ID: 1007605431

View in Genome Browser
Species Human (GRCh38)
Location 6:43114507-43114529
Sequence GGCTGTGCCCCCATTCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007605431_1007605437 8 Left 1007605431 6:43114507-43114529 CCCCCTGGAATGGGGGCACAGCC 0: 1
1: 0
2: 3
3: 23
4: 182
Right 1007605437 6:43114538-43114560 ACTTGAGTGAAGCCAGATCTCGG 0: 1
1: 0
2: 2
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007605431 Original CRISPR GGCTGTGCCCCCATTCCAGG GGG (reversed) Intronic
900107398 1:989691-989713 GGCTGGACCCCCCTTCCATGAGG + Intergenic
900667634 1:3826026-3826048 GGCTGGGCCTCCCTTGCAGGTGG + Intronic
902191775 1:14768603-14768625 AACTGTGCCCTCACTCCAGGGGG - Intronic
902332651 1:15738164-15738186 GGCTGTGCCCCGAGTCATGGTGG + Exonic
903071629 1:20729671-20729693 GGGTGTGCTCCCACTCAAGGAGG + Intronic
905037673 1:34928619-34928641 CACTGTCCCCCCATTCCTGGTGG - Intronic
906241044 1:44242497-44242519 GGCAGTGTCCCCATTCCTGTGGG - Intronic
906465225 1:46072809-46072831 GGGTGTGCCACCATGCCTGGTGG - Intronic
906551465 1:46669259-46669281 GGCTCTGCCCCTGTCCCAGGAGG - Intronic
907258237 1:53196697-53196719 GGCTGGGGCCCCCTTCCGGGCGG + Exonic
909643090 1:77888538-77888560 GCCTGTTCCCGCATTCCAGGCGG - Intronic
912322356 1:108726318-108726340 GGCAGTGCCTCCGTTTCAGGAGG + Intronic
914196533 1:145450787-145450809 GACTCTGCCTCCTTTCCAGGAGG - Intergenic
916986707 1:170199701-170199723 GGCTTTGCCCCATATCCAGGAGG - Intergenic
916997510 1:170316366-170316388 GGATGTGGCCCCACTCCATGGGG - Intergenic
917195899 1:172465510-172465532 GGCTGTGAACCAATTCCAGCAGG - Intronic
921355532 1:214281320-214281342 GGCTCTGCAGCCCTTCCAGGTGG + Exonic
922080843 1:222294420-222294442 AGCTGTGCACACCTTCCAGGAGG + Intergenic
922705210 1:227787028-227787050 GGCCTTGCCTCCTTTCCAGGGGG - Intergenic
924776115 1:247115285-247115307 GGCTGAGCCCCCATGCCTGCTGG + Intergenic
1063470333 10:6279626-6279648 GGCTCTGCTGACATTCCAGGAGG - Intergenic
1065831849 10:29621660-29621682 GGCTGTGGGCCCATGGCAGGAGG + Intronic
1067702411 10:48583348-48583370 GGCTGTACCCCTACCCCAGGGGG - Intronic
1069593281 10:69654995-69655017 AGCTCTGCCCTCCTTCCAGGAGG - Intergenic
1069901892 10:71711126-71711148 GGGTGGGCAGCCATTCCAGGAGG - Intronic
1071096076 10:81976307-81976329 TGCAGTGCCCACATTCCAGCAGG - Intronic
1071766527 10:88672258-88672280 GGCTGTGATTCCACTCCAGGAGG + Intronic
1072183724 10:93014210-93014232 GCCTGTGCCAGGATTCCAGGGGG + Exonic
1072540179 10:96392579-96392601 TGCTGGGGCTCCATTCCAGGGGG - Intronic
1072739139 10:97899229-97899251 GGCTGTGCCCCAAGTCCCTGTGG - Intronic
1073302869 10:102481505-102481527 TGCTGTGCCCCCTGCCCAGGTGG - Intronic
1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG + Intronic
1076590626 10:131579899-131579921 GGCTGGGCCTGCCTTCCAGGGGG - Intergenic
1077092585 11:786480-786502 GGCTGTCCCCCCACACCAGCTGG + Intergenic
1078659535 11:13276294-13276316 GTCTCTGCCCCCATTTCATGAGG - Intergenic
1079395202 11:20056235-20056257 AGCTGTGGCCCAAGTCCAGGAGG - Intronic
1083398829 11:62410148-62410170 GGCTGTGCCTGACTTCCAGGGGG - Intronic
1084013224 11:66364136-66364158 GGCCGTCCCTCCATTGCAGGCGG + Intronic
1084544910 11:69810402-69810424 GGCTGGACCCCCTTACCAGGGGG + Exonic
1085467563 11:76734582-76734604 CCCTGAGGCCCCATTCCAGGAGG - Intergenic
1089494638 11:118902004-118902026 AGCTGCGCACCCATTCCAGGTGG + Exonic
1089777477 11:120848443-120848465 GGCTGTTCACCCATTCCTGTTGG + Intronic
1091144469 11:133265634-133265656 GGCTGTGTCCCCATCACAGTGGG + Intronic
1091434764 12:463649-463671 AGCTGTGCCCCCATTTCAAGAGG - Intronic
1092257661 12:6936216-6936238 GGTTGGGCCCCCAGGCCAGGGGG - Exonic
1092304344 12:7283713-7283735 GCCTCAGCCCCCTTTCCAGGGGG - Intergenic
1093187178 12:16034104-16034126 GCCTGGGCCCCCATCCCTGGTGG + Intronic
1095664098 12:44774552-44774574 TGCTATGCCCCTATTCCAGTAGG - Intronic
1098917678 12:76274271-76274293 GGCTGGGCCCCTGTTCCAGGAGG + Intergenic
1104415512 12:128594202-128594224 GGCAGTGTCCCCACCCCAGGGGG + Intronic
1104568879 12:129908100-129908122 GGATGTGCCTCCCTTTCAGGGGG + Intergenic
1104980326 12:132570599-132570621 GGCTGTGCGCCCCTCCCCGGTGG - Intronic
1107411133 13:40159726-40159748 GACTGTGTCCCCATCCCAGCTGG - Intergenic
1111751880 13:92343252-92343274 GTCTGTGCCTTCATCCCAGGAGG + Intronic
1118321243 14:64754595-64754617 GGCTGTGCCTCCTTACGAGGGGG - Intronic
1118324986 14:64774588-64774610 AGTTGTGCCCCCACTCCTGGAGG + Intronic
1118481700 14:66173979-66174001 GGCTGAGCCCCCATGCCACTTGG + Intergenic
1119650926 14:76382279-76382301 GGCTGTGACCACATTCCAGCAGG + Intronic
1122144182 14:99679337-99679359 GGCTGTGCCCCCATCCTCAGAGG - Exonic
1122540507 14:102495472-102495494 GGCTAAGCCCCCATTCCAGGGGG + Intronic
1122604370 14:102938387-102938409 TGCTGTGCCCCCCTCCCAGGAGG - Exonic
1126104730 15:45139989-45140011 GCCTGGGCCACCAGTCCAGGTGG - Intronic
1128283210 15:66414502-66414524 GACTGTGCCCTGATTCCAAGAGG - Intronic
1129376820 15:75138733-75138755 CCCTGTGTCCCCCTTCCAGGAGG - Intergenic
1130053121 15:80500279-80500301 TTCTGGGCCCCCATTTCAGGGGG + Intronic
1130250399 15:82296653-82296675 CTCTGTCTCCCCATTCCAGGAGG + Intergenic
1131150203 15:90043003-90043025 GGCTGGGCCCTCACTCCAGGAGG - Intronic
1132556957 16:576755-576777 GTCTGTGCCCCGTTTCCAGCCGG + Intronic
1132601748 16:775904-775926 GGCAGAGCCCCGATGCCAGGAGG - Intronic
1135793990 16:25424067-25424089 AGCTGTGCCCTCAGCCCAGGAGG - Intergenic
1135926526 16:26698512-26698534 GGCTGTGGCTCCACACCAGGAGG + Intergenic
1136997963 16:35203678-35203700 AGCTGAGCCCCCATCCCAGGAGG + Intergenic
1137010781 16:35317519-35317541 AGCTGAGCCCCCATCCCAGTAGG + Intergenic
1138279880 16:55764634-55764656 GGCTGGACCCAGATTCCAGGTGG - Intergenic
1138288618 16:55829015-55829037 GGCTGGACCCAGATTCCAGGTGG + Intronic
1138438109 16:57017773-57017795 GGCTGTGCCCAATTTCAAGGAGG + Intronic
1139464730 16:67148427-67148449 GAAGGTTCCCCCATTCCAGGAGG - Exonic
1141177579 16:81730830-81730852 GCCTGGGCCCCCATCTCAGGGGG - Intergenic
1141916254 16:87099223-87099245 GGCTGTGTCCCCATCCCACATGG + Intronic
1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG + Intronic
1143419856 17:6780279-6780301 TGCTGTTCCTCCATACCAGGCGG - Exonic
1144599099 17:16597578-16597600 GGCTGTGGCCCCAGCTCAGGAGG - Intergenic
1147452038 17:40511827-40511849 TGGTGTGACCCCATCCCAGGAGG + Intergenic
1147655628 17:42089010-42089032 GGCTGTTCTGCCAATCCAGGTGG - Intergenic
1151683128 17:75632142-75632164 GGCTGTGCAGTCATTCCATGGGG - Intronic
1152316888 17:79586190-79586212 GAGGGTGCCCCCATTCCAGGTGG + Intergenic
1154501169 18:14998712-14998734 GCCGGTGCCGCCATGCCAGGAGG + Intergenic
1159697602 18:71579930-71579952 GGCTGAGCCACCATGCCTGGCGG + Intergenic
1160773997 19:846492-846514 GGGTGTGCCCACCTTCCAGGTGG - Intronic
1160836287 19:1126326-1126348 GGCTGAGTCACCATTCCCGGTGG + Intronic
1161059577 19:2208213-2208235 GGCGCTGCCCACATGCCAGGAGG - Intronic
1161070300 19:2256491-2256513 GGCTGTGACCTCACTCCAGCGGG - Intronic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1164636097 19:29792496-29792518 GGGTGTGCCTCCATTCCAGGAGG + Intergenic
1165012445 19:32858642-32858664 GGCTGTGCCCCGAGGCGAGGTGG - Intronic
1165279767 19:34786018-34786040 GGCAGAACCCCCATTTCAGGAGG + Intergenic
925917391 2:8616327-8616349 GTCTGTGCCCCAATCCCAGGAGG - Intergenic
927198344 2:20563415-20563437 GGCTGGGCCCTCATTGCTGGGGG - Intronic
928370465 2:30736692-30736714 GGATGTGGCCCCATGCCAGCTGG + Intronic
930091675 2:47535443-47535465 GGGTGCGCCCCCATTAGAGGAGG - Intronic
931245595 2:60490035-60490057 GCCTTTGCCCCCATTGCAGATGG - Intronic
934522748 2:95030269-95030291 GGCTGTGCCCCTATTGCAGGTGG + Intronic
936474085 2:112824452-112824474 TGCTGTGCCTGCAGTCCAGGCGG - Intergenic
938292012 2:130155486-130155508 GGCTGAGGCCCCTTTCCAAGTGG + Intronic
938464537 2:131517481-131517503 GGCTGAGGCCCCTTTCCAAGTGG - Intergenic
938500328 2:131828880-131828902 GCCGGTGCCGCCATGCCAGGAGG + Intergenic
939692741 2:145285834-145285856 TGCTGTGCCCACCTTCCAGGAGG - Intergenic
947728470 2:232415438-232415460 GCCTTTGCCCCCATCCCAAGGGG + Intergenic
948291038 2:236825005-236825027 GGCTGTGCCACTTATCCAGGTGG + Intergenic
1168843919 20:929119-929141 GGTTGTGCCCGAATTCCAAGAGG + Intergenic
1168895437 20:1320480-1320502 GTCTGTGCCTCCTTTCAAGGGGG - Intronic
1169400231 20:5273595-5273617 GTCTGTTCTCTCATTCCAGGGGG - Intergenic
1173295030 20:41748491-41748513 GGCTCTGCCCAGACTCCAGGTGG + Intergenic
1173867359 20:46321171-46321193 GGCTGTGTCCCCATCCCGAGAGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175826893 20:61941299-61941321 GACTGTGCCCCCACCACAGGGGG - Intergenic
1178631438 21:34264615-34264637 GGCTGGGCTCCTTTTCCAGGAGG + Intergenic
1178795888 21:35743921-35743943 GCTTGTGCCCCCGTTCCATGAGG - Intronic
1181108359 22:20587707-20587729 GCCTCTGCCTCCCTTCCAGGAGG + Intergenic
1183015841 22:34985927-34985949 GGCTGTTCCCCCACCCCAAGAGG + Intergenic
1183267797 22:36840054-36840076 TGCTGTGGCCAGATTCCAGGAGG + Intergenic
1183671251 22:39274208-39274230 GGCTGTGCCCCCCTTCCTCTGGG + Intergenic
1184357699 22:43993576-43993598 GCCTCTGCCCCCAGGCCAGGTGG + Intronic
1184390207 22:44199456-44199478 GCCTGTTCCCCCATTCCCTGAGG + Intronic
1184560699 22:45261331-45261353 GGCTGTGCACACATTCCTTGCGG + Intergenic
1185217921 22:49613906-49613928 GTCTGAGCCCCCAGCCCAGGTGG + Intronic
950214304 3:11147585-11147607 GACTGTGATCCCATTCCAGTAGG + Intronic
950214444 3:11148842-11148864 GACTGTGATCCCATTCCAGCTGG - Intronic
950217314 3:11168788-11168810 GGCGGTGCCCCAAATCCATGGGG - Intronic
950476710 3:13219475-13219497 GGATGTGCCCCCACCCCCGGCGG + Intergenic
953000832 3:38931582-38931604 GGCATTGCCCAGATTCCAGGAGG + Intronic
954035232 3:47847708-47847730 TGCCCTGCCCACATTCCAGGGGG + Intronic
955161163 3:56467123-56467145 AGCTGTATCCCCATACCAGGTGG + Intronic
960937435 3:122912492-122912514 GGGAGTGCCCCCACTCCATGCGG + Intronic
963910441 3:150812825-150812847 AGCTGTGCCCCCTTTTCAGTAGG - Intergenic
965849669 3:173009313-173009335 GGCTCTGCACCAATCCCAGGTGG - Intronic
966667810 3:182491839-182491861 ATCTGTGCCCCTATTCCAGATGG - Intergenic
967293866 3:187947143-187947165 GGCTGTGCCCAGATGCCAGCTGG + Intergenic
968489206 4:881126-881148 GGCTGTGCGCCCCATCCAGAGGG + Intronic
968965346 4:3766560-3766582 GGCTGCGCCCCGGCTCCAGGAGG + Exonic
969057313 4:4409945-4409967 GGCTGGGCCCACTTTCGAGGAGG - Intronic
969478682 4:7435306-7435328 GTCTCTGCCCCCATTCTGGGAGG + Intronic
976043203 4:80912807-80912829 GAGTGTGCCCACATTTCAGGAGG - Intronic
985585304 5:729315-729337 GTCTCTGCCACCATTCCAGTAGG - Intronic
985598815 5:813642-813664 GTCTCTGCCACCATTCCAGTAGG - Intronic
985625550 5:983381-983403 GGCTCGGACCCCATTCCACGTGG + Intergenic
991931396 5:71756378-71756400 GGCTCTGCCCCCTGTGCAGGCGG + Intergenic
994245585 5:97471927-97471949 GGCTGTGCCCTGGCTCCAGGAGG + Intergenic
996116704 5:119628247-119628269 GGCAGTGGCCCCAGTCCAGTGGG - Intronic
998039608 5:138944059-138944081 GGCTGTGCCCTCATCCTAGCAGG - Intergenic
998128315 5:139638496-139638518 GGCTGTGCCCCAGCCCCAGGCGG - Intergenic
1001284643 5:170413711-170413733 GGCCCTGCCCTCATTCCATGTGG - Intronic
1001305646 5:170570663-170570685 GACTGTGGCCCCGTGCCAGGCGG + Intronic
1003169254 6:3708239-3708261 GGCTGTTCCCGCCATCCAGGTGG + Intergenic
1004884272 6:20036754-20036776 GGCTGGGCCTCCCTTCCAGCTGG - Intergenic
1005136753 6:22577638-22577660 GGGTGTGCCTGCATTGCAGGAGG + Intergenic
1005667865 6:28076517-28076539 GGCAGTGCCCCCATACCAATGGG + Intergenic
1006633106 6:35443382-35443404 GGCGGCGACCCCACTCCAGGGGG - Intergenic
1006683550 6:35814269-35814291 GGCTCTGCCACCACACCAGGTGG - Intronic
1007605431 6:43114507-43114529 GGCTGTGCCCCCATTCCAGGGGG - Intronic
1013066315 6:106687493-106687515 TTCTGTGCCCCCAGTCCAGTGGG + Intergenic
1017206331 6:151807824-151807846 GGCTGTGCTCTTTTTCCAGGTGG + Exonic
1018051654 6:160014470-160014492 GGCTGTCTCCCTACTCCAGGAGG - Intronic
1018652797 6:166005805-166005827 GGCTGTGACCCCCTTCCTGGGGG + Intergenic
1018711102 6:166498738-166498760 GGCTCTGCCCCCTCTCCAGGTGG + Intronic
1019129967 6:169866255-169866277 GGCTGTGCCACCGTGGCAGGAGG + Intergenic
1019323459 7:426029-426051 GGCTGGGCCCCCAGACCAGGTGG + Intergenic
1019729479 7:2622433-2622455 GGATGTGGCTCCATTCCAGGGGG - Intergenic
1021342429 7:19480699-19480721 GGCAGTACCCCCACCCCAGGGGG + Intergenic
1023640622 7:42253395-42253417 GGGTGTATCCCCATCCCAGGAGG - Intergenic
1026128968 7:67604940-67604962 GTATGTGCCACCAGTCCAGGTGG - Intergenic
1026345839 7:69473462-69473484 GCATGTGCCACCATTCCTGGTGG + Intergenic
1026988917 7:74571987-74572009 GGCTGTGATCCCTTTTCAGGGGG + Intronic
1031392646 7:121234498-121234520 GGCTGTTCCTCCATTCTAGGAGG - Intronic
1032837002 7:135683846-135683868 GGCTGTGGCCCAGTTCCAGAAGG - Intronic
1034500698 7:151448674-151448696 GGCTGCGCCCCGTTTCCAGCCGG + Intergenic
1038192706 8:25338550-25338572 GACTGTCCCTCCTTTCCAGGTGG + Intronic
1038284020 8:26190784-26190806 TGCTGTGATCCCACTCCAGGAGG + Intergenic
1039178663 8:34838514-34838536 GGCTGGGCCACCATTTAAGGGGG + Intergenic
1039969701 8:42311133-42311155 GGCAGTGTCCACACTCCAGGTGG - Intronic
1043448370 8:80341379-80341401 AGCTGTGCTCCTAATCCAGGAGG - Intergenic
1047770660 8:128027666-128027688 GGCTGTGGCACCATGCAAGGTGG + Intergenic
1048987404 8:139742110-139742132 GGCTGCACCCCCATTCCCAGCGG + Intronic
1049655163 8:143794001-143794023 GGCTGTGGCCCCCGACCAGGAGG + Intronic
1049873427 8:144999684-144999706 GGCTGTACCCCTCTCCCAGGAGG - Intergenic
1050019231 9:1266727-1266749 GCCTGTTCCTCCATTCCAGCTGG + Intergenic
1052733624 9:32318259-32318281 AGCTTTGCCCCCTTTCCTGGAGG - Intergenic
1053562593 9:39211210-39211232 GATGGTGCCCCCATCCCAGGTGG - Intronic
1053828399 9:42049202-42049224 GATGGTGCCCCCATCCCAGGTGG - Intronic
1054134557 9:61407829-61407851 GATGGTGCCCCCATCCCAGGTGG + Intergenic
1054602160 9:67138252-67138274 GATGGTGCCCCCATCCCAGGTGG + Intergenic
1056510375 9:87298896-87298918 GGCTGTGGCCCCATGCCTAGGGG + Intergenic
1060311493 9:122466630-122466652 GGCTGTGCCAACGTTCCAGATGG + Intergenic
1060412621 9:123410177-123410199 GGCTGTGCCCTCATTCCTAGAGG - Intronic
1061913411 9:133737134-133737156 GGCAGTGCCCACAGTTCAGGTGG - Intronic
1062048582 9:134435655-134435677 GGCTGCACCCCCACTGCAGGTGG - Intronic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1062259687 9:135655389-135655411 GGCTGTGCCCTCTGTCCAGCTGG + Intergenic
1062460581 9:136661046-136661068 GCTTGTGCCCCCATCCCAGGAGG - Intronic
1062482882 9:136760577-136760599 GGCTGTGCCCAGATTCTTGGCGG + Intronic
1062698199 9:137886047-137886069 GACTCTGCCTCCTTTCCAGGAGG + Intronic
1185482823 X:460395-460417 AGCTGAGTCCCAATTCCAGGAGG + Intergenic
1186421884 X:9433104-9433126 GGCTGTGTCCCCATCCCTGGAGG + Intergenic
1187946143 X:24427924-24427946 CTCTGTGCCCCCCTTCCTGGAGG - Intergenic
1188670399 X:32875137-32875159 GGCAGAGCCTCCATTCCAGAGGG - Intronic
1191754304 X:64577448-64577470 GGCAATGCCCCCATGCCTGGGGG - Intergenic
1195583362 X:106533020-106533042 GACTGTGCTCCCTATCCAGGTGG - Intergenic
1199948936 X:152690055-152690077 GGCTGTGCCCTACTTCCAGTGGG + Intergenic
1199960740 X:152778394-152778416 GGCTGTGCCCTACTTCCAGTGGG - Intergenic