ID: 1007600152

View in Genome Browser
Species Human (GRCh38)
Location 6:43076331-43076353
Sequence CGTCCCGAGGCGTCCCGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007600152_1007600162 14 Left 1007600152 6:43076331-43076353 CCGGCTCGGGACGCCTCGGGACG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1007600162 6:43076368-43076390 TCCGGCTGCGGCTGCTGCTGCGG 0: 1
1: 1
2: 22
3: 192
4: 810
1007600152_1007600161 2 Left 1007600152 6:43076331-43076353 CCGGCTCGGGACGCCTCGGGACG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1007600161 6:43076356-43076378 TCGGGGTCGGGCTCCGGCTGCGG 0: 1
1: 0
2: 12
3: 65
4: 267
1007600152_1007600159 -4 Left 1007600152 6:43076331-43076353 CCGGCTCGGGACGCCTCGGGACG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1007600159 6:43076350-43076372 GACGCCTCGGGGTCGGGCTCCGG 0: 1
1: 0
2: 0
3: 12
4: 116
1007600152_1007600158 -10 Left 1007600152 6:43076331-43076353 CCGGCTCGGGACGCCTCGGGACG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1007600158 6:43076344-43076366 CCTCGGGACGCCTCGGGGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 80
1007600152_1007600164 28 Left 1007600152 6:43076331-43076353 CCGGCTCGGGACGCCTCGGGACG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1007600164 6:43076382-43076404 CTGCTGCGGCGCCCGCGCTCCGG 0: 1
1: 0
2: 2
3: 23
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007600152 Original CRISPR CGTCCCGAGGCGTCCCGAGC CGG (reversed) Intronic