ID: 1007603204

View in Genome Browser
Species Human (GRCh38)
Location 6:43096700-43096722
Sequence GCAGGTGCCCAGGCTAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007603204_1007603210 10 Left 1007603204 6:43096700-43096722 CCTGGGCTAGCCTGGGCACCTGC No data
Right 1007603210 6:43096733-43096755 GGCCAGCCTGCCTGCCTGTCCGG 0: 1
1: 0
2: 7
3: 85
4: 489
1007603204_1007603218 30 Left 1007603204 6:43096700-43096722 CCTGGGCTAGCCTGGGCACCTGC No data
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603204_1007603212 14 Left 1007603204 6:43096700-43096722 CCTGGGCTAGCCTGGGCACCTGC No data
Right 1007603212 6:43096737-43096759 AGCCTGCCTGCCTGTCCGGTAGG 0: 1
1: 0
2: 3
3: 20
4: 233
1007603204_1007603213 15 Left 1007603204 6:43096700-43096722 CCTGGGCTAGCCTGGGCACCTGC No data
Right 1007603213 6:43096738-43096760 GCCTGCCTGCCTGTCCGGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007603204 Original CRISPR GCAGGTGCCCAGGCTAGCCC AGG (reversed) Intronic