ID: 1007603209

View in Genome Browser
Species Human (GRCh38)
Location 6:43096718-43096740
Sequence GGCTGGCCCAGCACAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 346}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007603209_1007603210 -8 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603210 6:43096733-43096755 GGCCAGCCTGCCTGCCTGTCCGG 0: 1
1: 0
2: 7
3: 85
4: 489
1007603209_1007603212 -4 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603212 6:43096737-43096759 AGCCTGCCTGCCTGTCCGGTAGG 0: 1
1: 0
2: 3
3: 20
4: 233
1007603209_1007603223 28 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603223 6:43096769-43096791 GAGCTGGGCTGTCAGCAAGCTGG No data
1007603209_1007603213 -3 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603213 6:43096738-43096760 GCCTGCCTGCCTGTCCGGTAGGG 0: 1
1: 0
2: 1
3: 19
4: 519
1007603209_1007603218 12 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603209_1007603219 13 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603219 6:43096754-43096776 GGTAGGGCCCTGCCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007603209 Original CRISPR GGCTGGCCCAGCACAGCCGC AGG (reversed) Intronic