ID: 1007608745

View in Genome Browser
Species Human (GRCh38)
Location 6:43135023-43135045
Sequence GCTTCCAACCCAGGCTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007608734_1007608745 24 Left 1007608734 6:43134976-43134998 CCTTGAAAAAAAGAAAAAAAATG 0: 1
1: 5
2: 128
3: 1977
4: 17088
Right 1007608745 6:43135023-43135045 GCTTCCAACCCAGGCTCTAGGGG 0: 1
1: 0
2: 2
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007608745 Original CRISPR GCTTCCAACCCAGGCTCTAG GGG Intronic
900954229 1:5876818-5876840 TCTTCAAACCCAGGCTCCAGGGG + Intronic
901740315 1:11337988-11338010 GCTTTCGACCCAGGCTCTTCAGG - Intergenic
902926840 1:19701538-19701560 GGTTCCAACCCAGGCTGTGTTGG - Intronic
904317112 1:29672764-29672786 GCTGTCAACCCAGGCTTCAGAGG + Intergenic
912271077 1:108209547-108209569 GCTTCAAACCCAGGCTCTGGTGG + Intergenic
913326758 1:117634676-117634698 GTTTCCAACCCATGAACTAGAGG + Intergenic
915554022 1:156651497-156651519 GCCTCCAACCCAGCCTCTGATGG + Exonic
922745932 1:228043851-228043873 GATTCCACCCAAGGTTCTAGAGG - Intronic
1065700742 10:28423194-28423216 GCTTCCAGCCCATGCTCTCCTGG + Intergenic
1066588650 10:36967494-36967516 GGCACCAACCCAGGCCCTAGAGG + Intergenic
1066993539 10:42539810-42539832 GCTTGAAACCCAGGCCCTGGTGG + Intergenic
1069632877 10:69908093-69908115 GCTTCCCAGCCAGGGTCTGGAGG - Intronic
1069693755 10:70372002-70372024 TCTTCCAGCCCAGTCTCTACAGG + Intronic
1069981035 10:72252781-72252803 TCTTCCAACCCTCACTCTAGGGG + Intergenic
1071831562 10:89377451-89377473 ACTGCCAACCCTGGCTATAGTGG - Intronic
1072526577 10:96277016-96277038 GCATCCAGCCCAGCCTCTATTGG + Intergenic
1073397212 10:103228045-103228067 GCTACCAGCCTAGGCTCTAAAGG + Intergenic
1073682386 10:105718332-105718354 ACTCCAAACCCAGGCTCCAGGGG - Intergenic
1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG + Intergenic
1075081923 10:119390057-119390079 GCATCCAACCAAGGATCTAAAGG - Intronic
1076479606 10:130776297-130776319 GCTTCCCCCGAAGGCTCTAGGGG + Intergenic
1077323148 11:1951363-1951385 GCTCCCAACCCAGCCTCTCAGGG - Intronic
1077462267 11:2716528-2716550 GCTTCCCACCCAGGCTCTTGTGG + Intronic
1077519777 11:3025683-3025705 GCTTCCAACCTTGCCTCTTGTGG + Intronic
1077836306 11:5930568-5930590 GCTCCAAACCCAGGCCCTGGCGG + Intronic
1078296469 11:10076402-10076424 ACTTGCAATCCAGTCTCTAGTGG + Intronic
1079338466 11:19591929-19591951 GCTTCCAAGGCAGGCTATGGAGG + Intronic
1079351123 11:19692982-19693004 GCTGCCTGCCCAGGCTCTACAGG + Intronic
1079771503 11:24465818-24465840 TCTTCCAACTCAGGATCTATAGG + Intergenic
1084683466 11:70680377-70680399 GCTCCCCACCCAGGCTCCAGAGG + Intronic
1085899423 11:80680434-80680456 GGCACCAACCCAGGCACTAGAGG - Intergenic
1086335046 11:85792203-85792225 GACACCAACCCAGCCTCTAGTGG + Intronic
1088713006 11:112525101-112525123 GATTCCAAAACAGGCTCCAGGGG - Intergenic
1088908705 11:114174179-114174201 GCTCCCAGCCCAGGCTCTGTCGG + Intronic
1202806134 11_KI270721v1_random:6558-6580 GCTCCCAACCCAGCCTCTCAGGG - Intergenic
1094047573 12:26184052-26184074 GCTTCCAACCAATGAGCTAGAGG + Intronic
1094470359 12:30796533-30796555 GCTTCCAGCCCCGGCTCTGGTGG + Intergenic
1101200785 12:102434004-102434026 GCTTAGAACACAGGCTCTGGAGG + Intronic
1103464481 12:121131253-121131275 GCTTAGAACATAGGCTCTAGGGG - Intergenic
1106498177 13:30301603-30301625 GGTTCAAATCCAGGCTCTATGGG - Intronic
1107049928 13:36036059-36036081 GCTTCCACCCCAGCCTTTATTGG - Intronic
1108077880 13:46700538-46700560 GCTTTCAACCCTGGCTGTAAAGG + Intronic
1108554749 13:51582089-51582111 GCTCCCACCCCAGGCTTTATGGG - Intergenic
1109366559 13:61364251-61364273 GCTTGAAACCCAGGCCCTTGTGG - Intergenic
1111671682 13:91339551-91339573 CCTTCCACCCCAGCCTCAAGAGG + Intergenic
1113458786 13:110467431-110467453 CTTTCCATCCCAGGATCTAGGGG + Intronic
1113674905 13:112200431-112200453 GCTTCCCGCCCTGGCTCTGGTGG - Intergenic
1114220659 14:20693541-20693563 TCTTCCAACACAGGCTCCTGCGG - Exonic
1114248115 14:20933700-20933722 ACCTCCAACACAGGCTCAAGAGG - Intergenic
1116068631 14:40014679-40014701 ATTTCCCACCCATGCTCTAGGGG - Intergenic
1117043274 14:51787349-51787371 GCTTCCAAACCAGTCCCTGGGGG + Intergenic
1119880078 14:78092900-78092922 CCTTCCCAGCCAGGCTCTGGGGG + Intergenic
1122509259 14:102252987-102253009 GCTTCCAAAACAGGCCCTTGCGG - Intronic
1122808831 14:104277638-104277660 GTTTCCAAACCAGGCTCTCATGG - Intergenic
1123457897 15:20442733-20442755 GCTTCTTCCACAGGCTCTAGGGG - Intergenic
1123660172 15:22557676-22557698 GCTTCTTCCACAGGCTCTAGGGG + Intergenic
1124264045 15:28217886-28217908 GCTTCTTCCACAGGCTCTAGGGG - Intronic
1124314031 15:28652171-28652193 GCTTCTTCCACAGGCTCTAGGGG + Intergenic
1128983764 15:72204557-72204579 GATTCAAACCCAGGCTTTATTGG + Intronic
1129674449 15:77624913-77624935 GATGCCAACCCAGGCTCTCGGGG + Intronic
1132551217 16:554587-554609 GCTTCCGACTCAGGCTCCAATGG + Exonic
1133456976 16:5950899-5950921 GCATCCAACCCAGGCCAGAGAGG + Intergenic
1135772969 16:25231335-25231357 GCTTCCCACGAAGGTTCTAGAGG - Intergenic
1136337291 16:29618419-29618441 GCTTCCTTCTGAGGCTCTAGGGG - Intergenic
1136702377 16:32156134-32156156 GCTCCCTCCACAGGCTCTAGGGG - Intergenic
1136765290 16:32771354-32771376 GCTCCCTCCACAGGCTCTAGGGG + Intergenic
1136802809 16:33099030-33099052 GCTCCCTCCACAGGCTCTAGGGG - Intergenic
1137231488 16:46571218-46571240 TCTTGCAATCCAGGCTGTAGTGG + Intergenic
1137505667 16:49051850-49051872 GTTTCCATCCCAGGCCCTTGGGG - Intergenic
1138416805 16:56876354-56876376 GCCTCCCACCCTGCCTCTAGTGG - Intronic
1139319078 16:66098389-66098411 GGTTGGAACCCAGGCTCTAGTGG - Intergenic
1140619365 16:76709570-76709592 GCTTCCAGCCCAGGATTTTGTGG + Intergenic
1141874100 16:86809594-86809616 GATTCCAACCCAGCCTCTCTGGG - Intergenic
1203067678 16_KI270728v1_random:1033587-1033609 GCTCCCTCCACAGGCTCTAGGGG + Intergenic
1143167154 17:4902450-4902472 GATTCCAATCCAGACGCTAGTGG + Exonic
1144739730 17:17575117-17575139 GCTTCCACCAGAGGCTCTGGGGG + Intronic
1145007452 17:19345617-19345639 GCTCCCTCCCAAGGCTCTAGGGG - Intronic
1145058074 17:19716149-19716171 TCTTCCAACTCAGGCTTTTGTGG + Intronic
1145933005 17:28699453-28699475 CCTTCCAACCCTGGCACTATGGG + Intronic
1146077376 17:29743957-29743979 GCTTCCGACTCAGGCTCCAATGG - Intronic
1146812623 17:35916035-35916057 GGTCCCAACCCAGCCTCCAGAGG - Intergenic
1146816320 17:35944867-35944889 GGTCCCAACCCAGCCTCCAGAGG - Intergenic
1147059071 17:37859653-37859675 GCTGCCAACCCAGGACCAAGGGG + Intergenic
1147232453 17:39029309-39029331 GATCCCAACCCAGCCTCCAGAGG + Intergenic
1147874943 17:43614415-43614437 GCCTCCATCCCAGGCTCTCCAGG + Intergenic
1150334484 17:64320544-64320566 GCTTCCAACACAGACTTTGGGGG - Exonic
1152982888 18:295536-295558 GTTTGCAACCCTGGCTCAAGAGG + Intergenic
1153135966 18:1917842-1917864 ACTTTAAACCCAGGCCCTAGCGG - Intergenic
1158817827 18:61124444-61124466 GCTTCTAACTCAGGCTCTTGTGG - Intergenic
1159301533 18:66577828-66577850 GCTTCCACCCAAGTCTCTAGAGG + Intronic
1161059616 19:2208378-2208400 GCTCCCCAGGCAGGCTCTAGTGG - Intronic
1161266735 19:3367601-3367623 CCTTCCAGCCCAGGCTCCCGGGG + Intronic
1163680124 19:18676391-18676413 TCCTCCCACCCAGGCTTTAGTGG - Intergenic
1163682562 19:18691673-18691695 GCTTCCTCCAGAGGCTCTAGGGG - Intronic
1165540512 19:36489550-36489572 GCTTCCAACTCACGCGCTGGCGG - Exonic
1166475297 19:43119194-43119216 ACTTTCAACCCAGGTTCTAAAGG + Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925876030 2:8312067-8312089 GCTTCCAACCCATTCTCCACAGG + Intergenic
927982007 2:27380336-27380358 GCTTCCCACCGAGGCACTAAGGG - Intronic
931348507 2:61468775-61468797 GCTTCTAACCAAAGTTCTAGGGG + Intronic
934052096 2:88219636-88219658 GCTTCCTTCCCAGGTTCTTGAGG + Intergenic
936233239 2:110722611-110722633 GCTTCCCACCCAGCCTCTGGTGG - Intergenic
937048675 2:118869874-118869896 CCTTCCTTTCCAGGCTCTAGGGG + Intergenic
942049203 2:172122980-172123002 GCTCTCAACCCAGGCTGGAGTGG - Intergenic
946033703 2:216725143-216725165 GCTTCAAACACAGGCTCTACAGG - Intergenic
946384572 2:219374789-219374811 GCAACCAATCCAGGCACTAGAGG + Intronic
948731453 2:239966343-239966365 GCTTCCATTCCAGGCTGCAGAGG + Intronic
948976550 2:241466904-241466926 GTTTCCGACTCAGGCTCCAGTGG + Intronic
949041027 2:241850081-241850103 CCTTCCCACCCAGGCCCTGGTGG + Exonic
1172633120 20:36392176-36392198 GCTTCCAGCTCAGGTGCTAGGGG + Intronic
1179427236 21:41291415-41291437 GCTTCCATCCCAGGCTATGGGGG - Intergenic
1183597541 22:38821795-38821817 GCTCCCAGCCCAGGCTGAAGCGG + Exonic
1183682813 22:39343676-39343698 GCTGCCAAACCAGCCTCAAGAGG + Intergenic
1184472804 22:44705189-44705211 GCTCCCACCAGAGGCTCTAGGGG + Intronic
1185092813 22:48785429-48785451 GTTTCCAACTCAGGCTTTTGCGG - Intronic
953712677 3:45287953-45287975 GCTGCCACCTCTGGCTCTAGAGG + Intergenic
954640666 3:52095913-52095935 GCTGCCAACCTACGCTCCAGAGG + Intronic
956637817 3:71383732-71383754 CCTTCCAAACCAGGTTCAAGGGG - Intronic
957960072 3:87237568-87237590 TGTTCCAATCCATGCTCTAGGGG + Intronic
959611092 3:108295522-108295544 GCTTTCAACCCAGTTTCCAGTGG + Intergenic
959626562 3:108458622-108458644 GCCTCCAAACCAAGCTCCAGAGG + Intronic
959888883 3:111532178-111532200 GCTTCCTCCAAAGGCTCTAGGGG - Intronic
960849799 3:122041167-122041189 GTTTCCAACCCTGGCTTTTGGGG - Intergenic
961818106 3:129561574-129561596 GCTTCCATCCCATGCCCCAGTGG - Intronic
963792434 3:149597534-149597556 CCTTCCACCCCAGCCTCTCGAGG - Intronic
967894948 3:194388087-194388109 GCTGCCAACCCAGGCCCTGCTGG - Intergenic
969255999 4:6002310-6002332 GCTTCCTCCTGAGGCTCTAGGGG - Intergenic
969327452 4:6452129-6452151 GCTTCCTGTCCAGGCTCTTGGGG - Intronic
969594621 4:8142051-8142073 GCTGCAAGCCCAGCCTCTAGTGG + Intronic
969703350 4:8779621-8779643 GCTTCCCACCCAGGCCTTTGGGG + Intergenic
972632091 4:40850989-40851011 TCTGCCAACCCCTGCTCTAGAGG + Intronic
975702004 4:77075745-77075767 CCTCCCAACCCGGGCTCGAGCGG - Exonic
986397464 5:7344651-7344673 GCTCTCCACCGAGGCTCTAGGGG - Intergenic
986651770 5:9971128-9971150 GCTACCAACCCAAGCACTAAAGG - Intergenic
987019168 5:13852097-13852119 GCTTGAAACCCAGGCCCTTGTGG - Intronic
988508371 5:31843845-31843867 GCTTCCTCTCCAGGCTTTAGGGG - Intronic
1000049196 5:157547326-157547348 GTTTCCAACACAGGCTTTTGCGG - Intronic
1002890344 6:1326573-1326595 GTTTAGAACCCAGGCTCCAGGGG + Intergenic
1003973646 6:11322776-11322798 CCTGCCTACCAAGGCTCTAGGGG + Intronic
1007608745 6:43135023-43135045 GCTTCCAACCCAGGCTCTAGGGG + Intronic
1007700458 6:43763311-43763333 GCTTCCAGCCCAGGCCCAGGGGG + Intergenic
1008122415 6:47633693-47633715 GCTTCCAAAGGAAGCTCTAGGGG + Intergenic
1012193932 6:96316187-96316209 GCTTCCAACCCAGCCCCTGTGGG + Intergenic
1013480045 6:110545188-110545210 GCTTCCTCCAAAGGCTCTAGGGG + Intergenic
1028430007 7:90735930-90735952 GCTTGAAACCCAGGCCCTGGTGG + Intronic
1031290101 7:119923712-119923734 GCTTCAAATCCAGGCTGTATGGG - Intergenic
1033151159 7:138916001-138916023 GCTAGCAACCCAGGCTGTGGTGG + Intronic
1033414548 7:141150547-141150569 GTTTCAAGCCCAGGCTCCAGAGG + Intronic
1035070648 7:156143017-156143039 GCTTCCTACCCTTGCTCTAAAGG + Intergenic
1043676530 8:82963062-82963084 GTTTCCAACACAGGCTTTTGGGG - Intergenic
1049191839 8:141292573-141292595 GCTTCCACTCCAGGCCCAAGGGG - Intronic
1049602864 8:143515976-143515998 GCTTCCAGCCCAGGCCCTGCAGG + Intronic
1051766341 9:20528541-20528563 GCTCCCCACAAAGGCTCTAGGGG + Intronic
1056578907 9:87876315-87876337 GCTTCAAAGCCAGGATCTAAGGG + Intergenic
1056858968 9:90162064-90162086 GCTTCCTACACTGGCTGTAGAGG + Intergenic
1057495051 9:95553929-95553951 GCTCCCCACCAAGGCTTTAGAGG - Intergenic
1058866771 9:109167805-109167827 GCTTCCTCTCCAGGCTCTTGCGG + Intergenic
1059658448 9:116377879-116377901 GGTTCCAAGCCAGGCTTTTGTGG + Intronic
1060596940 9:124854106-124854128 GCTCCAACCCCAGGCTCTTGGGG + Intronic
1061584950 9:131559550-131559572 GCTTACAACCCTGGCACCAGGGG + Intergenic
1061863543 9:133479674-133479696 TCCTCCACCCCAGGCTCTGGTGG + Intergenic
1185655793 X:1684540-1684562 GCTTCCTCCGGAGGCTCTAGGGG - Intergenic
1186184887 X:7011001-7011023 ACTTTCAACCCAGGTTCTAAAGG + Intergenic
1187438316 X:19293118-19293140 GCTTCCTCCCCAGGCTGGAGGGG + Intergenic
1192149291 X:68701965-68701987 GCTTCCATCTCAGGGTCTTGGGG + Intronic
1193621477 X:83757116-83757138 GCTTCCAACCAATGAGCTAGAGG + Intergenic
1195958824 X:110364086-110364108 GCTCCCTACAAAGGCTCTAGGGG + Intronic