ID: 1007607986

View in Genome Browser
Species Human (GRCh38)
Location 6:43130106-43130128
Sequence ATGGAGAAACGGCCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007607986_1007607989 -8 Left 1007607986 6:43130106-43130128 CCTTCCTCAGGCCGTTTCTCCAT 0: 1
1: 0
2: 1
3: 17
4: 263
Right 1007607989 6:43130121-43130143 TTCTCCATGTATAAACTGAAAGG 0: 1
1: 0
2: 4
3: 43
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007607986 Original CRISPR ATGGAGAAACGGCCTGAGGA AGG (reversed) Intronic
900537798 1:3187391-3187413 ATGGGCAAATGGCCTGAGCAGGG + Intronic
902606507 1:17572268-17572290 ATGGAGCAGGGGGCTGAGGAGGG - Intronic
903249385 1:22041533-22041555 ATTGGGAGAGGGCCTGAGGAAGG - Intergenic
903604189 1:24562921-24562943 CTGGAGAAAGGGCATAAGGAGGG - Intronic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
904379448 1:30101239-30101261 AAGGAGGAAGGGCCTGGGGAGGG + Intergenic
905823905 1:41015181-41015203 CAGGAGAAACGGCCAGAGGCAGG + Intergenic
906348710 1:45038577-45038599 AGGGAGAAAAGGGCTGACGAGGG + Intronic
906714258 1:47955291-47955313 AAGGAGAAAGGGACTGGGGAAGG - Intronic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
910278972 1:85477364-85477386 CTGTAGAAAAGGCCTGAGGGCGG - Intronic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
914902095 1:151716403-151716425 GCGGGGAAAGGGCCTGAGGAGGG + Exonic
915106581 1:153538481-153538503 AAGGAGAGACGCCCAGAGGAGGG - Intronic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067474493 10:46556812-46556834 GTGGGGACCCGGCCTGAGGAGGG - Intergenic
1067978788 10:51057538-51057560 ATTGGGAAATGGCATGAGGAAGG - Intronic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1072161643 10:92772184-92772206 ATGGGAAAAGGGCCTGGGGAGGG + Intergenic
1072547653 10:96452342-96452364 AAGGAAAAAAGTCCTGAGGAGGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1076413170 10:130265923-130265945 ATGGAGACGGGGCCGGAGGAAGG + Intergenic
1076810490 10:132884125-132884147 AAGCAGGAAGGGCCTGAGGAGGG - Intronic
1076843686 10:133058625-133058647 AGTGAGAAACGTCCTGTGGAGGG - Intergenic
1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG + Intronic
1080660096 11:34288843-34288865 ATGCAGGAACGTCCAGAGGAAGG - Intronic
1082777027 11:57253590-57253612 ATGTAGCAAGGGCCTGAGGAAGG + Intergenic
1083293980 11:61705410-61705432 ATGGAGAAAAGGCCAGAGTCAGG - Intronic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1085163678 11:74374756-74374778 AAGGAGAAAGGGCCTGTTGAGGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1089931918 11:122321425-122321447 CTGGAGAAAAGACCTGAGGTGGG + Intergenic
1090568205 11:128018959-128018981 TTGGAGAAAGAGCCTGAGCATGG - Intergenic
1091138276 11:133212469-133212491 ATGGAGCAAAGACTTGAGGAAGG - Intronic
1091448936 12:560857-560879 ATGCACAAAAGGCCTGGGGAGGG + Intronic
1091622475 12:2099787-2099809 ATGGGGAAGCGGCCTCAGGCAGG - Intronic
1096494251 12:52030177-52030199 AGGGAGACAGGGCCTAAGGAAGG - Intronic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1101039245 12:100737348-100737370 CTAGAGCAATGGCCTGAGGAGGG - Intronic
1101755611 12:107618613-107618635 ATGGAAAGATGGTCTGAGGATGG - Intronic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103570016 12:121838823-121838845 ACGGAGAAAGGCCCTGAGGTGGG - Intergenic
1103743179 12:123105091-123105113 AGGGAGAAAGGCCCTGAGGCAGG - Intronic
1105494128 13:20915611-20915633 ATGGACAAAGGGGCTGAGCACGG + Intergenic
1106371612 13:29139882-29139904 ATGGAGAGAGCGCCAGAGGAAGG - Intronic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107624345 13:42267705-42267727 CTGAAGAAACAGCCTGTGGAAGG + Intergenic
1107787226 13:43969237-43969259 AGCAAGAAAGGGCCTGAGGAGGG + Intergenic
1108108717 13:47043825-47043847 GTGGAGAATCGACCTGAGAAGGG - Intergenic
1108395957 13:49991861-49991883 ATGAAGACAAGGCCAGAGGAAGG - Intergenic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1114845996 14:26322688-26322710 ATGGAGAAACGACTTGACCAAGG - Intergenic
1115476571 14:33820298-33820320 ATGTACAGAAGGCCTGAGGAAGG + Intergenic
1116863794 14:50015387-50015409 CTGCAGAAACGGCCTGCAGAAGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119863413 14:77953691-77953713 ATGGAAACAGGGCATGAGGAAGG - Intergenic
1120686514 14:87544049-87544071 ATGGAGGAGCTGCCTGAGAAGGG + Intergenic
1121816451 14:96932639-96932661 ATGAAGACATGGTCTGAGGATGG + Intergenic
1122557591 14:102590090-102590112 AGGGAGAAATGGCCAGAGGCAGG + Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1124379737 15:29155467-29155489 ATGAAGAAACGACCTGAGTCTGG - Intronic
1124866018 15:33492021-33492043 AAGAAGATATGGCCTGAGGAGGG + Intronic
1125916657 15:43493542-43493564 AAGAAGAAGCGGCTTGAGGATGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1127191546 15:56536608-56536630 CTGGAGTAAAGGCATGAGGAAGG + Intergenic
1128724449 15:69977652-69977674 ATGGAGAAAGGAGCTGAGGTTGG + Intergenic
1128769467 15:70271059-70271081 ATGGTGAAATGGCCTGTGAAAGG + Intergenic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1130983664 15:88830286-88830308 ATAAAGAAACGGGCTGGGGAAGG - Intronic
1131842498 15:96452287-96452309 ATGGAGAGATGACCAGAGGAAGG + Intergenic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1132010875 15:98275752-98275774 ATGAAGACACGGCCTTATGATGG - Intergenic
1132645976 16:999476-999498 ACGGAGGAACAGCCTGGGGATGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133859380 16:9579946-9579968 ATGGAGAAATGGTTAGAGGATGG - Intergenic
1135552620 16:23409704-23409726 AGGGAAAAACTGTCTGAGGAAGG + Intronic
1135830960 16:25772869-25772891 ATGGAGAAACGGCCATGGCAGGG + Intronic
1136014240 16:27384882-27384904 CGGGAGAAACTGCCTCAGGATGG - Intergenic
1137893561 16:52186959-52186981 CTGGAGAATCGGCTTCAGGATGG - Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1140151780 16:72374832-72374854 ACAGAGAAAAGGCCTAAGGATGG + Intergenic
1140552937 16:75887167-75887189 AAGGAGCAACAGCCTAAGGAAGG + Intergenic
1140968878 16:79993845-79993867 GTGAAGAAAGTGCCTGAGGATGG + Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1144583808 17:16475754-16475776 TTGTAGAAACGGGCTGAGCACGG + Intronic
1145051540 17:19665876-19665898 ATGGAGCAACTGACTTAGGACGG - Intronic
1147985335 17:44303772-44303794 AGAGAGAAACGGGCTGGGGACGG - Intergenic
1149347178 17:55750935-55750957 CTGGAGGAGCGGCCTGAGGGTGG - Intergenic
1151703948 17:75757138-75757160 AAGGAGGCACGGCCCGAGGAGGG - Intronic
1151748117 17:76022358-76022380 CTGGAGAAACGGGCTGGGGCTGG + Intronic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1153179118 18:2413172-2413194 CTGGAAAAACCGCCTGAGGCAGG + Intergenic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1160015849 18:75139812-75139834 AGGGAGTGAAGGCCTGAGGAAGG - Intergenic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163093340 19:15036451-15036473 GTGGAGAAAGGGCCTGGGGCAGG + Intergenic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1165631518 19:37305580-37305602 AGGGAGAAACTTCGTGAGGATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
1168042872 19:53772719-53772741 ATGGAAAAAGGGTCAGAGGAAGG - Intergenic
1168050589 19:53826776-53826798 ATGGAGATAATGCCTGAGTAAGG + Intergenic
925843903 2:8018753-8018775 ATTGAGACACTGCTTGAGGAAGG + Intergenic
926758514 2:16254942-16254964 ATGGAGTGAAGGCTTGAGGAAGG + Intergenic
928271388 2:29858434-29858456 ATGGACAAAAGGTCTGAGGCCGG + Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
930999137 2:57760138-57760160 GTGGACAAAAGGCCCGAGGAGGG - Intergenic
932860205 2:75283634-75283656 ATGGAGAAATGGCCAGAAAATGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
937757924 2:125563348-125563370 TTGGAGAAAGGCCCAGAGGAAGG - Intergenic
937866894 2:126759242-126759264 AGTGAGAAACGGCCTGACTAGGG + Intergenic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
944685609 2:202114928-202114950 ATGGAGGAAAGGCTTGAGAAAGG - Intronic
947777010 2:232720982-232721004 AGAGAGAAAAGGCCAGAGGAGGG + Intronic
1170947481 20:20904302-20904324 CTGGACAAACTCCCTGAGGAAGG - Intergenic
1172320636 20:33993366-33993388 ATGGAGAATCGCCCAGAGGGCGG - Intergenic
1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG + Exonic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1177583533 21:23059235-23059257 ATTGAAAAATGGCCTGAGGCTGG + Intergenic
1178299190 21:31437593-31437615 TTGGAGAAAGGGCCTGTGGGAGG + Intronic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180850406 22:19016471-19016493 ATGGAAAAATGGCCTGTGGATGG - Intergenic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182742197 22:32576096-32576118 ATGAAGCAATGGCCTGAGTATGG + Intronic
1182891091 22:33819480-33819502 TTGGTGAAACAGCCTGTGGATGG - Intronic
952000565 3:28781115-28781137 ATGGAGAGAGGGCAAGAGGAAGG + Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954707880 3:52490675-52490697 ATGGAGAAAGGGACAGAGGGAGG - Intronic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
954782848 3:53073515-53073537 ATGGAGCCACGGGCTGAGGCTGG + Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955249847 3:57269184-57269206 ATGGAGAAAAGGGCTGGAGAGGG + Exonic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956762420 3:72455759-72455781 AGGCAGAAAGGCCCTGAGGAGGG - Intergenic
959377686 3:105605460-105605482 ATGGAGAACCGGCATGGGAATGG - Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960456625 3:117880469-117880491 AGGGAGAAAGGGCATAAGGAAGG - Intergenic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961517195 3:127445270-127445292 ATGTACAAAAGGCCTGAGGATGG + Intergenic
962299120 3:134221988-134222010 ATGGAGAAACGGTGTAAGAAAGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
976505928 4:85847567-85847589 AAGGAGCAAAGGCCTAAGGAAGG + Intronic
978490164 4:109303157-109303179 ATGGAGAAATGGCCTCCGGGAGG + Intergenic
981051720 4:140315815-140315837 GTGGAAAAAAGGCCTGAGGCAGG - Intronic
982455536 4:155605130-155605152 AAGGAGAAACTGCCTGACCAGGG - Intergenic
983732524 4:171012965-171012987 TTGGAGGTAGGGCCTGAGGAGGG + Intergenic
985314426 4:188640481-188640503 ATGGAGAAAGGGCAAGAGGGAGG - Intergenic
986191470 5:5500319-5500341 ATGGACCAGCGTCCTGAGGAAGG + Intergenic
986199230 5:5566485-5566507 ATGAAGAAACGGCATCAGAAAGG + Intergenic
986927960 5:12781852-12781874 AAGGAGAAGTGGCCTGAGGTAGG - Intergenic
987557446 5:19472635-19472657 ATGGAGAAAAGAACTGGGGAGGG + Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992842155 5:80705998-80706020 AGGCACAAACGGACTGAGGAGGG - Intronic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
996494682 5:124140239-124140261 GTGAAGAAACTGCCTGAGGCTGG + Intergenic
997722394 5:136089635-136089657 TTGGAGGAACGGCCTAATGAAGG - Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
999563150 5:152827074-152827096 ATACAGAAACGCCCAGAGGAAGG - Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000116584 5:158159702-158159724 ATGAAGAAACTGCCCAAGGAAGG - Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1002701291 5:181127072-181127094 GTGGAGAAACGGCAGCAGGAAGG - Intergenic
1004176680 6:13346200-13346222 ATGCAGAGACGGCCTGAGATAGG - Intergenic
1004672436 6:17810312-17810334 GCCGAGGAACGGCCTGAGGAAGG - Intronic
1006510282 6:34517644-34517666 TTGGAGCAAAGGCCTGAGGAAGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1009840594 6:69068592-69068614 ATGTAAAAACGTCCTGATGATGG + Intronic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1012053057 6:94368202-94368224 AGGAAGAAATGGCCTGAGGATGG - Intergenic
1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG + Intergenic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1014157967 6:118134153-118134175 AAGGAGAAACTGCCTGTGCAGGG + Intronic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1015382371 6:132584113-132584135 ATGGACAAAGGTTCTGAGGAAGG - Intergenic
1015544611 6:134348619-134348641 TTGGAGAAAGGGCCTCAGAAGGG - Intergenic
1015879590 6:137857757-137857779 ATGAAGAAACGGCCTCAGTGAGG - Intergenic
1015885201 6:137910686-137910708 AAGGAGGAAGGGACTGAGGATGG + Intergenic
1016197675 6:141365790-141365812 TTGGAGAAACGGTCTGTAGAAGG - Intergenic
1016543620 6:145195466-145195488 TTGGAGGAAGGGCCTGAGGGAGG - Intergenic
1017641073 6:156494461-156494483 ATGGAGCTAGGGCCAGAGGACGG + Intergenic
1017944651 6:159085525-159085547 ATGGAAAAAAGACCAGAGGAAGG - Intergenic
1018007294 6:159634262-159634284 ATGGAGAAACACCCTGGGGCAGG + Intergenic
1018900502 6:168049640-168049662 GTGGCCAAACGGCCTGAGGGAGG - Intergenic
1019211464 6:170408738-170408760 CTGGAGAGACGGCCTTAGGTAGG - Intergenic
1019614142 7:1951281-1951303 GTGGATGAAGGGCCTGAGGAAGG + Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021828140 7:24574034-24574056 ATGGAGAGCCGGCCTGGGGGCGG + Intronic
1023013575 7:35944027-35944049 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1024077553 7:45829807-45829829 CTGCAGAAGGGGCCTGAGGAGGG - Intergenic
1025126857 7:56351605-56351627 CTGCAGAAGGGGCCTGAGGAGGG + Intergenic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1029403734 7:100360661-100360683 ATGGAGGAATGGCCAGAGGTGGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032738498 7:134714379-134714401 AGGGAGAACCTGCCAGAGGAAGG - Intergenic
1033045872 7:137961827-137961849 ATGGAGGAAAGGCCTGGGGTAGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035609080 8:948441-948463 ATGGAGGCCGGGCCTGAGGAAGG - Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037638905 8:20724881-20724903 ATGGACAAAGGCCCTGAGGTAGG + Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038533898 8:28340069-28340091 ATGGACAAATGGCTTGTGGAAGG - Intronic
1043890348 8:85646371-85646393 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043891963 8:85658561-85658583 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043894141 8:85724136-85724158 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043894497 8:85727221-85727243 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043894853 8:85730306-85730328 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043895209 8:85733391-85733413 ATGGAGAAAGGGCTTCAGGCTGG + Intergenic
1043897467 8:85748417-85748439 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043897823 8:85751505-85751527 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043898179 8:85754590-85754612 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043899793 8:85766785-85766807 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043901400 8:85778978-85779000 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043901755 8:85782063-85782085 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043903365 8:85794253-85794275 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043904976 8:85806446-85806468 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1043906587 8:85818637-85818659 ATGGAGAAAGGGCTTCAGGCTGG - Intergenic
1044598503 8:93981064-93981086 ATGGAGACAAGACCTGGGGAGGG + Intergenic
1045029776 8:98124074-98124096 ATGCAGAAATGGGCAGAGGATGG + Intronic
1045378536 8:101600169-101600191 ATGTAGAACAGGCCTGAGAAAGG + Intronic
1045769708 8:105721706-105721728 ATGGATAGAAGGCCTGATGAAGG - Intronic
1046598446 8:116288798-116288820 ATGCAGAACTGGGCTGAGGACGG + Intergenic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1048188064 8:132262671-132262693 ATGGAGACATGAGCTGAGGAGGG + Intronic
1048927550 8:139284293-139284315 ATGGTCAAACGTCCTGAAGAGGG - Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049348987 8:142154046-142154068 ATGGGGAAACGGCCCTGGGAGGG + Intergenic
1053423658 9:37997200-37997222 ATGGAGATACAGCCTGTGGCCGG - Intronic
1054936952 9:70698250-70698272 ATGGAGAATCGGCTTGAAGAAGG - Intronic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058280166 9:103103811-103103833 ATGGAGAGAAGACCTGAGGTAGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1060478961 9:124006557-124006579 ATGTAGAAACTCCCGGAGGAGGG - Intronic
1060601199 9:124878996-124879018 CTGGAGAAGCGGCCTCTGGAAGG + Exonic
1060876579 9:127088210-127088232 ATGGTGAAAAGTCCTGAGAATGG + Exonic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061719848 9:132544835-132544857 ATGGGGACGCTGCCTGAGGAGGG + Intronic
1062467100 9:136686327-136686349 ATGTAGCAACAGCCTGGGGACGG + Intronic
1192065318 X:67879224-67879246 ATGGAGACATGGCATGAAGACGG + Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1195068752 X:101260184-101260206 ATGGAGAAAGGGGCTGGGAAAGG - Intronic
1195675226 X:107502713-107502735 ATAGAGAAATGGCCTGGGAATGG + Intergenic
1196786321 X:119424454-119424476 ATAAAAAAAGGGCCTGAGGAAGG - Intronic
1198067909 X:133118278-133118300 ATGGAGGAATTGCATGAGGAAGG + Intergenic
1198323687 X:135545073-135545095 ATGGAGTAAGGGGCAGAGGAAGG - Intronic