ID: 1007593592

View in Genome Browser
Species Human (GRCh38)
Location 6:43038082-43038104
Sequence CTGTCCTAGCAGCTGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007593592_1007593597 -3 Left 1007593592 6:43038082-43038104 CCAACCACCAGCTGCTAGGACAG 0: 1
1: 0
2: 2
3: 17
4: 213
Right 1007593597 6:43038102-43038124 CAGGATGCCCCAAGGACACGAGG 0: 1
1: 0
2: 0
3: 18
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007593592 Original CRISPR CTGTCCTAGCAGCTGGTGGT TGG (reversed) Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900565318 1:3329154-3329176 CTGTCCCAGCAGTTGTAGGTAGG + Intronic
900987593 1:6082152-6082174 CTGTCCTGCCAGCCGGGGGTGGG - Intronic
902820067 1:18938323-18938345 CCTTCCCAGCAGCTGGAGGTGGG - Intronic
903244475 1:22005669-22005691 CTGACCTACCAGGTGGTGTTGGG + Exonic
904520883 1:31094863-31094885 CTGTTCTCGCAGCTGCTGTTGGG - Intergenic
906707480 1:47905338-47905360 CCGTCCTGGCAGCTGGGGATGGG + Intronic
907437680 1:54459875-54459897 CTGTCCCAGCCCCTGGGGGTGGG + Intergenic
908027394 1:59967440-59967462 CTGTCCCTGCTGCTTGTGGTAGG - Intergenic
908390694 1:63680995-63681017 CTCTCCTAGCTCCTGGGGGTTGG - Intergenic
911386746 1:97185366-97185388 CAGTCCTACCAGCTGTGGGTGGG - Intronic
911749781 1:101482765-101482787 CTGTGCAAGCAGCAAGTGGTGGG + Intergenic
916267192 1:162902626-162902648 CTCTCCTAGCTCCTGGTGCTTGG + Intergenic
918000812 1:180493392-180493414 CTGTCCTGGCAGCCTGTTGTGGG - Intronic
918030607 1:180804974-180804996 CTTTCCTAGCAGCTTTTGTTCGG + Intronic
919987371 1:202685303-202685325 CTGGAATAGCAGGTGGTGGTGGG - Intronic
921583134 1:216918158-216918180 CTGTCCCAGAAGCTGATGTTTGG - Intronic
924784215 1:247180365-247180387 CAGCCCTAGCATCTTGTGGTAGG + Intergenic
1063009838 10:2011415-2011437 CTTTGATAACAGCTGGTGGTTGG + Intergenic
1063638558 10:7809155-7809177 CTCTCCTAGAAACTGGAGGTGGG - Intergenic
1063642332 10:7842280-7842302 CTGTGATCCCAGCTGGTGGTAGG - Intronic
1065288878 10:24210474-24210496 CTGTCCTAGAAAATGGGGGTGGG - Intronic
1067227623 10:44386022-44386044 CTGTCCTAGGAGTCGGAGGTCGG - Intronic
1067440535 10:46306955-46306977 CTGTCCCAGCAGGGGGTGGGGGG - Intronic
1070799648 10:79237816-79237838 CTTTCCTAGGACCTGGTGTTAGG + Intronic
1072324795 10:94287549-94287571 CTGACCTAGCTTCTGATGGTGGG - Intronic
1073028256 10:100504410-100504432 ATGTCCTTGCAGCTGGTCGGAGG - Intronic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1078741197 11:14067722-14067744 CCTTCCTTGCTGCTGGTGGTAGG - Intronic
1080596760 11:33780026-33780048 CAGTTCTAGCAGCTGGAGGGAGG - Intergenic
1080710568 11:34743310-34743332 CTCTCCTAGCTTCTGGTGCTTGG - Intergenic
1080751967 11:35158951-35158973 CTGTCCTGGCAGTGGGTGGTGGG + Intronic
1081216276 11:40402862-40402884 TTGTCCTAATAGCTGGTTGTGGG + Intronic
1083470345 11:62880136-62880158 AGGTGCTAGCAGCTGGGGGTGGG + Intronic
1083540001 11:63505989-63506011 CTGTCCAGGGAGCTGGGGGTGGG + Intergenic
1083826407 11:65206452-65206474 CTGGCCCACCAGCTGGTGGGAGG - Exonic
1083961906 11:66019225-66019247 CTGTCCTTGAAGCTGGGGGGTGG - Intronic
1084036463 11:66514394-66514416 CTCTCCCTGCAGCTGGTGGTAGG + Exonic
1084114013 11:67031353-67031375 GAGTCCTGGCACCTGGTGGTGGG + Intronic
1084243405 11:67838232-67838254 CTGACTGATCAGCTGGTGGTGGG + Intergenic
1084549579 11:69833153-69833175 CTGTCCCAGCTGCTGGTGCACGG + Intergenic
1084658138 11:70531322-70531344 CTGTGCTGGGGGCTGGTGGTGGG + Intronic
1086009525 11:82083326-82083348 CTGGCTTAGCATGTGGTGGTAGG + Intergenic
1087004260 11:93453657-93453679 CTCTCCCAGCTGCTGGTGGTTGG - Intergenic
1088561575 11:111120856-111120878 CTGTCCTTGGAGCTGGAGGGTGG - Intergenic
1089581788 11:119485938-119485960 CTGTCCTCGCTGCTGGTAGAGGG + Intergenic
1089721276 11:120425202-120425224 CTTTGCTAGCAGGTGGTGATGGG + Intronic
1090271177 11:125387425-125387447 CTCACCTGGCAGGTGGTGGTGGG - Intronic
1091782882 12:3224998-3225020 CTGTGTGTGCAGCTGGTGGTGGG + Intronic
1093885386 12:24453683-24453705 CTTTCCTAGCTGCTGGATGTAGG - Intergenic
1095641311 12:44488553-44488575 CTGCTCTAGCAGATGGTGGAGGG - Intergenic
1096555477 12:52400990-52401012 CTGCCCGAGCAGCTGGAGATGGG - Intronic
1098295903 12:69003967-69003989 CTCTCCTAGCTTCTGGTGGTTGG - Intergenic
1100964957 12:100002503-100002525 CTTGCCTTGCAGCTGGGGGTGGG - Intergenic
1101437884 12:104679649-104679671 CTGTCCCTGCAGCTGGGGCTCGG - Intronic
1102440959 12:112963534-112963556 CACTCCTAGCAGCTGGGGATGGG - Intronic
1102562057 12:113769394-113769416 CTGTCCTTGCAGCTGGCCCTGGG - Intergenic
1103713553 12:122930022-122930044 CTGGGCCAGCAGCTGCTGGTGGG + Exonic
1104559964 12:129834545-129834567 CAGTGCTAGCAGCTGGTGCATGG - Intronic
1105892297 13:24690377-24690399 CCTTCAGAGCAGCTGGTGGTGGG + Exonic
1106434340 13:29710538-29710560 CTGTCCTGGGAGCTGGATGTTGG + Intergenic
1107682282 13:42864533-42864555 CTCTCCTGGGAGATGGTGGTGGG - Intergenic
1108432399 13:50367435-50367457 CTCTCCTGGCTTCTGGTGGTTGG - Intronic
1108493163 13:51001032-51001054 CTGCCCTGGCAGAAGGTGGTTGG + Intergenic
1110234963 13:73207434-73207456 CTGTCTTAGCAACTTGTGGGTGG - Intergenic
1111845297 13:93500124-93500146 CTGTCCTATCTGCTCGTGGTGGG - Intronic
1112822746 13:103355432-103355454 CTCTTGTAGCTGCTGGTGGTTGG - Intergenic
1117012497 14:51485167-51485189 CTTCTCTAGAAGCTGGTGGTTGG - Intergenic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118524577 14:66624529-66624551 CTGTCCTTGGAGCTGGAGGGTGG - Intronic
1119483648 14:74974916-74974938 TTGCCATAACAGCTGGTGGTTGG - Intergenic
1120219672 14:81718143-81718165 CTGTGCTAGGCACTGGTGGTGGG + Intergenic
1120286686 14:82511442-82511464 CTGTTCAACCAACTGGTGGTGGG - Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120813712 14:88831179-88831201 CTGTCATGGCAGCTGGTGGGAGG - Intronic
1121775468 14:96587731-96587753 CAGCCCTATCAGCTGGTGGGGGG + Intergenic
1122535068 14:102456204-102456226 CTTTGTTAGCTGCTGGTGGTGGG + Intronic
1123491099 15:20783437-20783459 CTGTCCGTGCTGCTGGTGGCGGG - Intergenic
1123547601 15:21352528-21352550 CTGTCCGTGCTGCTGGTGGCGGG - Intergenic
1127152602 15:56093624-56093646 CTGACCTACCAGCTGCTGGTTGG + Exonic
1129515097 15:76152473-76152495 CTGCCCTAGCTGGTGGTGGGTGG + Intronic
1202955931 15_KI270727v1_random:79758-79780 CTGTCCGTGCTGCTGGTGGCGGG - Intergenic
1132591989 16:730106-730128 CTGCCCTTGCTGCTGCTGGTCGG - Exonic
1132702555 16:1228383-1228405 CTGCCCAGGCAGCTGGTGGTGGG - Exonic
1132775677 16:1592598-1592620 CTGTCCTAACACGTGGTGTTGGG - Intronic
1133236559 16:4389913-4389935 CTGTGCTAGGAGCTGGCAGTGGG + Intronic
1133712634 16:8415987-8416009 CTGTTGTCGCAGCTGGTGGATGG - Intergenic
1135380229 16:21989893-21989915 ATGACCTAGCTGCTGGAGGTGGG - Intronic
1135544427 16:23356163-23356185 CACTTCTAGCAGCTGGGGGTGGG + Intronic
1141307723 16:82881897-82881919 CTGCCACAGAAGCTGGTGGTGGG - Intronic
1143016782 17:3895054-3895076 GTGTCCTAGGAGCTGCTGGAAGG + Intergenic
1144590736 17:16521437-16521459 CTGTCCTGCCATCTAGTGGTGGG + Intergenic
1146626250 17:34437622-34437644 CTTTCCTAGGAGCTGGTCTTAGG + Intergenic
1147378073 17:40034862-40034884 CTGTGCTAGGTGCTGGGGGTGGG - Intronic
1148328158 17:46796048-46796070 CTGTCCCATCCGCAGGTGGTAGG + Intronic
1149504591 17:57183707-57183729 ATGTCCTAGGAGCAGGTGCTTGG - Intergenic
1151479123 17:74360064-74360086 CAGTCCCAGCAGCAGGCGGTGGG + Exonic
1153336666 18:3932221-3932243 TTGTCCTGGCAGCTTGAGGTTGG + Intronic
1154448697 18:14458126-14458148 CTGTCCACGCTGCTGGTGGCGGG - Intergenic
1155804116 18:30144552-30144574 ATGTCCTAGCACATAGTGGTTGG + Intergenic
1156564151 18:38164508-38164530 CTGTCTCAGGAGGTGGTGGTGGG + Intergenic
1157028513 18:43876386-43876408 GTCTCCCATCAGCTGGTGGTTGG - Intergenic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158103085 18:53853032-53853054 CTATCCTGGCAGCTGGGGGATGG - Intergenic
1160371710 18:78377759-78377781 GTGTCCTGGGTGCTGGTGGTTGG + Intergenic
1161084800 19:2329939-2329961 CTGACAGAGCAGCTGGGGGTAGG - Intronic
1161457098 19:4374946-4374968 CTGTCCCAGCACATGGTGGCAGG + Intronic
1163414702 19:17179143-17179165 CTCTCCTGGCATCTGGTGGGTGG - Intronic
1164916209 19:32054170-32054192 CTGTCCCTGGAGCTGGGGGTGGG - Intergenic
1166060093 19:40320680-40320702 CTGTCCTAGGAGCTGGTAGCAGG - Exonic
1166831679 19:45643255-45643277 CTGTCCTTGCAGCTGGCTCTAGG - Intronic
1166885884 19:45960819-45960841 CTGGCCGAGCAGATGGGGGTGGG - Intronic
1167594475 19:50419776-50419798 CTGTCCCAGCAGGGGGTAGTGGG + Intronic
1167869501 19:52355970-52355992 CTCTCCTAGAAGCTAGTGGGTGG + Intronic
925990742 2:9252169-9252191 CAGTCCTAGCAGCTGGTGTCAGG - Intronic
926853656 2:17228563-17228585 CTGTGGAAGCAGCTGCTGGTTGG - Intergenic
927846775 2:26476306-26476328 CTTCCCTGGCAGCTGGGGGTGGG + Exonic
928085044 2:28340669-28340691 CACTTCTAGCAGATGGTGGTTGG + Intergenic
928632754 2:33210760-33210782 CTTTTCTCCCAGCTGGTGGTTGG + Intronic
930773742 2:55152862-55152884 TTTACCAAGCAGCTGGTGGTTGG - Intergenic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
933698653 2:85238566-85238588 CTGTCCTAGGAGCTGAGGATGGG + Intronic
934541167 2:95176242-95176264 CTCACCTGGCATCTGGTGGTCGG - Exonic
937201325 2:120206218-120206240 TTGTCCTAGCAGCCAGGGGTTGG + Intergenic
941394893 2:164962238-164962260 CTTTCCTAGCTTCTTGTGGTTGG + Intergenic
941725079 2:168851971-168851993 CAGTCCTCGCTGCTGTTGGTTGG + Intronic
943018128 2:182539339-182539361 TTGACCTAGCAGCTAGTGGGAGG - Intergenic
944535554 2:200705964-200705986 AGGTGCTTGCAGCTGGTGGTGGG - Intergenic
945344195 2:208693560-208693582 CTGACATACCAGCTGGGGGTAGG - Intronic
946951995 2:224886340-224886362 CTGTAGTAGCTGTTGGTGGTAGG - Intronic
1169804871 20:9549234-9549256 CACTCCAAGCAGATGGTGGTGGG + Intronic
1170893427 20:20394750-20394772 ATCCCCTCGCAGCTGGTGGTGGG + Intronic
1171078129 20:22149731-22149753 CTGTCATAGCATCTGGTGTCTGG - Intergenic
1171487072 20:25493048-25493070 CTGTCCTGGAACCTGGTGGAGGG - Intronic
1172842406 20:37909842-37909864 CTCTCCTAGCTGCTGGTCCTGGG + Intronic
1172885280 20:38226915-38226937 CAATCCTAGCAGCTCCTGGTGGG - Intronic
1175802170 20:61807121-61807143 CTGGCCTTGCAGCTGGGGGCTGG - Intronic
1175979060 20:62727950-62727972 CTGTCACAGCAGATGGTGCTGGG + Intronic
1176447531 21:6832396-6832418 CTGTCGACGCTGCTGGTGGTGGG + Intergenic
1176825700 21:13697422-13697444 CTGTCGACGCTGCTGGTGGTGGG + Intergenic
1176934037 21:14845964-14845986 CTGTACTAGCAGCTGGGAGGGGG - Intergenic
1178556813 21:33599145-33599167 TTGTCCTAGATGCTGGAGGTAGG - Exonic
1179551376 21:42146083-42146105 CAGCCCTAGGAGCTGGTGCTGGG + Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1181787175 22:25235817-25235839 CTCTCCTAGCCTCTGGTGGGTGG - Intergenic
1181819168 22:25462426-25462448 CTCTCCTAGCTTCTGGTGGGTGG - Intergenic
1181958617 22:26606708-26606730 ATGTCAAAACAGCTGGTGGTTGG + Intronic
1183265570 22:36823202-36823224 CTGGCCTCCCAGCTGGTGGAGGG + Intergenic
1183335626 22:37244337-37244359 CTGGCAGAGCAGCTGGTGGGAGG + Intronic
1183440156 22:37818410-37818432 GTGCCCTAGCCGGTGGTGGTGGG - Intergenic
1183531046 22:38353511-38353533 GTGTCCTTGGAGCAGGTGGTCGG + Intronic
1184458756 22:44625623-44625645 CTGCCATAGGAGCTGGGGGTTGG - Intergenic
1185165135 22:49256943-49256965 CTGTGCTGGCATCTGGTGGGAGG - Intergenic
953885306 3:46711624-46711646 CAGGCCTGGCTGCTGGTGGTTGG + Intergenic
954580597 3:51700925-51700947 CTGACACAGCAGTTGGTGGTGGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955327984 3:58024364-58024386 CAGTCCTTGGAGGTGGTGGTGGG + Intronic
957058973 3:75466203-75466225 CTGACTGATCAGCTGGTGGTGGG + Intergenic
957241113 3:77662280-77662302 TTGTCCTGGCAACTGGTGGTGGG - Intergenic
958177995 3:90021606-90021628 CAATCCTAGCAGCTGGGGGATGG + Intergenic
959906465 3:111716308-111716330 CTGTCCTAACAACTGGTCGCTGG + Intronic
961294473 3:125873528-125873550 CTGACTGATCAGCTGGTGGTGGG - Intergenic
962360608 3:134739903-134739925 CTGTCATAGCAGGAGGTGATGGG - Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
963932735 3:151020986-151021008 CTGTCCTTGCTCCTGGTGGATGG - Intergenic
965555675 3:170015927-170015949 GTTTGCTAGCAGCTGGTGGGAGG - Intergenic
968572525 4:1349550-1349572 CTGTGCTATCAGCAGGCGGTAGG - Exonic
969371226 4:6732796-6732818 CTGTTCTTGCAGCTGGGCGTGGG + Intergenic
972799386 4:42458327-42458349 CTGTCCCAGCAAGTGGTGCTGGG - Intronic
972867915 4:43257061-43257083 CTCACCTAGCTGCAGGTGGTGGG - Intergenic
977337870 4:95720917-95720939 CTCTCCCAGCTTCTGGTGGTTGG - Intergenic
981151626 4:141385226-141385248 CTCTCCTAGCTTCTGGTGGTTGG - Intergenic
983454580 4:167946659-167946681 CTCTTCTAGCTTCTGGTGGTTGG + Intergenic
984442326 4:179787988-179788010 TTGTCTGAGCTGCTGGTGGTGGG + Intergenic
985390458 4:189487220-189487242 CTGGGCTAGCAGCATGTGGTAGG + Intergenic
988559089 5:32264131-32264153 TTGTCCTAGCAGGTAGTGGCAGG - Intronic
988800597 5:34692955-34692977 CTGACCTAGATTCTGGTGGTTGG + Intronic
991957556 5:72010828-72010850 TTCTACTGGCAGCTGGTGGTTGG + Intergenic
993844409 5:92922690-92922712 CTAGCCTAGGAGCTGCTGGTGGG - Intergenic
999076354 5:148799446-148799468 TTCTCCTAGCTACTGGTGGTTGG - Intergenic
999368531 5:151038688-151038710 CTGTCTTCCCATCTGGTGGTGGG - Intronic
1000639008 5:163678808-163678830 CTAGCCTAGCAGCAGGAGGTAGG + Intergenic
1002195431 5:177498368-177498390 CTGTCCTAGGAGGAGGTGATGGG - Intergenic
1002580448 5:180207171-180207193 CTGACCTAGCAGGTTTTGGTTGG + Intronic
1002869130 6:1149832-1149854 CTGTCCTAGGACATGGTTGTGGG + Intergenic
1003199311 6:3944261-3944283 CTGTCCTCTCAGTTGGTGGCAGG + Intergenic
1003440282 6:6134533-6134555 CTTTGCTAGCTGCTGGTGGGAGG - Intergenic
1005984404 6:30861990-30862012 AGGTCCTAGCAGCTGGTAGCAGG + Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1012146272 6:95686970-95686992 CTTTCCTAGCAGCTGGTCCTGGG + Intergenic
1013422543 6:109979278-109979300 CTGTCCTCGCAGCTGTCGGCTGG + Exonic
1015417793 6:132969407-132969429 CTGTCTTAGCATCTGGTGGTTGG + Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020321835 7:6944541-6944563 CTGACTGATCAGCTGGTGGTGGG + Intergenic
1020776141 7:12456652-12456674 CTGTCCCAGAATCTGGGGGTGGG - Intergenic
1024063038 7:45713223-45713245 CTGTTCTAGCATCTGGAGCTGGG + Intronic
1025753373 7:64312300-64312322 CTGTGCTATCAGGTGGTGATGGG + Intronic
1028221746 7:88204829-88204851 GTGTCCTAGCACCTGCTGTTTGG - Intergenic
1029110808 7:98212274-98212296 CTGTCCTAGGAGGTGGCGGCAGG - Exonic
1029916848 7:104218941-104218963 CTCTCCTAGCTTCTGGTGGAGGG - Intergenic
1030523401 7:110625841-110625863 TTTTCCTAGCTACTGGTGGTGGG - Intergenic
1034338399 7:150337800-150337822 CTGTCCTTGCAGCATGTGGAGGG - Exonic
1035437699 7:158871488-158871510 CTGGCCCAGCAGGTTGTGGTGGG - Exonic
1038321080 8:26528140-26528162 CTGTTCTAGCAGCTGATGCCAGG - Intronic
1038425262 8:27460517-27460539 CTGTGCTAGGTGCTGGGGGTGGG + Exonic
1041507807 8:58620701-58620723 CTGTTCTAGGAGCTGGTTGGTGG + Intronic
1041883409 8:62779157-62779179 CTGTACTAGCTGGTGTTGGTGGG + Intronic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1046002211 8:108434536-108434558 CTGTAGTAGCAGCTACTGGTGGG + Intronic
1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047163220 8:122405245-122405267 CTGTCTTTCTAGCTGGTGGTTGG + Intergenic
1048740593 8:137554805-137554827 CTTCCCTAGCTGCTGGTGATTGG - Intergenic
1051118619 9:13727296-13727318 TTTTCCTAGCTTCTGGTGGTGGG - Intergenic
1054723826 9:68630264-68630286 CTATCATAGCATCTGGTGATGGG + Intergenic
1056828253 9:89891500-89891522 CTGTTCTATCAGCTTGTGGGAGG + Intergenic
1056879833 9:90380529-90380551 CTGTCCCATCAGCTGGGGGTGGG - Intergenic
1056958389 9:91101035-91101057 CTGTCCCAGCAGCACGGGGTGGG + Intergenic
1057195358 9:93113375-93113397 CTGTGCCAGCAGCTGGATGTGGG - Intergenic
1059925884 9:119208721-119208743 CTCTCTAGGCAGCTGGTGGTTGG + Exonic
1061071553 9:128313948-128313970 CTGCCCCAGAAGCTGGGGGTGGG + Intronic
1061631568 9:131875356-131875378 CTGTCATAGCAGCTGGGTCTTGG + Intronic
1062019410 9:134309488-134309510 GTGTCCTAGCAGTGGATGGTTGG + Intergenic
1203521660 Un_GL000213v1:52135-52157 CTGTCGACGCTGCTGGTGGTGGG - Intergenic
1189149875 X:38695585-38695607 CTGTCTCAGCACCTGGTAGTTGG + Intergenic
1190062344 X:47219282-47219304 CTGTCCTGGGAGCTGGGGTTGGG + Intronic
1190530245 X:51367844-51367866 GTGTCCTTGCTGGTGGTGGTGGG - Intergenic
1191652921 X:63561003-63561025 CTGTGCTTCCAGCGGGTGGTGGG - Intergenic
1194063498 X:89234155-89234177 CTGTTCTAGGTGCTGGTGATTGG - Intergenic
1196048245 X:111278680-111278702 CTTTGCTAGCAGGTGGTGGCTGG + Intergenic
1200070412 X:153526295-153526317 CTGGAGGAGCAGCTGGTGGTGGG + Intronic
1201448507 Y:14084095-14084117 CTGACCTATCAGCTGGGGTTGGG + Intergenic