ID: 1007600173

View in Genome Browser
Species Human (GRCh38)
Location 6:43076424-43076446
Sequence GCGCAGACTGCGCTCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007600173_1007600181 23 Left 1007600173 6:43076424-43076446 CCGCCGCGGAGCGCAGTCTGCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1007600181 6:43076470-43076492 TTTTCCTGAGCCCGCCGCGATGG 0: 1
1: 0
2: 0
3: 4
4: 40
1007600173_1007600182 24 Left 1007600173 6:43076424-43076446 CCGCCGCGGAGCGCAGTCTGCGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1007600182 6:43076471-43076493 TTTCCTGAGCCCGCCGCGATGGG 0: 1
1: 0
2: 0
3: 1
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007600173 Original CRISPR GCGCAGACTGCGCTCCGCGG CGG (reversed) Intronic