ID: 1007603211

View in Genome Browser
Species Human (GRCh38)
Location 6:43096735-43096757
Sequence TACCGGACAGGCAGGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 934}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007603211_1007603218 -5 Left 1007603211 6:43096735-43096757 CCAGCCTGCCTGCCTGTCCGGTA 0: 1
1: 0
2: 6
3: 47
4: 934
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603211_1007603219 -4 Left 1007603211 6:43096735-43096757 CCAGCCTGCCTGCCTGTCCGGTA 0: 1
1: 0
2: 6
3: 47
4: 934
Right 1007603219 6:43096754-43096776 GGTAGGGCCCTGCCTGAGCTGGG No data
1007603211_1007603223 11 Left 1007603211 6:43096735-43096757 CCAGCCTGCCTGCCTGTCCGGTA 0: 1
1: 0
2: 6
3: 47
4: 934
Right 1007603223 6:43096769-43096791 GAGCTGGGCTGTCAGCAAGCTGG No data
1007603211_1007603224 20 Left 1007603211 6:43096735-43096757 CCAGCCTGCCTGCCTGTCCGGTA 0: 1
1: 0
2: 6
3: 47
4: 934
Right 1007603224 6:43096778-43096800 TGTCAGCAAGCTGGTGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007603211 Original CRISPR TACCGGACAGGCAGGCAGGC TGG (reversed) Intronic