ID: 1007593468

View in Genome Browser
Species Human (GRCh38)
Location 6:43037494-43037516
Sequence ATATGCCAAGGGTCTTGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007593468_1007593476 22 Left 1007593468 6:43037494-43037516 CCCTAACAAGACCCTTGGCATAT 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1007593476 6:43037539-43037561 GGGCTCCTTCTCCACCAGCAAGG 0: 1
1: 0
2: 2
3: 33
4: 289
1007593468_1007593473 2 Left 1007593468 6:43037494-43037516 CCCTAACAAGACCCTTGGCATAT 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1007593473 6:43037519-43037541 TGCGACAGCCTCAGTGCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 123
1007593468_1007593472 1 Left 1007593468 6:43037494-43037516 CCCTAACAAGACCCTTGGCATAT 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1007593472 6:43037518-43037540 ATGCGACAGCCTCAGTGCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007593468 Original CRISPR ATATGCCAAGGGTCTTGTTA GGG (reversed) Intergenic
903825796 1:26144852-26144874 ATGTGCCAAGGATGATGTTAAGG - Intergenic
904768410 1:32868020-32868042 ATATGCTCAGCGTCTTGTCAGGG + Intronic
907799307 1:57749058-57749080 AGAAGCCATTGGTCTTGTTATGG + Intronic
910625912 1:89306114-89306136 CTATGCCAATATTCTTGTTAAGG + Intergenic
910682101 1:89877121-89877143 ATATGACAAGGGTCTGCTTTAGG + Intronic
912730284 1:112096238-112096260 ATGTGCCAAGAATCATGTTAGGG + Intergenic
1067683881 10:48456071-48456093 AGATGCCAAGGCTCTCGTTTAGG - Intronic
1078630375 11:12997793-12997815 TTATGCCAAAGTTCTTATTAAGG - Intergenic
1080959619 11:37143123-37143145 AGATGCCAAGGTTCTTGTCATGG - Intergenic
1081321810 11:41700593-41700615 TTATGTCAAGGGCCTTGATATGG - Intergenic
1084399014 11:68932991-68933013 ATAACCCAAGGGTCTTATAAGGG - Intronic
1085426965 11:76413306-76413328 ATATGCCAGGTGTCATGTAAAGG + Intronic
1085736220 11:79041461-79041483 ATGTGCCAAGAGTTGTGTTAAGG - Intronic
1086798768 11:91144399-91144421 GAAGGCCAAGGTTCTTGTTATGG - Intergenic
1087273909 11:96141345-96141367 AGATGTCAAGGGTCCTGGTAGGG - Intronic
1087285400 11:96259896-96259918 ATATCCCAAGGCTTTTTTTAAGG - Intronic
1088980467 11:114858497-114858519 ATATGAGAAGGGGCTTATTAGGG + Intergenic
1089777210 11:120846670-120846692 GTAGGCCCAGGGTCTTGTTTTGG + Intronic
1090993851 11:131846971-131846993 AAAGGTCTAGGGTCTTGTTAAGG + Intronic
1094745936 12:33344531-33344553 ATATGCCCAGTGTATTGTTCTGG - Intergenic
1095735146 12:45548098-45548120 ATAAGCTAAGGGTCTTGAGATGG + Intergenic
1105598802 13:21866775-21866797 ATCTGCAAAGGGTCCTGTCATGG + Intergenic
1109906486 13:68847979-68848001 ATAAACCACAGGTCTTGTTATGG - Intergenic
1111406568 13:87814154-87814176 ATATGCTGAGGTTATTGTTATGG + Intergenic
1124925071 15:34063109-34063131 ATATGTCAAGGGTCTTGTGATGG - Exonic
1125285162 15:38084699-38084721 ATATGCCAAGGTTTGTGCTAGGG - Intergenic
1130100692 15:80891608-80891630 AAAAGCCAAAGGTCTTATTATGG - Intronic
1131962804 15:97807299-97807321 ATTTGCCAAGGGTCTCCTTTGGG + Intergenic
1141041310 16:80675137-80675159 AGATGCCAAGGGCATTGTTCTGG - Intronic
1141793312 16:86251333-86251355 CTATGCCAGGGACCTTGTTAAGG - Intergenic
1142172843 16:88631878-88631900 AAAGGCCAAGGGTGTTGTTGGGG + Exonic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1149187351 17:54015155-54015177 ATAAATCAAGGGTCTTGATATGG + Intergenic
1155123125 18:22842954-22842976 ATAGGCCAAGGGTCTTAATCTGG - Intronic
1155724374 18:29061037-29061059 ATGTGCCAAGTGTCTGGTGAGGG - Intergenic
1157719069 18:49909601-49909623 AAATGACAAGGGTCCTGTTGTGG - Intronic
928279656 2:29934401-29934423 AAATGCCAAGGGTTTGGTGAAGG - Intergenic
930107865 2:47654231-47654253 CTATGCCAAAGGTCATGTTGAGG + Intergenic
930715632 2:54591685-54591707 ATATGCCACAGTTCTGGTTATGG - Intronic
930899570 2:56487358-56487380 ATAGGCCAACTCTCTTGTTAGGG + Intergenic
935174032 2:100632340-100632362 ATATGCCAATGGTCTTCTCAGGG + Intergenic
936275195 2:111090181-111090203 ATATGCCTAGGGTCTGGTAAAGG - Intronic
937494035 2:122399265-122399287 GTATGCCCAGGTTCTTGTTTGGG - Intergenic
937963845 2:127485727-127485749 ATATCCCAAGGTGCCTGTTAGGG + Intronic
941513252 2:166439858-166439880 GTATGACAAGGGTCTTCTCAAGG + Intronic
942315599 2:174693900-174693922 ATAAGCCCAGTTTCTTGTTAAGG + Intergenic
946728729 2:222688145-222688167 ATATGCCAAGCATCGTGTTATGG - Intronic
947468652 2:230379413-230379435 AGATGACAAGGATCTTGTAATGG + Intronic
1169658128 20:7948858-7948880 ATGTGCAATGGGTCTTGTGAAGG + Intergenic
1170425278 20:16229045-16229067 TTATGCAAAGTGTCCTGTTAGGG - Intergenic
1170506276 20:17028989-17029011 ATCTGCCGAGGGTCCTGGTAAGG + Intergenic
1170642765 20:18170311-18170333 ACAAGCCAACTGTCTTGTTAGGG + Intronic
1177787166 21:25683454-25683476 ATATGACATGGGTATTGTCAAGG + Intronic
1180622917 22:17173698-17173720 ATATTTGAAGGGTCTTCTTAAGG + Intergenic
951639937 3:24825957-24825979 ATCTGCCCAAGGTCTCGTTAAGG - Intergenic
951787029 3:26433094-26433116 ATATTCCCAAGGTCTTGTAAGGG + Intergenic
955069524 3:55560542-55560564 ACATGCCAAGGGCCTTGGTGGGG - Intronic
960526279 3:118714804-118714826 ATATGACAAGGGATTTATTAGGG + Intergenic
964809208 3:160644559-160644581 AAATGGCAAGGGACTTGTTAAGG + Intergenic
967283846 3:187849774-187849796 ATATTCCAGGCATCTTGTTAAGG + Intergenic
972199590 4:36698492-36698514 CTTTGCCTAGGGGCTTGTTATGG - Intergenic
973000091 4:44937150-44937172 ATATGCCAAGTGCCTAGATAGGG - Intergenic
976017978 4:80582855-80582877 ATCTGCCATGAGTCTTGATATGG + Intronic
977662809 4:99610311-99610333 ATATTCAAAGGGTCTTCTTGTGG - Intronic
978821506 4:112972033-112972055 TTCTGCCAAGGGTAGTGTTAAGG + Intronic
980254973 4:130367818-130367840 ATATACCAAGAGTATTTTTAAGG - Intergenic
981415708 4:144490684-144490706 ACATGCCAAGCTTCTTGTTTTGG - Intergenic
983421355 4:167521744-167521766 ATATGCCAATGGTTTTCATAAGG - Intergenic
984041537 4:174740427-174740449 ATATGCCTAGTGTCTTGGTGAGG - Intronic
984666941 4:182439346-182439368 ATGTGCTTAGGGTCTTGCTAGGG - Intronic
986207419 5:5638124-5638146 ATGTGCCAAGGATCCTTTTAGGG + Intergenic
991566910 5:68014821-68014843 ATATGCCAGGGGCCTTGCTTGGG + Intergenic
995868597 5:116720182-116720204 ATATGCCAAGTCTCCTGCTATGG + Intergenic
996518956 5:124405127-124405149 ATATGCCACGTTTCTTCTTAGGG + Intergenic
996575611 5:124973942-124973964 ATATGACACGGGTCTTTATAAGG + Intergenic
996582043 5:125041944-125041966 ATATGCCATGCTTCTTGTTGGGG + Intergenic
999589929 5:153133728-153133750 ATATGCCAATGATTTAGTTAAGG - Intergenic
1004700503 6:18074842-18074864 AAATGCCAATGATCTTTTTATGG - Intergenic
1006257293 6:32842027-32842049 ATATGCCATGCATCTTGTCAGGG + Intronic
1007593468 6:43037494-43037516 ATATGCCAAGGGTCTTGTTAGGG - Intergenic
1008523318 6:52383327-52383349 TCTTGCCAAGGGTCATGTTAAGG - Intronic
1009383761 6:63064279-63064301 AAATGCCATGGTTCTTGTTATGG - Intergenic
1014018430 6:116561827-116561849 ATGTGCCAAGGGTCACGTAAGGG + Intergenic
1015398379 6:132760513-132760535 ATTTGCCTATGGTCTTCTTAAGG - Intronic
1016829380 6:148418350-148418372 ATGTGTCAAGGGTTTTGTCAGGG - Intronic
1019004642 6:168786057-168786079 AGATGCCATGAGTCTTGTTCTGG - Intergenic
1021235152 7:18134194-18134216 AAATACCAAGGCTCTTGCTAAGG - Intronic
1023664765 7:42511621-42511643 ATATTCCAAGGATCTTGGTGTGG - Intergenic
1028015459 7:85705572-85705594 ATTTGCCAAAGGTCATGGTAGGG + Intergenic
1029897957 7:104006289-104006311 ATATGCCAAGCATCGTGCTAGGG + Intergenic
1030249881 7:107430807-107430829 ATATGCCATGGGTCTTGAGATGG + Intronic
1030869963 7:114743621-114743643 ATATGCCAAGGAGCTTTTTAAGG + Intergenic
1034148378 7:148892429-148892451 GTATGACAAGTGTTTTGTTAGGG - Intergenic
1035486407 7:159229645-159229667 AGCTGTCAGGGGTCTTGTTAAGG + Intergenic
1041860364 8:62506140-62506162 TTAAGCTAAGGATCTTGTTATGG - Intronic
1042267211 8:66921211-66921233 ATATGCCAACGGTATTTTAAAGG + Exonic
1045032176 8:98147629-98147651 ATATTTCAAGGGTCTTTTTAAGG - Intronic
1048843923 8:138588844-138588866 ATTTGCCAAGTGTCTGGTCAGGG + Exonic
1050449032 9:5760207-5760229 ATCTGCCAGGGGTTTTTTTAGGG + Intronic
1051501716 9:17785243-17785265 ATATGCCAAGTGCCTTGATGGGG - Intronic
1051810926 9:21048853-21048875 ATATGGGAAGGGGCTTATTAGGG + Intergenic
1058811381 9:108642902-108642924 AGATGCCAAGGATTTTATTAGGG - Intergenic
1059915683 9:119096956-119096978 AAATGCTAAGGGACTTGTTTAGG - Intergenic
1186232805 X:7474011-7474033 ATATGTCAGGGGTATTGTTAGGG + Intergenic
1188970247 X:36606421-36606443 AAATGCCAAGGGTCATATTTTGG + Intergenic
1189181592 X:39009603-39009625 ATATGCCAAGGTTACTCTTAGGG - Intergenic
1193704326 X:84802587-84802609 ACATGCTAAGAGACTTGTTATGG + Intergenic
1195533599 X:105984974-105984996 ATATAACAAGGGTCTTATAAAGG - Intergenic
1199449710 X:147965800-147965822 AAAGGCCAAGGGTGTTGTGAAGG + Intergenic