ID: 1007603214

View in Genome Browser
Species Human (GRCh38)
Location 6:43096739-43096761
Sequence GCCCTACCGGACAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007603214_1007603225 30 Left 1007603214 6:43096739-43096761 CCTGCCTGCCTGTCCGGTAGGGC 0: 1
1: 0
2: 0
3: 18
4: 509
Right 1007603225 6:43096792-43096814 TGAAACCGGCTGCACAAAGACGG No data
1007603214_1007603223 7 Left 1007603214 6:43096739-43096761 CCTGCCTGCCTGTCCGGTAGGGC 0: 1
1: 0
2: 0
3: 18
4: 509
Right 1007603223 6:43096769-43096791 GAGCTGGGCTGTCAGCAAGCTGG No data
1007603214_1007603224 16 Left 1007603214 6:43096739-43096761 CCTGCCTGCCTGTCCGGTAGGGC 0: 1
1: 0
2: 0
3: 18
4: 509
Right 1007603224 6:43096778-43096800 TGTCAGCAAGCTGGTGAAACCGG No data
1007603214_1007603218 -9 Left 1007603214 6:43096739-43096761 CCTGCCTGCCTGTCCGGTAGGGC 0: 1
1: 0
2: 0
3: 18
4: 509
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603214_1007603219 -8 Left 1007603214 6:43096739-43096761 CCTGCCTGCCTGTCCGGTAGGGC 0: 1
1: 0
2: 0
3: 18
4: 509
Right 1007603219 6:43096754-43096776 GGTAGGGCCCTGCCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007603214 Original CRISPR GCCCTACCGGACAGGCAGGC AGG (reversed) Intronic