ID: 1007603218

View in Genome Browser
Species Human (GRCh38)
Location 6:43096753-43096775
Sequence CGGTAGGGCCCTGCCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007603214_1007603218 -9 Left 1007603214 6:43096739-43096761 CCTGCCTGCCTGTCCGGTAGGGC 0: 1
1: 0
2: 0
3: 18
4: 509
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603211_1007603218 -5 Left 1007603211 6:43096735-43096757 CCAGCCTGCCTGCCTGTCCGGTA 0: 1
1: 0
2: 6
3: 47
4: 934
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603206_1007603218 20 Left 1007603206 6:43096710-43096732 CCTGGGCACCTGCGGCTGTGCTG 0: 1
1: 0
2: 7
3: 48
4: 328
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603204_1007603218 30 Left 1007603204 6:43096700-43096722 CCTGGGCTAGCCTGGGCACCTGC 0: 1
1: 1
2: 2
3: 46
4: 343
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133
1007603209_1007603218 12 Left 1007603209 6:43096718-43096740 CCTGCGGCTGTGCTGGGCCAGCC 0: 1
1: 0
2: 1
3: 34
4: 346
Right 1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG 0: 1
1: 0
2: 2
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007603218 Original CRISPR CGGTAGGGCCCTGCCTGAGC TGG Intronic
900300269 1:1973554-1973576 TGGCCGGGCCCTGGCTGAGCAGG + Intronic
900592822 1:3467536-3467558 CGGCAGGGCCCTGCATGGGCAGG - Intronic
901089557 1:6632335-6632357 CAGGAGGGCCCTGCATGTGCAGG + Intronic
901230239 1:7637695-7637717 CAGCAGGGCACAGCCTGAGCTGG - Intronic
901815018 1:11788943-11788965 CGGGTGGGCCTGGCCTGAGCTGG - Exonic
901879599 1:12185982-12186004 AGGGAGGGTACTGCCTGAGCAGG + Intronic
902371471 1:16009841-16009863 TGGTAGGGCCCTCGCTGAGATGG + Intergenic
902512676 1:16974853-16974875 CCCTCGGGCCCTGCCTGACCTGG - Exonic
902614442 1:17616201-17616223 CGGTGAGGCGCTGCCCGAGCGGG + Exonic
903213572 1:21831421-21831443 AGGTAAGGCCCAGCCTCAGCTGG + Intronic
907377069 1:54052979-54053001 AGGTAGGGCCCGTCCGGAGCGGG - Exonic
915341651 1:155179760-155179782 CGGGTGGGGCCTGGCTGAGCAGG - Exonic
915512270 1:156392774-156392796 CGGTTGGGGGCTGCCTGAGAGGG + Intergenic
918703734 1:187636710-187636732 AGGTAGGGACCTTCCTAAGCCGG - Intergenic
920347254 1:205314257-205314279 CTCTCGGGCCCTCCCTGAGCAGG + Intronic
922722022 1:227904191-227904213 CAGTTGGGCCCTCCCTGACCAGG + Intergenic
924609000 1:245558402-245558424 GGGGAGGGCCCTGCCCGGGCAGG - Intronic
924744304 1:246818225-246818247 CCCTCGGGCCCTGCCTGACCTGG + Intergenic
1064340049 10:14477675-14477697 GGGTAGGGCCCTGTCTGCCCAGG - Intergenic
1073379483 10:103066849-103066871 CTCTAGGGCCCTGCCTGTGTGGG + Intronic
1073612100 10:104954642-104954664 CAGCAGGACCCAGCCTGAGCTGG + Intronic
1076139402 10:128067870-128067892 TGCTTGGGCCCTGCCTGACCTGG + Intronic
1076720660 10:132391215-132391237 CGGGAGGCCCCTGCCTGGCCTGG - Intergenic
1077368701 11:2171723-2171745 CCGCAGGGCCGTGTCTGAGCTGG - Exonic
1077962470 11:7089654-7089676 CGGGAGGGCCCTGGCCGTGCGGG + Exonic
1081670351 11:44938979-44939001 CGGGAGGGCAAGGCCTGAGCAGG - Intronic
1083551497 11:63593510-63593532 CTGTAGGGCCCGGCCTGGTCTGG - Intronic
1083856052 11:65393735-65393757 TGGCAGGGCCCTGGCTGGGCTGG - Intronic
1084116157 11:67044344-67044366 CGGGAGGGTCCTGCCTGGGGCGG - Intronic
1086034610 11:82401701-82401723 CAGAAGGGCCCTGTCAGAGCTGG + Intergenic
1091439547 12:501968-501990 GGGGAAGGCCCTGCCTCAGCTGG - Intronic
1092001955 12:5040035-5040057 TGGTGGAGCCCTGCCAGAGCTGG + Intergenic
1092586378 12:9905280-9905302 AGGTAGGGTCCTTCCTAAGCTGG + Intronic
1093594188 12:20941772-20941794 AGGTAGGGTCCTTCCTGGGCTGG - Intergenic
1101987944 12:109462018-109462040 CAGTAGGGCCCAGTCTGAGGAGG - Intronic
1104747810 12:131221133-131221155 AGCAAGGGCCCTGCCTGTGCAGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1117783587 14:59259404-59259426 CCGTAGGACCCTGCATGAGCTGG + Intronic
1121652079 14:95566137-95566159 AGGCAGGGCCCTGCAAGAGCTGG + Intergenic
1122204312 14:100141087-100141109 CAGGTGGGCCCAGCCTGAGCGGG + Intronic
1123010137 14:105345908-105345930 CGGAAGGGCCTGGCCTGAGGGGG - Intronic
1124326042 15:28763469-28763491 CGACAGGGCCCTCACTGAGCTGG + Intergenic
1131150205 15:90043011-90043033 AGTGAGGGCCCAGCCTGAGCAGG + Intronic
1132547321 16:539368-539390 CGGGAGGACCCTGCCCGTGCAGG - Intronic
1132604212 16:787006-787028 CGGTGGGTCCCTGCCTGCCCAGG + Intronic
1132684522 16:1156749-1156771 CCGCCGGGCCCAGCCTGAGCCGG + Intronic
1136540628 16:30925910-30925932 CGGCAGTGCACTGCCGGAGCAGG - Exonic
1137003975 16:35255533-35255555 CGGAAGGCCACTGCATGAGCGGG + Intergenic
1137675378 16:50301322-50301344 GGGAAGGGCCCTGCCTGGGCAGG + Intronic
1138520270 16:57567170-57567192 AGGGAGGGCCCTGCTTGACCAGG + Intronic
1140039491 16:71396719-71396741 CTGCAGGGCCCTTCGTGAGCTGG - Intergenic
1141961709 16:87413393-87413415 CGGCAGGGCCCTGGCTGAGCGGG - Intronic
1142372503 16:89690903-89690925 TGGCAGGGCCCTGCCTGCACAGG - Intronic
1142759723 17:2035428-2035450 CGAGAGGGCCCTGCCTGTGGTGG + Intronic
1144020922 17:11240169-11240191 GGGCAGCGCGCTGCCTGAGCGGG - Intergenic
1144709644 17:17393086-17393108 AGGCAGGGCCCTGCCTACGCAGG - Intergenic
1147186599 17:38716571-38716593 CGCCCGGGCCCGGCCTGAGCTGG - Exonic
1150621749 17:66812809-66812831 CAGCAGGACCTTGCCTGAGCAGG + Intergenic
1151706870 17:75773842-75773864 CGGTAAGGCCATGCGTGATCTGG - Intergenic
1152117079 17:78394948-78394970 AGGTCGGGCCCTGCCTGAGGAGG + Intronic
1157147351 18:45177414-45177436 TGGCAGGGCCCTACCTGAGCTGG + Intergenic
1161060838 19:2214022-2214044 CAGAGGGGCCCTGCCTGGGCGGG + Intronic
1161072916 19:2271250-2271272 GGGTGGGCCCCTGCCTGGGCGGG + Intronic
1161768127 19:6217844-6217866 CTGCAGGGCCCAGCCTGTGCAGG + Intronic
1162353687 19:10167092-10167114 CGGCAGGGCCCTGGCAGAGTGGG - Intronic
1162746199 19:12800135-12800157 GGGCAGGGCGCTCCCTGAGCCGG + Intronic
1163675932 19:18655292-18655314 CGCCAAGGCTCTGCCTGAGCTGG - Intronic
1166714125 19:44955595-44955617 CGGTCCGGCCCTGCCTGGGCCGG - Intronic
1167116847 19:47493385-47493407 CAGCAGGGCCCTGCATGGGCTGG - Intronic
1167504392 19:49863379-49863401 CGTGAGGGCCCTGCTGGAGCAGG + Intronic
1167799066 19:51728626-51728648 CAGTAGGTACCTGCCTGAGATGG - Intergenic
1168189281 19:54726241-54726263 CTGTAGGTCCCTGCATGTGCTGG - Exonic
1168197518 19:54786651-54786673 CTGTAGGTCCCTGCATGTGCTGG - Intronic
1168199556 19:54804981-54805003 CTGTAGGTCCCTGCGTGTGCTGG - Exonic
1168206177 19:54852186-54852208 CTGTAGGTCCCTGCATGTGCTGG - Exonic
927854695 2:26520643-26520665 CTCTGGGGCACTGCCTGAGCTGG - Intronic
929095712 2:38261649-38261671 GGGGAGGGCCGTGCGTGAGCGGG - Intergenic
932760539 2:74436543-74436565 CGGGAGGGGCCTCCCGGAGCTGG - Intronic
935958677 2:108402659-108402681 AGGTAGGGCCCTTCCCAAGCTGG - Intergenic
937223182 2:120353632-120353654 CAGGAAGGGCCTGCCTGAGCCGG + Intergenic
937988045 2:127647461-127647483 TGGTGGGGGCCTGCCTGTGCTGG - Intronic
948265382 2:236632086-236632108 TGGAAGGGCCCTGCTTGAACTGG - Intergenic
948429678 2:237911650-237911672 CCGCACGGCCCTGCCTGAGATGG - Exonic
1168914285 20:1473735-1473757 CTGTAGGGCCCTGCATGAGCTGG - Intronic
1170566572 20:17611278-17611300 CGGCTGGGCCCTGCCTCAGGTGG - Intergenic
1172433759 20:34914010-34914032 CCATAGGGCCCTTCCTGAGTAGG - Intronic
1172650873 20:36500479-36500501 CGGCAGGCCCCTGGCTGTGCCGG - Exonic
1172972494 20:38883578-38883600 CAGTAGGGCCCTGCCTGTGTAGG + Intronic
1174183776 20:48691178-48691200 GGCGAGGGCCCTGCCTGTGCTGG - Intronic
1176196832 20:63840781-63840803 GGGGAGTGCCCAGCCTGAGCTGG + Intergenic
1180182533 21:46124408-46124430 GGGTAGGGGCCTGGCAGAGCTGG - Intronic
1181028910 22:20140707-20140729 CGGTGAGGCCCGGCCTGGGCAGG + Exonic
1181402714 22:22661068-22661090 CAGTAGGGCCCTACCTGTGGTGG + Intergenic
1181417644 22:22771952-22771974 CAGGAGGGCCCTGCCTGTGGTGG + Intronic
1183472513 22:38017073-38017095 CTGTGGGGCCGTGCCTGAGCGGG + Intronic
1184429997 22:44437129-44437151 CTGGAGGGCTCTGACTGAGCAGG + Intergenic
1184479132 22:44736971-44736993 CGGTGGGGCCCTGGCCGGGCGGG - Exonic
1184776945 22:46628006-46628028 CGGCAGGGGCCTGCCTTCGCCGG + Intronic
950672346 3:14534895-14534917 CGCCAGGGTCCTGCCTAAGCGGG + Intronic
954391307 3:50269368-50269390 CGGGAGGGCCCAGCTTGAGGTGG + Intronic
954580653 3:51701202-51701224 AGGTAGGGCCCTGCCTTGCCTGG + Intronic
954645229 3:52127231-52127253 CAGTCAGGCCCTGCATGAGCAGG - Intronic
954895610 3:53972615-53972637 CCGTGAGGCCCTGCCTGATCTGG + Intergenic
961326627 3:126112935-126112957 CGGCTGGGCCCTGGCAGAGCCGG - Intronic
961336000 3:126180179-126180201 TGGTAGGGCCCTTACGGAGCTGG - Intronic
966917486 3:184593092-184593114 AGGTTGGGCCCTGGCTGAGCAGG + Intronic
968730965 4:2269014-2269036 ATGTGGGGCCCTGTCTGAGCAGG - Intergenic
969642082 4:8405010-8405032 CTGCCAGGCCCTGCCTGAGCAGG - Intronic
984035419 4:174661751-174661773 CTGTAGGGCCATAGCTGAGCAGG - Intronic
984281740 4:177678736-177678758 AGGAAGGGCCCTGTCTGACCAGG - Intergenic
986343291 5:6811173-6811195 CGGTCTGGCCCTGCCTTTGCTGG - Intergenic
992639585 5:78757531-78757553 GGGTAGGGCTCTGGGTGAGCGGG + Intronic
994504986 5:100631102-100631124 CTATATGGCCCTGCCTGATCTGG + Intergenic
995541630 5:113191435-113191457 CGGTAGGGCCATGCCTAGGATGG - Intronic
997207322 5:132057352-132057374 TGGTGGGGCTCTGCCTGTGCTGG + Intergenic
999275235 5:150325635-150325657 AGGGAGGGCCCTGCCTTAGCTGG - Intronic
1001264929 5:170267356-170267378 CTGCGAGGCCCTGCCTGAGCTGG + Intronic
1001279562 5:170377121-170377143 CGGCAGGGCCAGTCCTGAGCTGG - Exonic
1004280479 6:14275806-14275828 TGGAAGGGCCCTGCCTGTGGGGG + Intergenic
1007603218 6:43096753-43096775 CGGTAGGGCCCTGCCTGAGCTGG + Intronic
1015692155 6:135937337-135937359 CTGCAGGGCCCTTCCTGATCTGG + Intronic
1017007195 6:150036514-150036536 CTCTAGGGCACTGCCTGACCAGG + Intergenic
1017714735 6:157201019-157201041 CGCCAGGGCCCTGCCTGTTCTGG - Exonic
1022675471 7:32495430-32495452 CGGGAGGGCCCTGACGGGGCGGG - Intronic
1022923445 7:35037772-35037794 GGGTCGGGCCCCGCCTGCGCCGG - Intronic
1023882773 7:44329836-44329858 CGTTGGGGGCCTGCCTGGGCTGG - Intronic
1023982115 7:45076307-45076329 CGGCCGGGCCCTCCCCGAGCGGG - Exonic
1025230481 7:57200791-57200813 TGGTAGGACCCTCCCTCAGCAGG - Intergenic
1026489142 7:70847797-70847819 AGGTAGGGTCCTTCCTAAGCCGG - Intergenic
1029360974 7:100088603-100088625 CTGCAAGGCCCTGCCTGATCTGG - Intergenic
1034453734 7:151152694-151152716 CAGGAGGGCCCTGCCAGATCGGG - Intronic
1037205684 8:16316953-16316975 AAGTGGGGCACTGCCTGAGCAGG + Intronic
1037716644 8:21406723-21406745 TGGCAGAGCCCTGGCTGAGCAGG + Intergenic
1047262390 8:123274455-123274477 CGGGAGGGCCCCGCCTTGGCCGG - Exonic
1049165224 8:141121561-141121583 CAGGAGGGGGCTGCCTGAGCAGG + Intronic
1060407975 9:123382065-123382087 CGGGAGGGTGCTGCCTGACCAGG + Exonic
1060554531 9:124501501-124501523 GGGTGGGGCCCTGTCTGAGCAGG - Intronic
1060826532 9:126691067-126691089 CGGTGAGGCCTGGCCTGAGCTGG + Exonic
1061091777 9:128430629-128430651 TGGTAGGGGGCTGCCTGAGGGGG - Intronic
1062341958 9:136097699-136097721 CGGATGGGGCCTCCCTGAGCTGG - Intergenic
1062519162 9:136950480-136950502 CCGCAGGGCCCTGCATGGGCGGG + Intronic
1203770686 EBV:48517-48539 CCGGGGGGCCCTGCCTGAGCCGG + Intergenic
1187367060 X:18674611-18674633 GGGTAGGGCCCGGCCGGATCGGG + Intergenic
1192341343 X:70266118-70266140 CAGCAGGGCCATGCCTGAGCAGG + Intergenic
1192785026 X:74326660-74326682 CAGGAGGTCCCTGTCTGAGCAGG - Intergenic
1199555460 X:149103359-149103381 GGGTAGGGTGCTGCCTGTGCGGG + Intergenic
1199991306 X:152989062-152989084 GGGCAGGGCCCTGCCCCAGCGGG - Exonic
1200094390 X:153650389-153650411 CAGGAGGGCTCGGCCTGAGCAGG + Exonic
1200323906 X:155217307-155217329 CTGGAGGGCGCTGCCTGTGCTGG + Intronic