ID: 1007607163

View in Genome Browser
Species Human (GRCh38)
Location 6:43125378-43125400
Sequence CAGCACCCACTCCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 397}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007607163_1007607170 -10 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607170 6:43125391-43125413 GTGGGTGCTGGAGGCTGAGCTGG 0: 1
1: 0
2: 6
3: 126
4: 940
1007607163_1007607173 -7 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607173 6:43125394-43125416 GGTGCTGGAGGCTGAGCTGGGGG No data
1007607163_1007607178 13 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607178 6:43125414-43125436 GGGTGGCCGAGGCTGAGCTGGGG 0: 1
1: 0
2: 5
3: 63
4: 575
1007607163_1007607177 12 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607177 6:43125413-43125435 GGGGTGGCCGAGGCTGAGCTGGG No data
1007607163_1007607171 -9 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607171 6:43125392-43125414 TGGGTGCTGGAGGCTGAGCTGGG 0: 1
1: 0
2: 7
3: 82
4: 765
1007607163_1007607174 -4 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607174 6:43125397-43125419 GCTGGAGGCTGAGCTGGGGGTGG No data
1007607163_1007607176 11 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607176 6:43125412-43125434 GGGGGTGGCCGAGGCTGAGCTGG 0: 1
1: 0
2: 3
3: 75
4: 587
1007607163_1007607172 -8 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607172 6:43125393-43125415 GGGTGCTGGAGGCTGAGCTGGGG 0: 1
1: 0
2: 6
3: 135
4: 829
1007607163_1007607175 2 Left 1007607163 6:43125378-43125400 CCCAGCCCCAGGAGTGGGTGCTG 0: 1
1: 0
2: 4
3: 57
4: 397
Right 1007607175 6:43125403-43125425 GGCTGAGCTGGGGGTGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007607163 Original CRISPR CAGCACCCACTCCTGGGGCT GGG (reversed) Intronic
900351156 1:2235337-2235359 CAGAACCCACTCCAGGGGCCAGG - Intronic
900563758 1:3322436-3322458 CAGCTCCAGCTCCTGGGCCTCGG + Intronic
901838560 1:11939457-11939479 GACCACCCACGCCTTGGGCTGGG + Intronic
902252786 1:15166296-15166318 CAGCTGCCACTCCTGGTGGTTGG + Intronic
902930282 1:19726286-19726308 CATCACCCACACCTGGGTCATGG - Intronic
902984728 1:20148583-20148605 AGGCACCCATGCCTGGGGCTGGG - Exonic
903606808 1:24580811-24580833 CACCACTCACTCCTGAGTCTGGG + Intronic
903656045 1:24949449-24949471 CAGCACCCACACCAAGGACTTGG + Intronic
903737212 1:25537586-25537608 CAGCAGCCCCTAATGGGGCTGGG - Intergenic
904201950 1:28825677-28825699 AAGAACCCACTTCTTGGGCTGGG - Intronic
904318646 1:29682327-29682349 CAGCACCCCCTCACTGGGCTGGG + Intergenic
904772437 1:32887644-32887666 CAGCTCCCTCTCCTGGGACCTGG + Intronic
904969082 1:34404987-34405009 CAGGACCCACTGCTGGAGCTGGG + Intergenic
905267744 1:36766396-36766418 CAGCACCAGTTCCTGGGGCTGGG - Intergenic
905869605 1:41395502-41395524 ACACACACACTCCTGGGGCTGGG - Intergenic
906044379 1:42816999-42817021 CAGCAGCCGCTCCTGGGGCCAGG + Intronic
906204958 1:43981719-43981741 CTGCACCCGCTCCAGGGGCATGG - Exonic
907489878 1:54801985-54802007 CAGCTCCCACTCCTCCAGCTTGG + Intergenic
910431360 1:87162494-87162516 CAGCCCCTACTACTGTGGCTGGG - Intronic
911197291 1:95007407-95007429 CACCACCCTTTCCAGGGGCTTGG + Intronic
912654353 1:111472337-111472359 CAGCAACCAACCCTGGGCCTAGG + Intergenic
912933616 1:113984620-113984642 CAGCAGCCCCTCCTGGTTCTTGG - Intergenic
913010178 1:114675604-114675626 CAATGTCCACTCCTGGGGCTTGG + Exonic
914462392 1:147897317-147897339 CAGGACCCAGGCCAGGGGCTGGG - Intergenic
915330264 1:155107227-155107249 GATCCCCCACTCCTGGGGTTGGG - Intergenic
915727120 1:158025815-158025837 CAGCAGCCTCTCCTGGGGAGTGG - Intronic
919672985 1:200354942-200354964 AACCACCCACTCCTGGGTCCGGG + Intergenic
920052607 1:203172781-203172803 CAGCACCCACCCCAGGGGACAGG - Intronic
920100128 1:203512134-203512156 CACCACCCACCCCTGGGGGGTGG - Intergenic
922152328 1:223017069-223017091 CGGCGCCCACTGCTGGGTCTTGG + Intergenic
922211133 1:223487630-223487652 CAGCACACTCTCCTGGAGCCTGG - Intergenic
924708379 1:246516281-246516303 CAGCACCCAATGCTGGGGGCGGG - Intergenic
924708402 1:246516343-246516365 CAGCACCCAATGCTGGGGGGGGG - Intergenic
1063213987 10:3907465-3907487 CAGCCCCCTCTCCAGAGGCTAGG - Intergenic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1066298949 10:34079983-34080005 CAACACCCAACACTGGGGCTTGG - Intergenic
1066459421 10:35600189-35600211 CAGCATGCCCTCCTGTGGCTTGG + Intergenic
1069495600 10:68900982-68901004 CAGTACGCACTGCTAGGGCTGGG - Intergenic
1070539784 10:77407800-77407822 AAGCACCCGCTGATGGGGCTGGG + Intronic
1070540710 10:77413329-77413351 CAGCCCCGAATGCTGGGGCTGGG + Intronic
1071060971 10:81570698-81570720 CAGCAAACACTCCTGAGCCTGGG + Intergenic
1071958331 10:90783214-90783236 TAGCAGGCACTCATGGGGCTAGG - Intronic
1072679817 10:97498724-97498746 CAGCACCGCCCCCTAGGGCTGGG - Intronic
1073139886 10:101240031-101240053 CAGCCCCCACTCCCAGGGATGGG - Intergenic
1073179264 10:101574100-101574122 CAGCCCCCTCTGCTGGGCCTTGG - Intronic
1073614305 10:104977450-104977472 CAGCACCCAGTCCTCTTGCTTGG - Exonic
1074764609 10:116691564-116691586 GAACACCCACGCCTGGGGCCTGG - Intronic
1076022992 10:127089575-127089597 CAGCCCCCTCTCCTGGGGGAGGG - Intronic
1076670836 10:132120363-132120385 CAGCAGCCACCCCTGGGGGAAGG - Intronic
1076722605 10:132399234-132399256 CAGCACCCACACTTGGGGACTGG - Intronic
1077109584 11:856180-856202 CAGCACCCACCCAAGAGGCTCGG - Intronic
1077149356 11:1062562-1062584 CAGCTTCCACTCCCAGGGCTGGG - Intergenic
1077200408 11:1304167-1304189 CAGCAGCCACTCCAGGAGCCAGG + Intronic
1077225579 11:1437816-1437838 CAGGCCCCATTCCTGAGGCTGGG + Intronic
1077813026 11:5658029-5658051 AAGCCTCCACTCCTGGGGCCTGG + Intergenic
1078428804 11:11271590-11271612 CAGCTCCTACCCCAGGGGCTGGG + Intronic
1079071871 11:17353800-17353822 CAGCACCAACGCCTGGTTCTGGG - Intronic
1079087798 11:17459753-17459775 TAGCATCCACTTCGGGGGCTGGG - Intronic
1080443081 11:32313340-32313362 CAGCACCCGCCCCTGGGGAGGGG + Intergenic
1080899096 11:36470627-36470649 CCTCACCCACTCCAGGGACTCGG - Intergenic
1082641201 11:55663709-55663731 AAGTACTCAGTCCTGGGGCTAGG + Intergenic
1083026933 11:59559083-59559105 CAGCACCCAATCGTGAGGCAGGG - Intergenic
1083075346 11:60031623-60031645 GAGCTCCCACTCCTGGTGCTTGG - Intergenic
1083639515 11:64137852-64137874 CAGCATCCCCTGCTGTGGCTTGG + Intronic
1083663238 11:64261783-64261805 CTGCACCCTGGCCTGGGGCTTGG + Intronic
1083706226 11:64518224-64518246 CTGCAGCCCCTCCTGGTGCTTGG - Intergenic
1083889484 11:65588833-65588855 CAGCAGCCGCTCCTGGGTGTGGG + Intronic
1084195547 11:67522218-67522240 CATCACCCTCTTCTGGGGCAGGG + Intronic
1084410122 11:69002010-69002032 CTGCACCAACTCCTGGAGGTCGG + Intergenic
1084452979 11:69251074-69251096 CGGCCCACATTCCTGGGGCTCGG - Intergenic
1084514157 11:69626943-69626965 CTGCAAACACTCCTGAGGCTGGG - Intergenic
1088396729 11:109377556-109377578 CAACACCCACTCCTGGTTCCTGG + Intergenic
1088794355 11:113255396-113255418 CATCACTCACCCCTGGGACTGGG - Intronic
1088803378 11:113328160-113328182 AAGCCACCACTCCTGGTGCTTGG + Intronic
1088888227 11:114024366-114024388 CAGGGCCCACTCCTGGTGCCTGG + Intergenic
1089593647 11:119560873-119560895 CTGCACCCCATCGTGGGGCTGGG + Intergenic
1089615692 11:119693501-119693523 CACCTTCCACTCCTGGGCCTTGG - Intronic
1089659514 11:119976946-119976968 CAGCACCCTGTGCTGGGTCTAGG - Intergenic
1090387936 11:126367275-126367297 CAGCAGCGTCTCCTGAGGCTGGG + Intronic
1090390575 11:126384721-126384743 CAGCAGCATCTCCTGAGGCTGGG + Intronic
1091030196 11:132179767-132179789 CAGCAGGGACTCATGGGGCTTGG + Intronic
1091367146 11:135031772-135031794 CAACACTCACTCCTGCTGCTTGG - Intergenic
1091622733 12:2101555-2101577 CTGCCCCTACTCCTGAGGCTCGG - Intronic
1094161728 12:27397930-27397952 CAGCACCCACTACTGCGGACAGG + Intronic
1095905154 12:47369724-47369746 CAGCATCCACTTCTGGAGCTGGG - Intergenic
1096499670 12:52057052-52057074 CAGCACCAGCTCCTGGAACTAGG - Exonic
1097899975 12:64862907-64862929 CAGCACCTTCTCTAGGGGCTGGG - Intronic
1098311886 12:69156909-69156931 CAGCTACCACCCCTAGGGCTAGG + Intergenic
1100899592 12:99222861-99222883 CAGCACTTACTCTTGGGACTTGG + Intronic
1102037021 12:109776537-109776559 CACCCCTCAATCCTGGGGCTTGG + Intergenic
1102239455 12:111314979-111315001 CAGCACTTTCTCCTGGGGGTCGG + Intronic
1102533721 12:113565723-113565745 CAGCTTCCCCTCCTGGAGCTGGG - Intergenic
1103013598 12:117476739-117476761 CTGCACCTACTACTGGGTCTCGG - Intronic
1103272918 12:119688389-119688411 CAGCACCCGCTCCAGAGCCTGGG + Intronic
1104205598 12:126635403-126635425 CACCTCCCACCCATGGGGCTGGG - Intergenic
1104205615 12:126635463-126635485 CACCTCCCACCCATGGGGCTGGG - Intergenic
1104429153 12:128702820-128702842 CAGCACCCACTCCATGGACGGGG - Intronic
1104728545 12:131092696-131092718 GAGCACCCGCTCCTGGGGCCTGG + Intronic
1106632004 13:31484233-31484255 CATCTACCACTTCTGGGGCTGGG + Intergenic
1107603452 13:42036994-42037016 CACCACTCACTTCTGGGTCTGGG + Intergenic
1107862414 13:44673462-44673484 GTGCACCAACTGCTGGGGCTTGG - Intergenic
1107893014 13:44930647-44930669 CAGCAATCACCCTTGGGGCTGGG - Intergenic
1113485077 13:110647182-110647204 CAGCAGCTGCTCCTGGGGCTGGG - Exonic
1113812982 13:113153541-113153563 CAGCACCCACCCCGGGGGTCCGG - Intergenic
1113902257 13:113803830-113803852 CTGCCCGCACCCCTGGGGCTGGG - Intronic
1114351375 14:21855171-21855193 CAGTCCCTACTCCTAGGGCTGGG - Intergenic
1114655789 14:24314900-24314922 CAGCACCTAGACCTGGGGCCAGG + Exonic
1117569336 14:57030833-57030855 CAGCTACCACTACTAGGGCTGGG + Intergenic
1117899434 14:60516535-60516557 GAGCACCTACTACTTGGGCTAGG - Intergenic
1118822036 14:69352131-69352153 CAGCTGCCACTGCTGGGCCTGGG - Exonic
1119724473 14:76913823-76913845 CAGCACCCACCCTAGGGACTGGG + Intergenic
1121016736 14:90553475-90553497 CAGCACCCCCTCCAGGGACCAGG + Intronic
1122113903 14:99518320-99518342 CAGGCCCCACCCCTGAGGCTAGG + Intronic
1122128912 14:99593829-99593851 CTGCACCCATCTCTGGGGCTGGG + Intronic
1122259198 14:100502467-100502489 CAGCTCCCTCTCCTGGAGCTGGG + Intronic
1122309865 14:100787683-100787705 CAGCTCCCTCTCCTAGGGCCTGG - Intergenic
1122943065 14:104991691-104991713 CTGCACCCACCCCTTGGGCGCGG - Intronic
1123059465 14:105587949-105587971 CACCACCACCTCCTGGGGCTCGG + Intergenic
1123083800 14:105708219-105708241 CACCACCACCTCCTGGGGCTCGG + Intergenic
1123224005 14:106883322-106883344 CAGCGCCCACTGCTGGCGCCGGG - Intergenic
1124375068 15:29124562-29124584 CAGCCCCCATTCCCGGGGGTGGG + Intronic
1124410588 15:29433149-29433171 CAGCCACCAGTGCTGGGGCTGGG - Intronic
1124989088 15:34652942-34652964 CTGCCTCCACTCCTGGGGCCAGG + Intergenic
1125022094 15:34995960-34995982 CAGCCCCCACTGCAGTGGCTGGG + Intergenic
1125411930 15:39415306-39415328 CAGCAACCTCACCTGGGGCGAGG + Intergenic
1125756990 15:42071017-42071039 CAGCATCCACTTCTGGGGTGTGG - Intronic
1127142728 15:55993749-55993771 CGGCGCGCGCTCCTGGGGCTGGG + Intergenic
1128260001 15:66226732-66226754 CAGCATCCACTGGGGGGGCTTGG + Intronic
1128682513 15:69662147-69662169 CAGCACCCTCTCTCGGTGCTGGG - Intergenic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1129670773 15:77606566-77606588 CAGCACCCAGAGCTGGGGCTGGG - Intergenic
1129741542 15:77991990-77992012 CAGCAGCCAGCCCTGGGCCTGGG - Intronic
1129786524 15:78313689-78313711 CAGCCCCTACTCCTGTGGCATGG - Intergenic
1129844117 15:78760414-78760436 CAGCAGCCAGCCCTGGGCCTGGG + Intronic
1130342572 15:83011778-83011800 CAGCTCCACTTCCTGGGGCTCGG - Intergenic
1130897301 15:88181452-88181474 CTGCTCCCACTCCTGAGCCTGGG + Intronic
1131199599 15:90385847-90385869 CAGCACCCGCTCCTTAGGCCAGG - Intergenic
1131551792 15:93363710-93363732 CAGGGCCCACTCCTGGAGCTGGG + Intergenic
1132044665 15:98553521-98553543 CAGCCCCAATTCCTGGTGCTGGG + Intergenic
1132484238 16:181856-181878 CTGCACCCATTCCTGGACCTGGG - Intergenic
1132602373 16:779441-779463 CAGCACTTCCTCCTGAGGCTGGG + Intronic
1132668717 16:1094111-1094133 CAGCACCCAGGCCAGGGGCTGGG + Intronic
1132735194 16:1382471-1382493 CAGCGCCCAGTGGTGGGGCTTGG - Intronic
1132903715 16:2271759-2271781 CAGGCCCCGCTCCTGGGGCCGGG - Intergenic
1133103613 16:3493697-3493719 CAGCGCCCAGGCCTGGGCCTCGG - Exonic
1133217065 16:4299071-4299093 CAACACTCCCTCCAGGGGCTGGG - Intergenic
1133267659 16:4594558-4594580 CTGGTCCCACACCTGGGGCTGGG - Intronic
1134237569 16:12479348-12479370 CATAACCCACTCCTGGCACTTGG + Intronic
1135678582 16:24438188-24438210 CAGCACCCCCTCTTCTGGCTGGG + Intergenic
1136113093 16:28077322-28077344 CAGGACCCACGCCTGGAGCTGGG + Intergenic
1136142733 16:28297890-28297912 CCTCACCCACACCTGGGGCAGGG - Intronic
1136147788 16:28325718-28325740 CAGCCCCCACGCCTGGGACAGGG + Intergenic
1136366506 16:29811590-29811612 CTGCTCCCAGTCCTAGGGCTCGG - Intronic
1136543540 16:30942492-30942514 CAGCAGCAACTCCCGGAGCTGGG - Exonic
1139054161 16:63161384-63161406 CAGCTCCCAGTTCTGGAGCTGGG + Intergenic
1139447536 16:67007078-67007100 CAGCTCCCAGTACTGGGGCTGGG - Intronic
1139787867 16:69408459-69408481 CAGCTTCTTCTCCTGGGGCTGGG - Intronic
1139890942 16:70252989-70253011 CATCACCCACTCCTTGCCCTGGG + Intronic
1140833795 16:78775034-78775056 CAGCCCTCACTCCTGAGGGTGGG + Intronic
1140914534 16:79482668-79482690 CACCACCCCATCCTGGGGCAGGG - Intergenic
1141627373 16:85268439-85268461 TAGGACCCACACCTGGGGCAGGG - Intergenic
1141677061 16:85523587-85523609 CAGCCCCCACGGCTGGGGCCAGG - Intergenic
1142103802 16:88291272-88291294 CAGCAGGGACTCCAGGGGCTCGG + Intergenic
1142715446 17:1744811-1744833 CGGCTCCCACTCCTGCAGCTGGG - Intronic
1143027694 17:3950845-3950867 CAGAACCCAAGGCTGGGGCTGGG + Intronic
1143119754 17:4599461-4599483 CAGCACCCACCCCAGCGGCAAGG + Intronic
1143119762 17:4599490-4599512 CAGCACCCACTCCAGCGGCGAGG + Intronic
1143166050 17:4897736-4897758 CACCAGCCACTCCAGGGGCAGGG + Exonic
1143348767 17:6271260-6271282 CAGCACCTACAGCTGGGGCCAGG - Intergenic
1143542428 17:7577558-7577580 CAGCTTCCACTCCTGGAGGTTGG - Exonic
1143596302 17:7916252-7916274 GAGCACACTCTCCTGGGGCCGGG + Intergenic
1143598984 17:7931864-7931886 CCGCCCCCACTCCTTGGGCTCGG + Exonic
1143948744 17:10616680-10616702 CAGTACCCACTCCTGCCTCTAGG + Intergenic
1144776390 17:17787119-17787141 GGGCAGGCACTCCTGGGGCTTGG + Intronic
1146256921 17:31397045-31397067 CAGGAGCCAGCCCTGGGGCTGGG + Intronic
1146258446 17:31405251-31405273 CAGCACCCAGTCATGGAGGTGGG - Intronic
1146700639 17:34956607-34956629 CAGGATCCACTCCTTGAGCTGGG - Intronic
1146729249 17:35180336-35180358 CAGAACCCACTGCTGTGGCCAGG + Intronic
1147614781 17:41821548-41821570 CAGTTTCCCCTCCTGGGGCTGGG - Intronic
1147649096 17:42051777-42051799 CAGCAGCCACTGGTGGGGCTGGG - Intronic
1148122575 17:45221723-45221745 CAGCCCGCCCCCCTGGGGCTGGG + Intronic
1148123833 17:45226878-45226900 CAGCACCTGATCCTGGGGCTGGG + Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1149133760 17:53340314-53340336 CATCTGCCACTGCTGGGGCTTGG + Intergenic
1149561340 17:57609857-57609879 CAGCACCCACTCTCCTGGCTTGG + Intronic
1149638199 17:58186723-58186745 CAGAACCCGCTGCTGGGCCTGGG - Intergenic
1150465159 17:65386452-65386474 CAGCAGCCACTACTGAGGCTTGG + Intergenic
1151307580 17:73273111-73273133 CAGCACCCCCTCCAGGGTCAGGG - Intergenic
1151343033 17:73484132-73484154 CAGCTCCCACTCCTGGGGTTGGG + Intronic
1151407830 17:73900915-73900937 CAGCACCCATTCCTGGAGACTGG - Intergenic
1151730186 17:75906385-75906407 GAGACCCCTCTCCTGGGGCTGGG - Intronic
1152242566 17:79168012-79168034 CCTCACCCAGCCCTGGGGCTGGG - Intronic
1152252190 17:79218032-79218054 CAGGACCCACTCTGGGAGCTGGG + Intronic
1152331885 17:79678297-79678319 GAGCAGCCATTCCTGGGGCACGG - Intergenic
1152377354 17:79925633-79925655 CGGCACCTACTTGTGGGGCTGGG + Intergenic
1152524631 17:80880502-80880524 CAGCACGCTCTCCACGGGCTTGG + Intronic
1152556098 17:81053996-81054018 CAGCTCCCACCCTTGGGGCCAGG - Intronic
1152556126 17:81054091-81054113 CAGCTCCCACCCTTGGGGCCAGG - Intronic
1152556183 17:81054282-81054304 CAGCTCCCACCCTTGGGGCCAGG - Intronic
1152615131 17:81334420-81334442 GTGGACCCAATCCTGGGGCTTGG - Intergenic
1152659654 17:81536365-81536387 CAGCACCCGTTCCGTGGGCTGGG - Intronic
1152718646 17:81911697-81911719 CACCGCCCACACCTGGCGCTCGG + Intergenic
1152742319 17:82023693-82023715 CAGGACAGCCTCCTGGGGCTCGG - Exonic
1152875968 17:82786403-82786425 CAGCACCCACACTCGGGGCAGGG - Intronic
1153801823 18:8677950-8677972 CAGCTCCCACTGCTGCGGTTTGG - Intergenic
1154304404 18:13219280-13219302 CAGCAACCATTCCTGTGCCTGGG - Intronic
1155142191 18:23053756-23053778 CGGCTACCACCCCTGGGGCTGGG + Intergenic
1156019736 18:32586212-32586234 CCACATCCACTCATGGGGCTGGG + Intergenic
1156333782 18:36150548-36150570 CAGCAACAACTACTGGGGTTTGG - Intronic
1156651975 18:39235614-39235636 CAGAACCCACGCCGGGGGCCGGG - Intergenic
1157238096 18:45982788-45982810 CAGAACACACAACTGGGGCTGGG - Intergenic
1157592295 18:48843096-48843118 CAGGGGCCAGTCCTGGGGCTTGG - Intronic
1158435149 18:57430271-57430293 CAGCCCCCAGTCCTGGGGACCGG + Intergenic
1159947382 18:74454458-74454480 CAGCCCCCGCTACTGGGGGTGGG + Intronic
1160468842 18:79108022-79108044 CAGCACACACTCCTAGTGCCAGG - Intronic
1160497707 18:79384870-79384892 CAGCACCTGCACCTGAGGCTCGG - Intergenic
1160734774 19:657522-657544 CAGCACCCACTCCAGCGTCGGGG + Intronic
1161039179 19:2100868-2100890 CACCATCCAGGCCTGGGGCTCGG - Intergenic
1161770966 19:6230478-6230500 CAGCACCGACACCTCTGGCTGGG + Intronic
1162019856 19:7863413-7863435 CAGCAGCCGCACCTGGGGCGGGG - Exonic
1163125148 19:15240482-15240504 CAAGACCCAGTCCTGGGGGTGGG + Intronic
1163211031 19:15840463-15840485 AAGCACCCTCTCTTGGGGTTTGG - Intergenic
1163313998 19:16530595-16530617 CAGAGCCCAGCCCTGGGGCTTGG - Exonic
1163641031 19:18462060-18462082 CACCTCCCACTTCTGAGGCTGGG - Intronic
1163690452 19:18735716-18735738 GAGCTCCCAGTCCTGGGCCTTGG + Intronic
1164438549 19:28253403-28253425 CAGAGCCCACCCCTGGGGCTGGG - Intergenic
1164570808 19:29372982-29373004 GAGCACACAGTCCTGGGGGTTGG + Intergenic
1164708864 19:30340076-30340098 CAGCAGACACTCCTGGAGCTGGG - Intronic
1166962618 19:46507924-46507946 TAAAACCCACTCCTGGGGCGGGG + Intronic
1167053580 19:47095106-47095128 CAGCAGGCAATCCTGGGCCTGGG - Intronic
1167667240 19:50829947-50829969 CAGCACCCAGACACGGGGCTGGG + Intronic
1168103824 19:54155034-54155056 GTGCACTCACACCTGGGGCTGGG + Intronic
1168162230 19:54518947-54518969 CAGCAACATCTCCTGGGACTCGG + Intergenic
925040630 2:731128-731150 CAACACCCACCTCTGTGGCTGGG - Intergenic
925276198 2:2649918-2649940 CAGCTCCCACGGCTGGGTCTAGG - Intergenic
927131791 2:20066362-20066384 CAGCACCCAGCCCTGGACCTGGG + Intergenic
927465453 2:23332957-23332979 CAGCACCAACACCTGTGGCTGGG + Intergenic
927518868 2:23687512-23687534 CAGGAGCCCCTCCTGGGGCCGGG + Intronic
927871782 2:26628665-26628687 CTGCAGCCACTCCTGGAGCTGGG + Intronic
927936470 2:27079250-27079272 CACCACCCAAGCCTCGGGCTGGG - Intronic
929452571 2:42047491-42047513 CAGCGCTCCCTCCTGGGACTGGG - Intergenic
929881512 2:45841014-45841036 CAGCACACACTCGTGGAGGTGGG - Intronic
931220794 2:60286228-60286250 CAGCACCCCAGCCAGGGGCTTGG - Intergenic
932898999 2:75676363-75676385 CAGCTTCCACTCCTTGGTCTTGG + Intronic
933755087 2:85632171-85632193 CAGCATTCACTCATGGTGCTAGG + Intronic
934764957 2:96875500-96875522 CTGCCCCCACTCCTGAGGCTGGG + Intergenic
934853255 2:97714184-97714206 CAGCTCCCCCTCCAGAGGCTTGG + Intronic
935112068 2:100103977-100103999 CAGCACCAACTCCAGGGGGTCGG + Intronic
935733399 2:106085194-106085216 GAGCAGCCACTCATGGGGCCTGG - Intergenic
936122904 2:109761174-109761196 CAGCACCAACTCCAGGGGGTCGG - Intergenic
936221784 2:110610290-110610312 CAGCACCAACTCCAGGGGGTCGG + Intergenic
936270629 2:111046009-111046031 CTGCACCCTCTCCTGAGGCCAGG + Intronic
937215285 2:120308751-120308773 CAGGACTCAGTTCTGGGGCTGGG + Intergenic
937317991 2:120944079-120944101 CAGCACCCACTCCGAGGGTCTGG + Intronic
937988002 2:127647237-127647259 CAGCACCCCCTCCTGGCCCTGGG - Intronic
938133735 2:128737213-128737235 CAGCACCCTGGCCTGGGTCTCGG - Intergenic
938408157 2:131044201-131044223 CAGCAGCCCCTCCTATGGCTGGG + Intronic
938540491 2:132280485-132280507 CAACAGGCATTCCTGGGGCTTGG + Intergenic
940789462 2:158016627-158016649 CTGCACCCAGCCCTGGGTCTAGG + Intronic
941524704 2:166592549-166592571 CCGAACCCACTACTGGGGGTTGG - Intergenic
943520574 2:188944487-188944509 CAGCGCCCACTGGTGAGGCTCGG + Intergenic
945251078 2:207767231-207767253 GAGCACCCAGTACTCGGGCTTGG + Exonic
946127831 2:217579872-217579894 CATTACCCACACCTGGGGCCAGG - Intronic
946202108 2:218076464-218076486 CAGCAGCTGCTCCTGGCGCTGGG - Exonic
946235912 2:218324134-218324156 CACCACCCTCCCCTGGGGCCAGG - Intronic
946373990 2:219297280-219297302 CAGCACCCCGTCCTGGTGCGAGG - Exonic
947715146 2:232335564-232335586 CAGCCCCCACCCCTGGCCCTTGG + Intronic
947734221 2:232446515-232446537 CAGCCCCCACCCCTGGCCCTTGG + Intergenic
948674138 2:239587310-239587332 CCGAAACCATTCCTGGGGCTGGG - Intergenic
948829327 2:240590313-240590335 CAGCAGCCCCTCCTGCTGCTGGG - Intronic
948835700 2:240625060-240625082 CTGCACCCTGTCTTGGGGCTGGG + Intronic
949053913 2:241914327-241914349 CAGCATCCCCACCTGGGCCTGGG - Intergenic
1169074083 20:2750882-2750904 AAGCACTCACTTCTGGGGATCGG - Intronic
1169321968 20:4640520-4640542 CAGCAGCCCCTCCTGAGCCTAGG - Intergenic
1169383240 20:5126920-5126942 CAGCAGCCAGCCCTGGAGCTCGG - Exonic
1169939337 20:10919908-10919930 CAGCACCCACCCGAGGTGCTTGG - Intergenic
1171335259 20:24379777-24379799 CAGCAGCCACTCCCAGGGCATGG - Intergenic
1173182616 20:40816092-40816114 CAGCAGCCCCTCCTGGGCCCAGG - Intergenic
1174080381 20:47967217-47967239 CACAGCCCACTGCTGGGGCTGGG + Intergenic
1174082261 20:47978946-47978968 CAGCTGCCACTCATGAGGCTGGG - Intergenic
1174137212 20:48388056-48388078 CACAGCCCACTGCTGGGGCTGGG - Intergenic
1175118930 20:56703499-56703521 CAGAACCAACTCCTAGAGCTGGG - Intergenic
1175846668 20:62063428-62063450 CAGCACCCACCACGGCGGCTGGG + Intronic
1175870613 20:62207866-62207888 CAGCACCCACTCCTGGGGAGGGG - Intergenic
1175883195 20:62272237-62272259 CTGCATCCTCTCCAGGGGCTGGG - Exonic
1176088443 20:63308483-63308505 CAGCATCCCCTCCTGGTGCTCGG - Intronic
1176428008 21:6560559-6560581 GTGCAGCCCCTCCTGGGGCTGGG + Intergenic
1179189073 21:39108013-39108035 CAGCACTCGCCCCTGGGGCTGGG - Intergenic
1179444893 21:41424349-41424371 CAGGATCCACTCCTAGGGCTGGG - Intronic
1179703499 21:43168876-43168898 GTGCAGCCCCTCCTGGGGCTGGG + Intergenic
1180074226 21:45454683-45454705 CAGCACCCACTGCTGTGCCTGGG + Intronic
1181521764 22:23452411-23452433 CTGCTCCCTCTCCTGGGCCTAGG - Intergenic
1182393639 22:30019879-30019901 CATCACCCAGTTCTGGGTCTTGG - Exonic
1182529806 22:30946570-30946592 CAGCACACAGTCCTGGGACCTGG - Intronic
1182655085 22:31883811-31883833 CAGAAGCCACTCCTGGAACTGGG - Intronic
1183273920 22:36879396-36879418 CAGCTCCCCCTCCTAGGGCAAGG + Intergenic
1183696546 22:39426915-39426937 CAGCACACGTACCTGGGGCTGGG - Exonic
1183927591 22:41217061-41217083 CAGCAGCCACTCCAGGAGCCTGG - Intronic
1184273337 22:43397068-43397090 CAGCAAGAACCCCTGGGGCTGGG + Intergenic
1184513459 22:44946207-44946229 CACCACGTACTTCTGGGGCTCGG + Intronic
1184587859 22:45459808-45459830 CAGCACTCACCCCAGGGGCTTGG + Intergenic
1184665934 22:45989080-45989102 CAGCACCCAGGGCTGAGGCTGGG + Intergenic
1184711125 22:46250116-46250138 CTGCGCCGACTCCTGGCGCTTGG + Intronic
1184783029 22:46658567-46658589 CAGCCCCCAGGCCTGGGGCCAGG + Intronic
1184796203 22:46734525-46734547 CAGCACCTTCTCCTGGGCCCTGG - Intronic
1184907673 22:47499773-47499795 GAGCCCCCACTCCTGGGTATAGG - Intergenic
1185009453 22:48305095-48305117 CTGCGCCCACTGCTGGGGCCAGG + Intergenic
1185070714 22:48654282-48654304 CACCACCCTCCCCTGGGGCTGGG + Intronic
1185278877 22:49961452-49961474 CAGCACCACCTCCAGGGGCACGG - Exonic
949843927 3:8351579-8351601 CAGAACCCAGACCTGGGTCTGGG - Intergenic
950633110 3:14297464-14297486 CACCACCCTCTCCCGGGACTAGG - Intergenic
952945620 3:38476514-38476536 CAGCAACCACACCTGGTGCTCGG - Intronic
953916079 3:46922089-46922111 CAGCATCCACTGCAGAGGCTAGG + Exonic
953930293 3:47002634-47002656 CAGCACCAGCTCCTGGGGTGGGG - Exonic
954108708 3:48422624-48422646 CACCACCCAGTCCTGGGGAGAGG + Intronic
954122453 3:48507475-48507497 CTGCAGTCAGTCCTGGGGCTGGG - Intergenic
954938384 3:54347873-54347895 CAGTACCCTCCCATGGGGCTTGG + Intronic
955224513 3:57049934-57049956 CAGCAACAACTGCAGGGGCTGGG + Intronic
959686429 3:109152294-109152316 CAGCACTCTCTCCTGATGCTGGG - Intergenic
959687148 3:109159864-109159886 CAGCAGTCACTCTAGGGGCTGGG - Intergenic
960148669 3:114230436-114230458 CAGTCCTGACTCCTGGGGCTGGG - Intergenic
960246298 3:115404050-115404072 CAGCACTGACTTCTGGGGCAGGG + Intergenic
960705581 3:120477746-120477768 CAGCCACCATTCCTAGGGCTAGG + Intergenic
962745497 3:138394875-138394897 CAGCACCCACTCCCCGCCCTCGG + Intronic
963038401 3:141051485-141051507 CATCGCCCTCCCCTGGGGCTGGG - Exonic
963924751 3:150939405-150939427 CAGCTACCACCCCTAGGGCTTGG - Intronic
964570635 3:158105312-158105334 CAGCACCCCCTCCTGCAGCCCGG + Intronic
966912627 3:184568090-184568112 CAGCATCCAGTCCTGGGGGCTGG - Intronic
968232948 3:197015135-197015157 CAGCACCCACCCCAGGGGACAGG - Intronic
968451640 4:678794-678816 CAGCACAGGCTCCTGGGGGTGGG - Intronic
969029641 4:4201557-4201579 CAGCAGCCACTCTTGGTGTTTGG - Intronic
969045136 4:4331087-4331109 CAGCACTCACTACTGGTGCCAGG - Intergenic
969617642 4:8262818-8262840 CAGCACCCACAGCTGGGCCTGGG + Intergenic
975586339 4:75954081-75954103 AAGTACCCACGCCTGGGGCCAGG + Intronic
985179106 4:187237366-187237388 CAGCACCAACTCCTTCGACTGGG + Intergenic
985589946 5:759341-759363 CAGCCCCTACTCCTGGGGCCCGG + Intronic
985833174 5:2250864-2250886 CAGCACATCCTCCTGGGGCTGGG + Intergenic
986227336 5:5828217-5828239 CAGCATCCTCTCCCGAGGCTTGG - Intergenic
990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG + Intergenic
991618282 5:68518736-68518758 ACCCAGCCACTCCTGGGGCTGGG - Intergenic
993939266 5:94039697-94039719 CAGAACCCTCTCCTGGGGTCTGG + Intronic
996152615 5:120058312-120058334 CATCACCCACACCTGGGGTGGGG + Intergenic
997521700 5:134527487-134527509 CCCCACCCGCCCCTGGGGCTCGG + Intronic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998132378 5:139657894-139657916 CTGCACCCCATCCTGCGGCTAGG - Intronic
999242364 5:150135377-150135399 TCGCACCCACTCCTTGGTCTGGG - Intronic
999248987 5:150170563-150170585 CAGGTCCCAATCCTAGGGCTGGG - Intronic
999743976 5:154577637-154577659 CACCACTCACTCCTGGGGCCTGG + Intergenic
1000964103 5:167634553-167634575 CAGAAACCACTGCTGGTGCTAGG + Intronic
1001470049 5:172005963-172005985 CAGCACCCACTCCCCAGCCTAGG - Intronic
1001705275 5:173737073-173737095 AAGCCCCCACCCCTGGGGCTGGG + Intergenic
1001972726 5:175969273-175969295 AAGAACCCACTCCTGGGGTCTGG + Intronic
1002093024 5:176815832-176815854 CACCACCCACTGCAGGGACTTGG + Intronic
1002244712 5:177874509-177874531 AAGAACCCACTCCTGGGGTCTGG - Intergenic
1003200686 6:3957571-3957593 CAGCACCTCCTCCTGGAGCCTGG - Intergenic
1006143967 6:31947238-31947260 GAGTGCCCACTCCTCGGGCTGGG - Intronic
1006416064 6:33904574-33904596 CAGCCACCCCTCCCGGGGCTTGG + Intergenic
1006579295 6:35067342-35067364 CAGGACCAACTTCTGAGGCTGGG - Intronic
1007294875 6:40814105-40814127 CAGCACCCATGCCTGGGGGGTGG - Intergenic
1007607163 6:43125378-43125400 CAGCACCCACTCCTGGGGCTGGG - Intronic
1009734936 6:67663677-67663699 CCGCAGCAACTCCTGGGGCAGGG - Intergenic
1017005872 6:150027748-150027770 CAGCCCCCACCCCTGAGGCTGGG + Intergenic
1017155948 6:151322737-151322759 CACCACCCACTCCTGCCACTGGG + Intronic
1017967738 6:159281121-159281143 CTGCACCCACTCCTGGGACCTGG + Intergenic
1019212698 6:170419352-170419374 CAGCACCCACACCCTGGGTTGGG + Intergenic
1019224246 6:170497015-170497037 GAGGACCCAGTCCTGGAGCTGGG - Intergenic
1019256519 7:55958-55980 CAGCTCCCGCTCCTGGTGCCTGG + Intergenic
1019307396 7:342328-342350 CAGCACCAACCGCTGGGGCCTGG - Intergenic
1019589575 7:1824070-1824092 CTGCTCCCTCTCCTGGGCCTAGG + Intronic
1019619056 7:1980633-1980655 CAGCACCCCCGCCCTGGGCTGGG + Intronic
1019706326 7:2498855-2498877 CAGCCCCCACTCCGGGCTCTGGG - Intergenic
1019897611 7:3994941-3994963 GAGAACCCACCGCTGGGGCTGGG + Intronic
1020049626 7:5072911-5072933 CAGCCCCGACTCCTGGGGAAGGG - Exonic
1022494407 7:30844087-30844109 CAGCACCCAGTCCAGGGGGTGGG - Intronic
1023054930 7:36283634-36283656 CAGCACACTCTCCAGGGGGTGGG + Intronic
1023833785 7:44056891-44056913 CAGCACTCACCACTGGGGCCTGG - Exonic
1023984088 7:45085309-45085331 CAGCAGCTCCTCCTGGGGCCAGG - Exonic
1024179835 7:46881069-46881091 CAGCTGCCACTCCTGGAGCTGGG + Intergenic
1024425156 7:49216491-49216513 CAGCTGCCACTCCAGGGTCTGGG + Intergenic
1025097791 7:56110619-56110641 CAGCCCCCACTCAAGGGGATAGG - Intergenic
1026941333 7:74289586-74289608 CTGCACCCCCTCCTGGCGCCGGG - Exonic
1027129286 7:75579777-75579799 CAGGACCCACTCTTGGGGCTTGG - Intronic
1027631555 7:80612010-80612032 CAGCACTCACTGCTTGGCCTTGG - Intronic
1029590378 7:101503150-101503172 CAACACCCAGTTCTGGGGCCTGG - Intronic
1029714696 7:102319571-102319593 CAGCTCCCCCTCCTGGGCTTGGG + Intronic
1030035087 7:105402046-105402068 CAGCACCCATATCTGGGGCTGGG - Intergenic
1030710340 7:112741650-112741672 CAGATACCACTCCTAGGGCTGGG + Intergenic
1031670659 7:124540575-124540597 CAGTACCCATTACTGGGGCATGG - Intergenic
1034273015 7:149812355-149812377 CAGCCCCCACCCCAGGGCCTGGG + Intergenic
1034951661 7:155301094-155301116 CACCACCCAGTACTGGGGCTGGG - Intronic
1035297720 7:157876645-157876667 CAGCGCCCCCACGTGGGGCTGGG + Intronic
1035382480 7:158448614-158448636 CAGCTCCCACTCCTGGGCCAAGG + Intronic
1036164536 8:6420226-6420248 CAGCACCCACTCCAGGGAAGGGG - Intronic
1037116719 8:15236933-15236955 CTGCTCCCGCGCCTGGGGCTAGG + Intronic
1037154533 8:15684194-15684216 CCCCACCCACCCCTGGGGCAAGG - Intronic
1037510331 8:19576046-19576068 CAGCACCCACTCCCGTCTCTCGG - Intronic
1037753147 8:21695693-21695715 CAGCACCAAGTCCTGGGGAGTGG - Intronic
1037952302 8:23027433-23027455 CAGGACCCGCTGCTGGGGCCAGG + Intronic
1037963783 8:23118008-23118030 CAGGACCCGCTGCTGGGGCCAGG - Intergenic
1039522601 8:38184112-38184134 CAGCTACAATTCCTGGGGCTGGG + Intronic
1040276005 8:46013968-46013990 CATCACCCAGTACTGGGGCCTGG - Intergenic
1041007455 8:53509046-53509068 CAGCACCAACACCTGCAGCTTGG - Intergenic
1041205401 8:55494232-55494254 CAGCACCCACAGCTGGCACTAGG + Intronic
1042224929 8:66508024-66508046 CAGTCCCCAGTCCTGGGCCTGGG + Intronic
1042530497 8:69810113-69810135 CAGAACCCCCACCTGGGCCTGGG - Intronic
1042875738 8:73438595-73438617 CAGCTTCCACTCCCTGGGCTTGG - Intronic
1046526329 8:115386274-115386296 AAGAACCCTCTCTTGGGGCTTGG - Intergenic
1046693144 8:117308527-117308549 CAGTATCCATTCCTGTGGCTTGG - Intergenic
1048017291 8:130508842-130508864 ACCCACACACTCCTGGGGCTGGG - Intergenic
1048295267 8:133209402-133209424 CAGCACCTTCTCCTGAGTCTGGG + Intronic
1049348819 8:142153224-142153246 CAGAACCCAGCCCTGGGGCATGG + Intergenic
1049487389 8:142873675-142873697 CAACACCCACTCCTGGAACAAGG + Exonic
1049578104 8:143398769-143398791 CAGTACCCACAGCTGGGCCTGGG - Intergenic
1049709824 8:144058453-144058475 CACTGCCCACTCCTGGGCCTGGG - Intronic
1049914750 9:306585-306607 CAGCACACCAGCCTGGGGCTGGG + Intronic
1049925861 9:406576-406598 CCTCACCCAGTCCTGGGGCTGGG - Intronic
1050161102 9:2719068-2719090 CATCCCCCACTCCTGGTGGTGGG + Exonic
1050339950 9:4626549-4626571 CAGCTTCCACCCCTAGGGCTGGG - Intronic
1050483148 9:6106838-6106860 CAGCTACCACTCCTGGGGCTGGG + Intergenic
1051369787 9:16348558-16348580 CAGGACCCACCCCTGGAACTGGG - Intergenic
1052327632 9:27232749-27232771 CAGCAACCACTTCTGGGGGTAGG - Intergenic
1053071399 9:35104254-35104276 CAGTCCTAACTCCTGGGGCTGGG - Exonic
1053200533 9:36148916-36148938 CAACCCCCACTCCTCGGCCTGGG - Intronic
1054836258 9:69677234-69677256 CAGCTCCCAGTCCTGGAGCTGGG + Intergenic
1056468627 9:86883791-86883813 CAGATCCCACTCCTGGAGATGGG + Intergenic
1056591548 9:87969275-87969297 CAGCACCTCCTCCAGGGGCATGG + Exonic
1056881377 9:90396914-90396936 CAGCTCCCACTGCTGGGGTAGGG - Intergenic
1057014640 9:91641157-91641179 CAGCTACCATTCCTAGGGCTAGG + Intronic
1057144673 9:92749764-92749786 CAGAAGCCAGTCCTGGGGCCTGG + Intronic
1057442448 9:95091907-95091929 GAGAAGCCACTCTTGGGGCTGGG + Intergenic
1059234417 9:112750424-112750446 CAGCAGCCACGCTTGGGGCTGGG - Intergenic
1059277502 9:113108747-113108769 CAGGACCCACTGCTGGGACCCGG + Intergenic
1059278749 9:113115804-113115826 CAGGACCCACTGCTGGGACCCGG - Intergenic
1060665732 9:125431059-125431081 CAGCCCCTCCTCCTGGGACTAGG - Intergenic
1060826632 9:126691680-126691702 CAGCACCCAGTCCACAGGCTGGG + Intronic
1061048210 9:128178785-128178807 CAGCAACGACACCTGCGGCTGGG + Exonic
1061205238 9:129159201-129159223 CAGCCCCTACTCCTGGTGCTGGG - Intergenic
1061494347 9:130963139-130963161 CAGCACCCAGGCCTAGGGCAAGG + Intergenic
1061804207 9:133129061-133129083 CAACTCCCATGCCTGGGGCTCGG + Intronic
1061912868 9:133734137-133734159 CAGCAGCCACACGTAGGGCTCGG + Exonic
1062161829 9:135084789-135084811 AAGCAGCCACTCCTGGCTCTGGG + Intronic
1062276903 9:135735609-135735631 CAGCACCAACTCCAGGGAGTGGG - Intronic
1062290327 9:135791538-135791560 CCGCACCCACCTCTGGTGCTAGG - Intronic
1062577671 9:137216112-137216134 CAGCACCGGCTCCGGGAGCTGGG + Exonic
1062583485 9:137238337-137238359 GAGGACCAACTCCTGGGCCTGGG - Intergenic
1062627169 9:137448542-137448564 CAGCACACAGGCCTGGGGCTTGG - Exonic
1203788370 EBV:140756-140778 CAGGACCCAGCCCTGGAGCTCGG + Intergenic
1185555623 X:1018853-1018875 CAACACCCTCTCTTGGGGCCAGG - Intergenic
1186733421 X:12434705-12434727 CAGGGCCCACTCCTGGTGCTGGG + Intronic
1187223507 X:17353536-17353558 CCGCTACAACTCCTGGGGCTGGG - Intergenic
1187685666 X:21813496-21813518 CAGCTACCAACCCTGGGGCTGGG + Intergenic
1191252056 X:58264432-58264454 CAGCAGCTACTCCGAGGGCTAGG + Intergenic
1192727626 X:73769013-73769035 CAGCACCCAGGCATGGGCCTGGG + Intergenic
1193323135 X:80148120-80148142 CATAAACCATTCCTGGGGCTAGG + Intergenic
1195151143 X:102071673-102071695 CAGGAACAAGTCCTGGGGCTTGG - Intergenic
1195168911 X:102247008-102247030 CCCCTCCCCCTCCTGGGGCTCGG - Intergenic
1195189946 X:102440078-102440100 CCCCTCCCCCTCCTGGGGCTCGG + Intronic
1196002036 X:110796197-110796219 CAGCCCCCACTCCTTTGGCTAGG + Intergenic