ID: 1007599876

View in Genome Browser
Species Human (GRCh38)
Location 6:43075238-43075260
Sequence TCATCTCCAGCAGGGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007599870_1007599876 1 Left 1007599870 6:43075214-43075236 CCTCTCTTCCTCCCGTTGTTTGT 0: 1
1: 0
2: 0
3: 29
4: 470
Right 1007599876 6:43075238-43075260 TCATCTCCAGCAGGGCCTGTAGG 0: 1
1: 0
2: 4
3: 35
4: 290
1007599872_1007599876 -10 Left 1007599872 6:43075225-43075247 CCCGTTGTTTGTATCATCTCCAG 0: 1
1: 0
2: 5
3: 63
4: 669
Right 1007599876 6:43075238-43075260 TCATCTCCAGCAGGGCCTGTAGG 0: 1
1: 0
2: 4
3: 35
4: 290
1007599871_1007599876 -7 Left 1007599871 6:43075222-43075244 CCTCCCGTTGTTTGTATCATCTC 0: 1
1: 0
2: 3
3: 7
4: 112
Right 1007599876 6:43075238-43075260 TCATCTCCAGCAGGGCCTGTAGG 0: 1
1: 0
2: 4
3: 35
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007599876 Original CRISPR TCATCTCCAGCAGGGCCTGT AGG Intergenic