ID: 1007605433

View in Genome Browser
Species Human (GRCh38)
Location 6:43114509-43114531
Sequence CTGGCTGTGCCCCCATTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007605433_1007605437 6 Left 1007605433 6:43114509-43114531 CCCTGGAATGGGGGCACAGCCAG 0: 1
1: 0
2: 1
3: 21
4: 222
Right 1007605437 6:43114538-43114560 ACTTGAGTGAAGCCAGATCTCGG 0: 1
1: 0
2: 2
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007605433 Original CRISPR CTGGCTGTGCCCCCATTCCA GGG (reversed) Intronic
900348703 1:2224710-2224732 CTGCCTTTGCCCGCATGCCAGGG + Intergenic
900476267 1:2877809-2877831 CCGGCTCTGCCGCAATTCCACGG + Intergenic
900579266 1:3400483-3400505 CAGGCTGTGCACCCTGTCCAAGG + Intronic
900757782 1:4449137-4449159 CTGGCTGTGTACCAATTACAGGG + Intergenic
900866509 1:5272697-5272719 CCTGCTCCGCCCCCATTCCAGGG - Intergenic
903031737 1:20468522-20468544 CTGGCTGTGACCAGTTTCCAGGG - Intergenic
903658469 1:24963106-24963128 ATGGGAGTGCCCCCATTTCAGGG + Intronic
904412022 1:30330332-30330354 CTCGCTGGGCCCCCATTCCAAGG + Intergenic
906079158 1:43072508-43072530 CTCACTGTGCTCCCAGTCCAGGG - Intergenic
907271483 1:53294023-53294045 AGGGCTGTGCCGCCATTCTAAGG + Intronic
907321053 1:53602574-53602596 CTGGCTGTCCACCCTTTCTAGGG - Intronic
909249119 1:73328524-73328546 CTGGCTGCTCCTCCATACCATGG + Intergenic
911102603 1:94106122-94106144 CTTGCAGAGCCCCCATTCCTAGG + Intronic
912366266 1:109136373-109136395 CTGGCTGTCCCCCGAAGCCAGGG + Intronic
912662026 1:111540351-111540373 CTGGCTGCTGCCCCATGCCAAGG - Intronic
914947950 1:152082552-152082574 AAGACTGTGCCCCCTTTCCAAGG - Intergenic
916573997 1:166051107-166051129 CTAGCTGTGAACCCATTCCAGGG - Intergenic
917468686 1:175307547-175307569 CAGGCTGTTCCCCCAATCCCAGG + Intergenic
917734009 1:177904028-177904050 CTGACTCTGTCCCCATTACAAGG - Intergenic
918723075 1:187879217-187879239 CTTACTGTGCCCACACTCCATGG - Intergenic
922564277 1:226590980-226591002 CTGTCTGGGCTCCCATTCCTAGG + Intronic
922745365 1:228040062-228040084 CTGGCTGGGCCCCCACTGCATGG - Intronic
922976637 1:229790066-229790088 CTGGCAGAGTCCCCCTTCCATGG + Intergenic
924214997 1:241811752-241811774 CTGCCTGTTCCCCCTTTCCTAGG + Intergenic
924483041 1:244453740-244453762 CTGTCTGTAGCCCCATTGCAGGG + Intergenic
1062858009 10:789178-789200 CTGGCTGGGGCCCCTTTGCAAGG + Intergenic
1063586584 10:7358207-7358229 AGGGCAGTGCCTCCATTCCAGGG - Intronic
1063819010 10:9812879-9812901 CTGGCTGTGGCCCCAGGCTAAGG + Intergenic
1069867218 10:71511374-71511396 CAGGCTGGGCCCCGATTCCCAGG - Intronic
1069918596 10:71802421-71802443 CTGGCTGACCCCCCAGCCCAGGG - Intronic
1069944144 10:71974488-71974510 CTGGCTGCGGCCCCAGCCCAGGG - Intronic
1072189220 10:93066741-93066763 CTGGCTGGGGCCAGATTCCAGGG + Intronic
1073207901 10:101778378-101778400 CTGCCCCTACCCCCATTCCAGGG - Intronic
1073318802 10:102601231-102601253 CTGGAAGTGCCCCCAAGCCAGGG - Intronic
1076259472 10:129054340-129054362 CTGGCTGGGCCCTAAATCCAAGG - Intergenic
1077309885 11:1883584-1883606 CTGGGTGTACCCCCACCCCAGGG + Intronic
1081269338 11:41065068-41065090 CTGGCTCAGCCCCCTTTCCGGGG - Intronic
1081848919 11:46261205-46261227 GTGGCTGAGCCTCCATTCCTCGG + Intergenic
1082032007 11:47611509-47611531 CTGGCAGTGCCACATTTCCATGG - Intergenic
1085349371 11:75788706-75788728 CTTGCTGTGTGCCCATTCCCTGG - Intronic
1088007589 11:104961388-104961410 CTGTCTGTAGCCCCATTGCAGGG + Intronic
1089620007 11:119716752-119716774 CAGGCTGTGCCCCCAACCCCAGG + Intronic
1091271352 11:134313826-134313848 CTGGCTGTGCCCCTGTCCTAAGG + Intronic
1092159263 12:6307076-6307098 CTAGATGTGTCCCCATTCCCTGG - Intergenic
1092783842 12:12010511-12010533 CTGCCTGTCCCCCCATGCAACGG + Intergenic
1093652689 12:21662318-21662340 GTGGCTGTGGTCCCCTTCCACGG + Intronic
1094767745 12:33617626-33617648 CTGTCTGTTACCCAATTCCAAGG - Intergenic
1096004415 12:48157425-48157447 CTGGCTGTAGACCCACTCCAAGG + Intronic
1096178634 12:49538967-49538989 CTGGGTGTGCCCCGTCTCCATGG + Intergenic
1096606930 12:52773509-52773531 CTGGCTGTGCACTCTCTCCATGG + Intronic
1096660945 12:53123654-53123676 CTGGCTTCCCTCCCATTCCAGGG - Intronic
1098386052 12:69920007-69920029 CTGGCTGTGCCCCAATATCTTGG + Intronic
1101195610 12:102378847-102378869 CTGGGTGTACCCACAGTCCAAGG - Intergenic
1102576148 12:113857369-113857391 ATGGCTGCGCCCCCCTCCCAGGG - Intronic
1104979993 12:132569465-132569487 CTGGATGTGCCCTCAGCCCAGGG - Intronic
1105022027 12:132823128-132823150 CTTTCTGTGCCCCCACTCCAAGG - Intronic
1105840312 13:24248319-24248341 CTGGCTCTGCAGCCATTCCCTGG - Intronic
1106300363 13:28458877-28458899 CTGGCTGTGCACTCCTTCTAGGG - Intronic
1106756405 13:32826889-32826911 CTGTCTGTAGCCCCATTGCAGGG + Intergenic
1107332040 13:39311775-39311797 GTGACTGTGCCCCCTTTCCTCGG - Intergenic
1107482813 13:40798984-40799006 CTGCCTGTGCCTTCCTTCCATGG + Intronic
1113915924 13:113874293-113874315 CTGGCTCTGCCCCCACTCGAGGG + Intergenic
1115838329 14:37435263-37435285 CTAGGTGTGCTCCCATCCCAGGG + Intronic
1117817320 14:59611463-59611485 CTGTCTGTAGCCCCATTGCAGGG + Intronic
1118186854 14:63545489-63545511 ATGGCTCTGCCCTCAGTCCATGG + Intergenic
1121346433 14:93139398-93139420 CCTGCTGTGCCCCCAGTCAATGG - Intergenic
1122266107 14:100547629-100547651 TGGGCTGTGCACCCATTGCAAGG - Intronic
1122540135 14:102493445-102493467 TAGGCTAAGCCCCCATTCCAGGG - Intronic
1122540505 14:102495470-102495492 TAGGCTAAGCCCCCATTCCAGGG + Intronic
1122799223 14:104221472-104221494 CTGGCTGTGCTCCCTTCCCTGGG - Intergenic
1122840645 14:104461264-104461286 CTGGCTTTCCCCCCACCCCACGG - Intergenic
1124473252 15:30007524-30007546 CTGGGTGGGCCCCAAGTCCATGG - Intergenic
1124668465 15:31615781-31615803 CTGGCTGTGCCACCGTGCCCAGG + Intronic
1127961752 15:63895447-63895469 CTGCCTGGGCCCCCATCCCTCGG + Intergenic
1128936537 15:71750670-71750692 CTGACTGTGCCCCCAGTCCCAGG + Intronic
1130086333 15:80780651-80780673 CTGGCTGCAGCCCCATACCAGGG + Intronic
1132055327 15:98647721-98647743 CTGTCTGGGCCCCCCTTCCGGGG + Intergenic
1134065516 16:11225706-11225728 CTGGCTCTGCCCCAAAGCCATGG + Intergenic
1135221952 16:20621526-20621548 CTGGGTGTGTGCCCCTTCCAGGG - Intronic
1136085801 16:27884095-27884117 CTGACTGTGCCGCCTTTCCCTGG - Intronic
1136414872 16:30096687-30096709 CTCACTGTGGGCCCATTCCATGG + Intronic
1137376325 16:47955217-47955239 CTGGCTGGGCCACCCTTCCATGG + Intergenic
1138552810 16:57756651-57756673 CTGGCTGTGCCCACAATCCCTGG + Intronic
1138830330 16:60367292-60367314 TTGTCTGTGCCCCCATTTCCTGG + Intergenic
1139924763 16:70479973-70479995 CTGGCTGTCAACCCTTTCCAGGG - Exonic
1140544287 16:75791354-75791376 CTGGCTGTTCCACCAGACCATGG - Intergenic
1142138926 16:88463997-88464019 CTGGCTGGAGCCCCATCCCATGG - Intronic
1143108907 17:4542785-4542807 CAGGCTCTGCTCCCATCCCAGGG - Intronic
1143781638 17:9232391-9232413 CTGACTGTGCCCACCTCCCAGGG + Intronic
1143781986 17:9233853-9233875 CTGACTGTGCCCACCTCCCAGGG + Intronic
1144686037 17:17227019-17227041 CTGGCGGTGCCCTCCTTCCCAGG + Intronic
1145909932 17:28536644-28536666 CTGGCTCTGCTCCCATTCCCTGG + Intronic
1146379097 17:32315256-32315278 CTGGTTGTGCCCTCCTTCCCTGG + Intronic
1147559828 17:41501866-41501888 CTAGCTGTGCCCCCAGCTCAAGG + Intronic
1148115123 17:45170977-45170999 CTGGCTGTGCCACCAGGCAAGGG + Intergenic
1150248609 17:63693878-63693900 CTGGCTGGGCTGCCACTCCATGG - Exonic
1150295591 17:64005668-64005690 CAGGCTGTGCTCCAACTCCATGG + Intronic
1151655159 17:75492395-75492417 CTGGCTCTGCCCACCTCCCAAGG - Intronic
1151683130 17:75632144-75632166 TTGGCTGTGCAGTCATTCCATGG - Intronic
1152039660 17:77894623-77894645 CTGGCTGAGGCCCCATTGCCAGG - Intergenic
1152439254 17:80295377-80295399 CTGCCTGAGCCCTCATGCCAGGG + Intronic
1152626589 17:81390527-81390549 AAGGCTGTCCCCCCACTCCAAGG + Intergenic
1156564687 18:38174289-38174311 CTTGCTTTGCCACCATTCCAAGG - Intergenic
1157280916 18:46345797-46345819 CAGGCTGTGCCCCGACTCCCGGG + Intronic
1161852798 19:6746282-6746304 CTGGCTGGGCCCCTCTTCCCTGG + Intronic
1161982910 19:7639148-7639170 CTGACTGTGCCCCTCTCCCAGGG + Intronic
1163623180 19:18372849-18372871 CTTGCTGTGTCCCCAGTCCAGGG - Intergenic
1163777593 19:19227312-19227334 CTGGCTGTGGCCCCCTACCATGG + Exonic
1164120530 19:22261711-22261733 CTGCCTGGGCCCCCAGCCCAAGG + Intergenic
1166664624 19:44671725-44671747 CTGTCTGTGCTCCCATCCCAGGG + Exonic
1166727484 19:45037680-45037702 CTGGCGGTGCCTCCATCCCCGGG - Exonic
1167044009 19:47039485-47039507 CTGGCTGAGCTGCCACTCCATGG + Exonic
927207996 2:20622052-20622074 CTGGCTGTGCAGCCACACCAGGG - Intronic
927685837 2:25169715-25169737 CCGGCTTTGGCCCCTTTCCAGGG + Intergenic
927861542 2:26562912-26562934 CTGGCTGTGCCCCACTTGCCAGG - Intronic
928436427 2:31257425-31257447 CTGGCTGTGCCTGCGTGCCAGGG + Intronic
929924112 2:46195213-46195235 CTAGCTGCTCCCCCTTTCCAAGG - Intergenic
933489460 2:82967239-82967261 CCGGCTGGGCTCCCCTTCCATGG - Intergenic
933603152 2:84354105-84354127 CTGGCTCAGCCCCCTTTCCAGGG - Intergenic
934047561 2:88185411-88185433 CTTGCTGTGCCCCCACTCAGCGG + Exonic
935690127 2:105723498-105723520 CCTGCTGTGCCACCCTTCCAGGG + Intergenic
937941176 2:127287340-127287362 CTGGCTGAGCCACCATGCCACGG + Intronic
939955731 2:148526559-148526581 CTGGCTCTGCCACCAGTGCAAGG + Intergenic
940865275 2:158811651-158811673 CTTGCTGTGGCTCCATTACAGGG - Intronic
943670679 2:190657249-190657271 CTGCCTGTCCTCCCACTCCAGGG - Intronic
946837120 2:223783698-223783720 CTGGCTGTGGGTCCATTTCATGG - Intronic
948125661 2:235563217-235563239 TTGGCTGTGCCCCCCTGCCCTGG + Intronic
1168848535 20:961135-961157 CTGGCTGTGCCCGCTGCCCAGGG + Intronic
1171272509 20:23827854-23827876 CTGGCTGTTCCCCAATGCCTGGG - Intergenic
1171375806 20:24693569-24693591 CTGGCTGTGCCCCTGTTGCTTGG - Intergenic
1172550165 20:35792978-35793000 CTGTCTGTGCACCCATCCCTAGG + Intronic
1173902587 20:46601790-46601812 CTGGGTGTGCTCCCACCCCAGGG - Intronic
1174291321 20:49510939-49510961 CTGGCTGAGCCCTCAGTCCCAGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175917773 20:62434928-62434950 CTGGCTGTGCCCCTTACCCACGG + Intergenic
1176210398 20:63917893-63917915 CAGGCAGTGCCCCCACTCCCTGG - Intronic
1177651422 21:23965378-23965400 GTAGCTGTGCCACCTTTCCATGG + Intergenic
1177937682 21:27369404-27369426 ATGGCTGTGCTCCCAGTGCAAGG + Intergenic
1178114554 21:29404265-29404287 CTGCCTGTTACCCAATTCCAAGG - Intronic
1179194915 21:39155883-39155905 CTGGGTGTGCTCCCATGTCAGGG - Intergenic
1179506895 21:41847142-41847164 CTGGCTGGGCTCCGACTCCACGG + Exonic
1179644957 21:42770189-42770211 CTGCCTGTGGCCCCCTGCCAAGG + Intronic
1180843001 22:18967963-18967985 CTGGCTGTGCCCCTTGACCAGGG + Intergenic
1181111329 22:20604620-20604642 CTGGCTGTGCACCCATCTTAGGG - Intergenic
1181475699 22:23166671-23166693 CTAGCCGTGCACTCATTCCAAGG - Intergenic
1181542614 22:23581488-23581510 CTGGCTCTGCTCACACTCCAGGG + Intergenic
1181580831 22:23827254-23827276 CTGCCAGTGCCCACAGTCCAGGG + Intronic
1182355002 22:29718969-29718991 CTGGCTGTGGCCCCATCTCTGGG - Intergenic
1182800210 22:33026000-33026022 CTGGCTGTCCCACGAATCCAAGG + Intronic
1184861393 22:47174931-47174953 GTGGCCCTGCCCGCATTCCAGGG - Exonic
1184886841 22:47351831-47351853 CTGCCTCTGCCCGCATTCCAGGG + Intergenic
1185049103 22:48544382-48544404 CAGGCTCTGTCCCCACTCCACGG + Intronic
949175968 3:1063173-1063195 CTGGTTCAGCCCCCTTTCCAGGG + Intergenic
950408536 3:12819591-12819613 CTGGCTGGGCCCCTCTTCCTGGG - Intronic
950640824 3:14347022-14347044 CTGGCTGTACCTTCATTCCCTGG - Intergenic
954035230 3:47847706-47847728 CTTGCCCTGCCCACATTCCAGGG + Intronic
954684600 3:52363556-52363578 CTTGCTGAGCCCAGATTCCAAGG + Intronic
955455916 3:59121723-59121745 CTAGGTGTGCCCCCATCTCAAGG - Intergenic
956598229 3:70992015-70992037 CTCCATGTGCCCCCCTTCCATGG - Intronic
956866756 3:73376729-73376751 CTGTCTGTGCCTCCAGTTCATGG + Intergenic
961524498 3:127488185-127488207 CTGCAGGTGCCACCATTCCAGGG + Intergenic
962900270 3:139755715-139755737 CTGTCTGTGCTCCCATCACAAGG - Intergenic
965866754 3:173214627-173214649 CTGGCTTTTCCCCAATTCCCTGG - Intergenic
967100721 3:186213335-186213357 CAGGCTGAGCCCCAATGCCATGG + Intronic
968622642 4:1610711-1610733 GTGGCTGTGACCCCAGGCCAAGG + Intergenic
969697612 4:8743973-8743995 CTGACTGTGCACCCCTGCCAAGG - Intergenic
971136194 4:23871385-23871407 CTTGCTGGTCCCCAATTCCAGGG - Intronic
976023959 4:80664707-80664729 CTGGTTCAGCCCCCTTTCCAGGG + Intronic
981475394 4:145181559-145181581 CTGCCTTGCCCCCCATTCCAAGG - Intergenic
982217121 4:153092040-153092062 CTGGCTGAGCCAGCATTCCTTGG + Intergenic
987401791 5:17485797-17485819 CTGGCTGTGATCTGATTCCATGG - Intergenic
992414469 5:76539374-76539396 ATGGGTGTGCCCCCACTCCAGGG + Intronic
994298749 5:98121488-98121510 CTGGCTTTAGCCCCATCCCATGG - Intergenic
994474398 5:100249012-100249034 CTGCCTGTTACCCAATTCCAAGG - Intergenic
997251016 5:132388601-132388623 CTGTCGGTGGCCACATTCCAAGG - Intronic
997977562 5:138449338-138449360 CTTGCTGTCCCCTCATTCCCTGG + Intergenic
998128738 5:139640584-139640606 CAGGGTGTGCCCTCATTCCTGGG + Intergenic
998649956 5:144107511-144107533 ATGCAGGTGCCCCCATTCCAAGG + Intergenic
998880074 5:146636572-146636594 CTCTCTGTGCCCTCCTTCCATGG + Intronic
999083927 5:148870439-148870461 CTGGCTATGCCCCAAATCCTGGG + Intergenic
999246936 5:150160094-150160116 CTGGCTCTGCCCCCACTCCCAGG + Intergenic
999411600 5:151354815-151354837 CTGACTCTGCCTCCAATCCAGGG - Intergenic
999533521 5:152489401-152489423 CAGACTCTGCCCCCATTCAAGGG + Intergenic
1001024102 5:168208470-168208492 CTGGCTTTGCCCGCCTTCCCAGG - Intronic
1001064914 5:168529075-168529097 CTGGCTGTGCCACCAGTTCTGGG - Intergenic
1001346406 5:170903461-170903483 CTGGCTTAGCCCCCTTTCCAGGG + Intronic
1001574339 5:172752071-172752093 CTGTCTGGGCACCCATTCCTTGG - Intergenic
1002567560 5:180120281-180120303 CTGGCTCAGCCCCCATCACAGGG - Intronic
1002699100 5:181109945-181109967 CAGGCTGTGCTCCCAATCGAGGG + Intergenic
1003115270 6:3279681-3279703 CTGGCAGAGCCCACATTTCAGGG - Intronic
1005583354 6:27253192-27253214 TTCTCTGTGTCCCCATTCCAGGG + Intronic
1005677504 6:28170216-28170238 CTGGGTGTGCCAACATTGCAAGG + Intergenic
1007605433 6:43114509-43114531 CTGGCTGTGCCCCCATTCCAGGG - Intronic
1009735704 6:67674057-67674079 ATGGGTGTGTCCCCATACCAAGG - Intergenic
1011741730 6:90368183-90368205 ATGGCTGTGCCTCCTGTCCAGGG + Intergenic
1012870870 6:104671241-104671263 CTGGCTTCACCCCCTTTCCAGGG - Intergenic
1015667608 6:135649009-135649031 CTGTCTGTTACCCAATTCCAAGG + Intergenic
1018935851 6:168273800-168273822 CTGGCTGTGTCCCCTGGCCAGGG + Intergenic
1019729481 7:2622435-2622457 CAGGATGTGGCTCCATTCCAGGG - Intergenic
1022804411 7:33807444-33807466 CTGGCACTGCCCCCACTTCAGGG + Intergenic
1026801172 7:73400869-73400891 CTGCTTGTGCCCCCACTTCACGG - Intergenic
1028287764 7:89024728-89024750 CTGGCTGATACCACATTCCATGG + Intronic
1029172677 7:98641937-98641959 CAGGCTGTCCCCCAACTCCAGGG - Intergenic
1033862590 7:145645446-145645468 CTGTGGGTTCCCCCATTCCATGG + Intergenic
1034676883 7:152898388-152898410 CTGGCTGTGCCGCCATCACCTGG - Intergenic
1034708733 7:153171403-153171425 CTGGCTGTTACTCCATACCATGG + Intergenic
1035108001 7:156458176-156458198 CTGGGTGTGCCGCCAGTCCAGGG + Intergenic
1037446739 8:18972898-18972920 CTGGCTGGGCCACCCTTCAAAGG + Intronic
1038654352 8:29435667-29435689 CTGCCTGTGCCCAGATTTCATGG - Intergenic
1040378508 8:46849753-46849775 CTGCCTGTGCCCTGATTCCTTGG + Intergenic
1043678911 8:82996968-82996990 CTGGCTTTGCCCCACTTCCCTGG + Intergenic
1047255834 8:123212861-123212883 CTGGCTCTGTCTCCCTTCCAGGG - Intergenic
1048572742 8:135668910-135668932 CAGGCTGTGCCCCCTTTTCTGGG + Intergenic
1049178584 8:141208723-141208745 CTGCCTGTGTCCCCTTTCCTGGG - Intronic
1049586162 8:143433304-143433326 CAAGCTGTGCCCCTATTCCCAGG - Intergenic
1051894044 9:21970159-21970181 CTCCCTCCGCCCCCATTCCATGG - Intronic
1052699881 9:31924711-31924733 CTGGCTGTGCCCACTCTTCATGG + Intergenic
1054743147 9:68828571-68828593 CTGACCGTGACCACATTCCAAGG + Intronic
1055623048 9:78145801-78145823 CTGTCTAGGCCCCCATCCCATGG + Intergenic
1056121785 9:83495369-83495391 CTGGCTCTGTCCCCTTACCAAGG - Intronic
1056510373 9:87298894-87298916 CTGGCTGTGGCCCCATGCCTAGG + Intergenic
1057349982 9:94288132-94288154 ATTGCTGGGCCCTCATTCCAGGG - Intronic
1057905313 9:98978093-98978115 CTGGCTGTGCCTCCTGGCCATGG + Intronic
1060209281 9:121700040-121700062 CAGGCTGTGCCCCCAGCTCAGGG - Intronic
1060299365 9:122365896-122365918 CAGACTGGGTCCCCATTCCAGGG + Intergenic
1061453933 9:130683745-130683767 CTGCCTGTGCCTCCATTTCCAGG - Intergenic
1061676175 9:132216990-132217012 CTGGCTTCGCGTCCATTCCATGG - Intronic
1062031211 9:134362855-134362877 CTGTGTGTGCCCCCATGCCCGGG + Intronic
1062066638 9:134531528-134531550 CTGGCTGTTACCCCACTCCGGGG + Intergenic
1062269887 9:135703557-135703579 CAGGCTGTGCCCACTTCCCAAGG - Intronic
1062446153 9:136596035-136596057 CTGGCTCTGGGCCCATTCCAGGG - Intergenic
1062712752 9:137985677-137985699 CTTGCAGTCCCTCCATTCCAGGG + Intronic
1187556624 X:20358087-20358109 CAGGCTGTGCATCCATTCCCTGG + Intergenic
1187664254 X:21586456-21586478 CTGTCTCTGCCTCCATTCCTTGG - Intronic
1189161179 X:38810711-38810733 ATGGCTCTGATCCCATTCCAGGG + Intergenic
1189192671 X:39123895-39123917 CAGGCTGTGCACCCATTCATTGG - Intergenic
1190070044 X:47272181-47272203 GTGGCTGTGTCCCCAGCCCAGGG - Intergenic
1191754909 X:64582481-64582503 CTGGCTGAACTCCCCTTCCAGGG + Intergenic
1193299094 X:79867843-79867865 CTTGCTGTGAGCCCAATCCAAGG - Intergenic
1200062139 X:153488426-153488448 CTCGCCTTGCTCCCATTCCATGG + Intronic
1201570983 Y:15414233-15414255 CTCTCTCTGCCCCCATGCCAAGG - Intergenic
1202173778 Y:22079125-22079147 CAGGCTGAGCTCTCATTCCATGG + Intronic
1202217583 Y:22507257-22507279 CAGGCTGAGCTCTCATTCCATGG - Intronic
1202325602 Y:23688802-23688824 CAGGCTGAGCTCTCATTCCATGG + Intergenic
1202545169 Y:25981252-25981274 CAGGCTGAGCTCTCATTCCATGG - Intergenic