
920374211 1:205498545-205498567 CCAGTTCCTAACAGGCAGCCAGG + Intergenic
924460614 1:244255333-244255355 TGAGGTCCTAACTGACAGCTGGG + Intergenic
924619062 1:245644692-245644714 CCACTTCCTAACAGCCAGCCTGG - Intronic
1067682494 10:48449822-48449844 AGGGGTCCTCACTTCCAGCCTGG + Intronic
1071988161 10:91073487-91073509 AGCTTTCCTTCCTGCCAGCCTGG - Intergenic
1073455659 10:103635398-103635420 AGAGGGCCTGACTGCCAGGCTGG - Intronic
1074455492 10:113592250-113592272 TGAAGTCATAACTGCCAGCCCGG + Exonic
1075190995 10:120308458-120308480 GAAATTCCTAATTGCCAGCCTGG - Intergenic
1076920086 10:133446604-133446626 TGGGTTCCTCCCTGCCAGCCCGG - Intergenic
1077423966 11:2465866-2465888 ACAGCTCCTGCCTGCCAGCCAGG - Intronic
1079043608 11:17080531-17080553 TGAGTACCTAACTTCCCGCCAGG - Intronic
1082870293 11:57937972-57937994 ACAGTTCATAACTGGTAGCCAGG - Intergenic
1089231140 11:116977921-116977943 AGAATTACTATCTGCAAGCCGGG + Intronic
1089930924 11:122311128-122311150 AGAGTTTCTATCTTCCAACCAGG + Intergenic
1090334700 11:125954594-125954616 AGGGTTCCTAACCCTCAGCCTGG - Intergenic
1093091242 12:14923046-14923068 AGAGTTCCACTCTGCCACCCAGG - Intronic
1094603616 12:31932130-31932152 AGCCTTCCTGACTGCCAGCCTGG - Intergenic
1096620246 12:52860056-52860078 TGTGTTCCTGACTCCCAGCCTGG - Intergenic
1097206958 12:57330638-57330660 AGAATTAATAAATGCCAGCCAGG - Intronic
1102556649 12:113731151-113731173 AGAGTTCCTGCCTCCCACCCTGG - Intergenic
1102670191 12:114611692-114611714 AGAGCTCCTCACTGTCAGCCTGG + Intergenic
1105470258 13:20687457-20687479 AGCCTTCCTGACTGCCAGCCTGG - Intronic
1105549077 13:21375595-21375617 AGAATTTCCAACTGACAGCCAGG + Exonic
1109916107 13:68987173-68987195 AGAATAACTAACTGACAGCCAGG - Intergenic
1110810392 13:79806242-79806264 AGACTACCTACCTGCCTGCCTGG - Intergenic
1113542864 13:111122501-111122523 AGAGTTGAGAACTGCCAGCCTGG - Intronic
1117219050 14:53583018-53583040 AAAGTTCATAACTTCCAGTCTGG - Intergenic
1121062367 14:90925114-90925136 AGAATTCCTGGGTGCCAGCCAGG + Intronic
1121088802 14:91167223-91167245 AGAGCTCCGACCAGCCAGCCTGG + Exonic
1202854771 14_GL000225v1_random:43469-43491 GGAGATCCCATCTGCCAGCCCGG - Intergenic
1124201652 15:27683479-27683501 AGCGTTCCTAAGTTCAAGCCTGG + Intergenic
1127858430 15:62972440-62972462 AGATCTCCTGACTCCCAGCCAGG + Intergenic
1130579708 15:85125013-85125035 ATAGTTTCATACTGCCAGCCTGG - Intronic
1132288523 15:100683315-100683337 AGAGTGTCTAAATGTCAGCCAGG - Intergenic
1132302310 15:100783627-100783649 AGTGCTCGTAACTGCCCGCCAGG - Intergenic
1134258598 16:12631726-12631748 AGAGTTTCTCTCTGCCAGTCAGG - Intergenic
1136125797 16:28179477-28179499 AGAGTTCCTCAGTTCCAGTCTGG - Intronic
1139663020 16:68435149-68435171 AGAGTTCATCCCTGCCAGCAGGG - Intronic
1140468057 16:75197865-75197887 AGAGGTCCTCACTGCCAGCCTGG + Intergenic
1141677271 16:85524428-85524450 AGGGCTCCTAAATGCCAGCACGG + Intergenic
1142640520 17:1283084-1283106 AGAGTTCCTTCCTGCCGGACTGG - Intronic
1143284195 17:5777024-5777046 AGAGTTCCTGACTCCCAGCCTGG + Intronic
1148694989 17:49553419-49553441 AGAGCACCTCACTGGCAGCCAGG - Intergenic
1155489011 18:26380370-26380392 ATATTTCCTAACTTCCATCCTGG + Intronic
1156331082 18:36123857-36123879 AGAGTTCTTAAGTACCAGTCAGG - Intronic
1157320812 18:46632475-46632497 ACAGTGCTTAACTTCCAGCCAGG + Intronic
1158267605 18:55677443-55677465 AGAGTCTCTCTCTGCCAGCCAGG + Intergenic
1159648133 18:70943661-70943683 AGAGGTCCCACCTGCGAGCCAGG - Intergenic
1160343165 18:78107279-78107301 AGTGTTCACAACTGCCTGCCTGG + Intergenic
1160653588 19:247329-247351 AGTGTCCCTAGCTGCCAGCAGGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1164556284 19:29255264-29255286 AGCCTTCCTCACTGCTAGCCTGG - Intergenic
1164822442 19:31260493-31260515 AGAGTTCCTCAGTGCATGCCAGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
928096529 2:28408374-28408396 AGAGTCCCCTCCTGCCAGCCAGG - Intronic
930407710 2:50981430-50981452 AGAGTTTCTATCTGTCACCCAGG - Intronic
930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG + Intergenic
932448347 2:71794309-71794331 AGAGCTCCTGAGTGTCAGCCTGG - Intergenic
937160173 2:119753123-119753145 GGTGTTTCTAACTTCCAGCCAGG + Intergenic
940280359 2:151982336-151982358 AAAGATACTGACTGCCAGCCGGG + Intronic
941059744 2:160832871-160832893 AGAGTCTCTCTCTGCCAGCCAGG - Intergenic
944192683 2:197020295-197020317 AGCTTTCCTAATTGCCAGCATGG - Intronic
944228792 2:197372999-197373021 ATAGCTCATAACTGCGAGCCAGG + Intergenic
948624383 2:239260057-239260079 TGATTTCCTAACTGCATGCCAGG + Intronic
1169938771 20:10914414-10914436 AGAGTGGCCAACTGCAAGCCAGG + Intergenic
1170768364 20:19311259-19311281 AAAGTTGCTGACTGCAAGCCTGG - Intronic
1170800062 20:19583404-19583426 ATAATTCCTAACGCCCAGCCTGG - Intronic
1172083450 20:32359416-32359438 AGCGTTCCTAACCGCCTCCCAGG - Intronic
1172189335 20:33052612-33052634 AGAGTCCCTCACTGTCACCCAGG + Intergenic
1172579471 20:36035634-36035656 AGAGGTCCTCACTGCCACCTAGG + Intergenic
1172994191 20:39057880-39057902 AGAGAGCCTGACTGCCAGGCAGG + Intergenic
1173461867 20:43249324-43249346 TGGGGTCCTCACTGCCAGCCAGG + Intergenic
1173512078 20:43637858-43637880 AGATTTGCTAAGTGGCAGCCAGG - Intronic
1176073239 20:63237463-63237485 TGAGTTCCTAAAAGCAAGCCTGG + Intronic
1177540804 21:22491790-22491812 GGAGTTCCTCTCTGTCAGCCAGG - Intergenic
1180115932 21:45705036-45705058 AGAGCTCCTCACAGCCAGCAAGG - Intronic
1181266555 22:21634171-21634193 GGATTTCCTAACTGAGAGCCAGG + Exonic
1183853203 22:40609431-40609453 AGACTGCATCACTGCCAGCCTGG + Intronic
953070953 3:39518951-39518973 AGAGGTCCTAGAAGCCAGCCTGG - Intronic
955333204 3:58064455-58064477 ATATTTCCTAACTGCCAGCCAGG - Intronic
956061446 3:65352141-65352163 AGAGTTCATAATTACCATCCTGG + Intergenic
956790035 3:72673297-72673319 CGACTTCCCCACTGCCAGCCAGG - Intergenic
959191216 3:103113596-103113618 AGAGATACTAACTGGGAGCCAGG - Intergenic
960185046 3:114627933-114627955 ACATTTCCCAACTCCCAGCCCGG - Intronic
965448546 3:168807039-168807061 AGTGTTCCCAACTGCCTGACTGG - Intergenic
966949454 3:184803245-184803267 AGGTTTCCTGACTCCCAGCCTGG - Intergenic
967065252 3:185909397-185909419 AGAGTTGCTGACTGCGAGCCTGG - Intergenic
967628406 3:191713385-191713407 AGCACTCCTAACTCCCAGCCGGG - Intergenic
970555055 4:17223289-17223311 AGAGTTTTTCACTGCCACCCAGG + Intergenic
970814557 4:20138662-20138684 AGAGATGCTAAATGCCAGCCTGG + Intergenic
972074975 4:35076013-35076035 AGAGTTCTGATCTGCCATCCAGG - Intergenic
975098819 4:70488929-70488951 TGAGTCCCTAACTGCCTGGCAGG + Intergenic
976424353 4:84883510-84883532 ATAGTTCCTCACTGCCAGAGGGG - Intronic
979006523 4:115305247-115305269 AGACTTACTATCTGCCTGCCTGG + Intergenic
980809113 4:137852690-137852712 TGAGTTCTTACCTGCCTGCCTGG + Intergenic
981788984 4:148514134-148514156 AGAGATCCTAACTCCAAGACAGG - Intergenic
982331134 4:154183244-154183266 AGAGTTTCTTACTGTCACCCAGG - Intergenic
983810250 4:172051779-172051801 AGAGGCCCTACCTGCAAGCCTGG - Intronic
985239828 4:187918132-187918154 AGAGTTTCACACTGCCACCCAGG - Intergenic
999107521 5:149086878-149086900 AAAACTCCTAACAGCCAGCCTGG - Intergenic
999459509 5:151745887-151745909 AGAGTTACTACCCTCCAGCCTGG + Intronic
1001720020 5:173849263-173849285 TGAGTTCCTACCTGACAGCCAGG - Intergenic
1002800208 6:515192-515214 ATAGTTCTTAATTGCCAACCTGG - Intronic
1003530829 6:6936239-6936261 AGAGTTCTTAAAGGCCAGGCAGG - Intergenic
1005468469 6:26139057-26139079 AGATTTCCCAAATTCCAGCCTGG + Exonic
1006039610 6:31243576-31243598 AGATTTCCAATCTGCCAGCCTGG - Intergenic
1006048517 6:31320501-31320523 AGGTTTCCAATCTGCCAGCCTGG - Intronic
1007309684 6:40935391-40935413 TGAGGTGCTCACTGCCAGCCTGG - Intergenic
1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG + Exonic
1010723764 6:79311172-79311194 AGACTGCCTTACTGGCAGCCAGG - Intergenic
1013023628 6:106246260-106246282 AGAGTCCCCATCTGGCAGCCAGG + Intronic
1013432333 6:110066299-110066321 AGAGTTTCCAGGTGCCAGCCAGG + Intergenic
1021646201 7:22791925-22791947 AAAGTTACTAATAGCCAGCCAGG + Intergenic
1022707641 7:32819582-32819604 AGAGCTGCTAAGTGGCAGCCAGG - Intergenic
1026070009 7:67110373-67110395 AGAGTTGCAAACTGCCTGCCTGG + Intronic
1026082436 7:67233936-67233958 TGAGGTCCTAACTCCCAGCGTGG + Intronic
1026706899 7:72701890-72701912 AGAGTTGCAAACTGCCTGCCTGG - Intronic
1029418720 7:100460674-100460696 AGAGTGTCTCACTGCCACCCAGG + Intronic
1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG + Intergenic
1033311926 7:140267883-140267905 ACACTTACTAACAGCCAGCCAGG + Intergenic
1034687578 7:152986504-152986526 AGAATTCATAACAGCCAGCTTGG - Intergenic
1035513119 8:207124-207146 AGTGTCCCTAGCTGCCAGCAGGG - Intergenic
1036432698 8:8704774-8704796 AGATTTCCTAACTGGCTTCCAGG + Intergenic
1037319079 8:17627124-17627146 ACAGTCAGTAACTGCCAGCCAGG - Intronic
1037330812 8:17741955-17741977 AGGGCTCCTAACTGCAGGCCAGG + Intronic
1037636097 8:20702085-20702107 ATAGTTCCTAAGTGCCAACTGGG + Intergenic
1043075156 8:75689848-75689870 AGAGTTGCTCTCTGTCAGCCAGG + Intergenic
1045753252 8:105511137-105511159 AGACTTCCTACATGCCAGTCTGG - Intronic
1049724828 8:144140895-144140917 AGAGCTCGTAGCAGCCAGCCTGG - Intergenic
1051135463 9:13915320-13915342 AGAGTTGAAAGCTGCCAGCCTGG + Intergenic
1052030620 9:23624345-23624367 AGAGTTTCTAACTGTCACTCAGG + Intergenic
1053118962 9:35530932-35530954 AAAGTTCCTTTCTACCAGCCAGG - Intronic
1055968263 9:81886516-81886538 AGGGGTCCTTAATGCCAGCCAGG + Intergenic
1056289751 9:85130998-85131020 ATGGTTCCTATGTGCCAGCCTGG - Intergenic
1057038056 9:91825976-91825998 AGAGTTCCTAAGAGCCAGAAAGG - Intronic
1060240122 9:121896326-121896348 AGAGTTCCCAACTGTGGGCCAGG + Intronic
1060297912 9:122355598-122355620 AGAGTTCCCAGGAGCCAGCCTGG - Intergenic
1062624281 9:137435902-137435924 AGAGCCCCTAAGAGCCAGCCTGG + Intronic
1062669452 9:137698593-137698615 AGGGGTCCTTCCTGCCAGCCTGG + Intronic
1186053393 X:5624091-5624113 AGATTTACTAACTGCCTGGCTGG + Intergenic
1187575306 X:20547676-20547698 GGAGTGGCTGACTGCCAGCCGGG + Intergenic
1193142806 X:78046314-78046336 AGAGTTATGAACTGCCTGCCCGG + Exonic
1194217961 X:91154659-91154681 AGAGATCCTAACTGACCCCCTGG + Intergenic
1200554466 Y:4618444-4618466 AGAGATCCTAACTGACCCCCTGG + Intergenic