ID: 1007603218

View in Genome Browser
Species Human (GRCh38)
Location 6:43096753-43096775
Sequence CGGTAGGGCCCTGCCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007603214_1007603218 -9 Left 1007603214 6:43096739-43096761 CCTGCCTGCCTGTCCGGTAGGGC 0: 1
1: 0
2: 0
3: 18
4: 509
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603209_1007603218 12 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603204_1007603218 30 Left 1007603204 6:43096700-43096722 CCTGGGCTAGCCTGGGCACCTGC No data
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603206_1007603218 20 Left 1007603206 6:43096710-43096732 CCTGGGCACCTGCGGCTGTGCTG 0: 1
1: 0
2: 7
3: 48
4: 328
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603211_1007603218 -5 Left 1007603211 6:43096735-43096757 CCAGCCTGCCTGCCTGTCCGGTA 0: 1
1: 0
2: 6
3: 47
4: 934
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007603218 Original CRISPR CGGTAGGGCCCTGCCTGAGC TGG Intronic