ID: 1007607139

View in Genome Browser
Species Human (GRCh38)
Location 6:43125267-43125289
Sequence AACATCAAAGCTGGCCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007607139_1007607145 -2 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607145 6:43125288-43125310 TTTCCCAGGCCCAGTCGTTGGGG No data
1007607139_1007607152 7 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607152 6:43125297-43125319 CCCAGTCGTTGGGGCACAGGGGG 0: 1
1: 1
2: 0
3: 6
4: 136
1007607139_1007607154 17 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607154 6:43125307-43125329 GGGGCACAGGGGGCTCTGAGTGG 0: 1
1: 0
2: 10
3: 45
4: 537
1007607139_1007607150 6 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607150 6:43125296-43125318 GCCCAGTCGTTGGGGCACAGGGG 0: 1
1: 0
2: 1
3: 9
4: 158
1007607139_1007607155 25 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607155 6:43125315-43125337 GGGGGCTCTGAGTGGCAGTCTGG 0: 1
1: 0
2: 1
3: 18
4: 287
1007607139_1007607149 5 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607149 6:43125295-43125317 GGCCCAGTCGTTGGGGCACAGGG No data
1007607139_1007607156 26 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607156 6:43125316-43125338 GGGGCTCTGAGTGGCAGTCTGGG No data
1007607139_1007607148 4 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607148 6:43125294-43125316 AGGCCCAGTCGTTGGGGCACAGG 0: 1
1: 0
2: 2
3: 2
4: 117
1007607139_1007607144 -3 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607144 6:43125287-43125309 GTTTCCCAGGCCCAGTCGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 82
1007607139_1007607143 -4 Left 1007607139 6:43125267-43125289 CCCTCGGGGCCAGCTTTGATGTT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1007607143 6:43125286-43125308 TGTTTCCCAGGCCCAGTCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007607139 Original CRISPR AACATCAAAGCTGGCCCCGA GGG (reversed) Intronic