ID: 1007609376

View in Genome Browser
Species Human (GRCh38)
Location 6:43139358-43139380
Sequence AGACGAGGAATTGGGGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007609376 Original CRISPR AGACGAGGAATTGGGGCCGC TGG (reversed) Intronic
902917598 1:19648109-19648131 AGAAGAGGAATTGGGGAGGATGG + Intronic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
909355746 1:74708002-74708024 AGACGATGAACTGGGCCCTCAGG + Intronic
920772039 1:208896729-208896751 AGACGAGGAATTAGGGAGGAGGG - Intergenic
920882223 1:209890731-209890753 AGACGAGGAAATGGAGGCCCAGG - Intergenic
923008132 1:230067846-230067868 GGACGAGGATTTGCAGCCGCTGG - Intronic
924772688 1:247090366-247090388 TGGCCAGGAATTGGGGCCGATGG + Intergenic
1063042708 10:2359388-2359410 AGACCAGGAGTTGGAGACGCAGG - Intergenic
1067071800 10:43138142-43138164 AGTCGAGGGCTTCGGGCCGCGGG - Intergenic
1067437322 10:46287280-46287302 AGACCAGGAAGTAGGGCCCCAGG - Exonic
1070750219 10:78959693-78959715 AGACAGGGAATAGGGGCTGCAGG + Intergenic
1072433883 10:95398049-95398071 AGATGAGGAAATGGGGACTCAGG - Intronic
1074833084 10:117263560-117263582 AGATGAGGAATTTGGGGGGCAGG - Intronic
1075426543 10:122346296-122346318 AAAGGAGGAATTGGGGGCTCAGG + Intergenic
1075519807 10:123136641-123136663 AGAAGTGGAATTGGAGCCCCGGG + Intronic
1075814528 10:125254671-125254693 AGAGGAGGAATTGGGGGAGGCGG - Intergenic
1076357689 10:129864983-129865005 AGAGGAGAAATTGGGACCACAGG + Intronic
1077216192 11:1396163-1396185 AGACGAGGAGCGGGGGACGCAGG - Intronic
1081988878 11:47327004-47327026 AGAAGAGCAAATGGGGCCTCAGG + Intronic
1084346980 11:68559589-68559611 AGATCAGGAATTGGGGAAGCAGG - Intronic
1085205485 11:74729692-74729714 AGACTAGGAGTTGGGAACGCAGG + Intronic
1088763666 11:112956361-112956383 AGAAGAGGAAATTGGGCCTCAGG - Intergenic
1091618624 12:2068603-2068625 AGGCAAGGACTTGGGGCCACTGG - Intronic
1094291581 12:28856369-28856391 AGAGGAGGAATTGGGGAAGGGGG + Intergenic
1100831013 12:98516322-98516344 AGGCCAGAAGTTGGGGCCGCGGG + Intronic
1102613920 12:114136416-114136438 AGACAAGGAAGTGGGTCGGCTGG + Intergenic
1107102934 13:36613523-36613545 AGATGAGGAAGTTGGGCCTCAGG - Intergenic
1116405254 14:44558618-44558640 AGACGAGGCATTGGTCCAGCAGG - Intergenic
1120757479 14:88257659-88257681 AGGCGAGGAAATGAGGCAGCAGG - Intronic
1125208411 15:37182093-37182115 AGATGAGGAAATAGGTCCGCAGG + Intergenic
1125882901 15:43209156-43209178 AGATGGGGAAATGCGGCCGCAGG + Intronic
1128367018 15:67011630-67011652 AGACGAGAAATTGGGGCCTAGGG - Intergenic
1128389000 15:67170361-67170383 AGACAAGAAATTGGGGCCCAGGG + Intronic
1131068713 15:89450564-89450586 AGGCGAGGAATTGCAGTCGCTGG - Intergenic
1131466129 15:92655917-92655939 TCCCGAGGAATTGGGGTCGCGGG - Exonic
1132542230 16:515911-515933 AGAGGAGGAATCGGGACTGCAGG + Intronic
1134215613 16:12314899-12314921 AGACGAGAATTTGGTGCCACAGG - Intronic
1135193674 16:20376701-20376723 AGCTGAGGAATGGGGGCTGCAGG - Intronic
1138295411 16:55881034-55881056 AGACGTGGAATTGGGACATCTGG + Intronic
1138488175 16:57360149-57360171 AGAGGAGGAAATTGGGCCTCAGG + Intronic
1138694242 16:58796854-58796876 AGACGAGGAGTTGGGGGTGAGGG - Intergenic
1142133293 16:88440780-88440802 AGACCAGGGATGGGGGCCGGCGG - Intergenic
1144760383 17:17703881-17703903 AGACAAGGACTTGGGCCCTCTGG - Intronic
1146512531 17:33462484-33462506 ATACAAGGAAATGGGGCCCCAGG + Intronic
1146922429 17:36722555-36722577 AGAGGAAGAAGTGGCGCCGCAGG - Intergenic
1150281531 17:63931987-63932009 AGGAGAGGAACTGGGGCCACAGG + Intronic
1152349992 17:79778870-79778892 AGACGCAGAAACGGGGCCGCGGG - Intronic
1153527284 18:6009224-6009246 AGTCCAGGAGTTGGGGCCTCAGG + Intronic
1153977767 18:10284557-10284579 AGAAGAGGAATGTGGGCCCCCGG + Intergenic
1155932680 18:31724005-31724027 CGAGGAAGAATTTGGGCCGCGGG - Intergenic
1157605429 18:48923200-48923222 AGAGGAGGAGCTGGGGCTGCAGG - Intronic
1160514419 18:79470647-79470669 AGACGAGGAGTGCGGGCGGCTGG - Intronic
1162550074 19:11353761-11353783 AGACAAGGAGCTGGGGGCGCTGG - Intronic
1163284555 19:16338334-16338356 AGACGGGGACTTGGATCCGCTGG + Intergenic
1163743807 19:19033239-19033261 GGGCGAGGAAATGGGGGCGCCGG + Intronic
1166609005 19:44172126-44172148 GGAGGAGGAATTGGGGCTGCTGG + Exonic
1168273220 19:55261679-55261701 AGACGTGGGATTGGGGCGGGAGG - Intergenic
927695684 2:25238232-25238254 AGATGGGGCATTGGGGCAGCTGG - Intronic
928173767 2:29020660-29020682 AGGCGAGGAAGGGGGGCAGCAGG + Intronic
934789599 2:97047380-97047402 AGAGCAGGAATTGGGCCCGATGG - Intergenic
936487194 2:112936233-112936255 GGAAGAGGAATTGGGGCCCTTGG + Intergenic
937240806 2:120461182-120461204 AGAGGAGGAAATGGGGACTCAGG + Intergenic
939462900 2:142519618-142519640 AGAGGAGGAATTGGGGGAGGAGG + Intergenic
939550952 2:143614887-143614909 AGACCGGGAATTGGTGCCACAGG + Intronic
946865031 2:224035069-224035091 AGACTTGGATTTGGGGCAGCAGG + Intronic
1178463449 21:32824485-32824507 AGACCAGGAAGTGGGTCCTCTGG + Intergenic
1183710859 22:39502445-39502467 AGAGAAGGAATGAGGGCCGCCGG + Intronic
1184413788 22:44340494-44340516 AGAGGAGGACATGGGGCGGCAGG - Intergenic
1184797157 22:46738883-46738905 AGGCGGTGAATTGGGGCCACAGG - Intergenic
954844638 3:53544863-53544885 ATTCGAGGAAGTGGGGCCACTGG + Intronic
954974030 3:54676078-54676100 AGACGAGGAACTGGAGGCTCAGG - Intronic
956771127 3:72526815-72526837 AGAGTAGGAATTGTAGCCGCTGG - Intergenic
961170954 3:124797389-124797411 AGAGGAGGAATTGGGGCACGGGG - Intronic
969256918 4:6008439-6008461 GGACGAGGCACTGGGGCAGCAGG - Intergenic
975207734 4:71663812-71663834 AGACCAGGAATTGGAGCTGGAGG + Intergenic
980367975 4:131831180-131831202 TGATGAGGAAGTGGGGCCTCTGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985537718 5:474066-474088 AGAGGAGGAAGAGGGGCTGCTGG + Intronic
986770941 5:10973131-10973153 AGACGAGGCATTCGGGCCGGTGG - Exonic
986957096 5:13165826-13165848 AGAGGAGGAAGTGGGGGAGCTGG + Intergenic
995436070 5:112137022-112137044 AGACCAGGAAGTGGGTCCTCTGG + Intergenic
995902856 5:117090728-117090750 AGCCAAGAAAATGGGGCCGCTGG - Intergenic
998170583 5:139870079-139870101 AGACAAGGAAATGGGGATGCAGG + Intronic
1007609376 6:43139358-43139380 AGACGAGGAATTGGGGCCGCTGG - Intronic
1019590187 7:1827061-1827083 AGCCGAGGGAGTGGGGGCGCCGG + Intronic
1019929009 7:4211131-4211153 AGACGGGGGATTGGGCCCGAGGG - Intronic
1020136273 7:5589890-5589912 AGACCAGGATTTGGGGCCTGGGG - Intergenic
1026858502 7:73770097-73770119 AGACGAGGGGCCGGGGCCGCTGG + Exonic
1034560223 7:151875697-151875719 AGGCGAGGAACAGTGGCCGCGGG + Intronic
1040328936 8:46376161-46376183 AGAAGAGAAAATGGGGCTGCAGG + Intergenic
1040339283 8:46432302-46432324 ACAAGAGAAAATGGGGCCGCAGG + Intergenic
1045321019 8:101081172-101081194 AGACCAGGAAACGGGGCCACAGG + Intergenic
1048254947 8:132898565-132898587 AGAAGAGGGGTTGGGGCTGCAGG - Intronic
1057546286 9:96021968-96021990 GGCCGGGGGATTGGGGCCGCAGG - Intergenic
1057623563 9:96657401-96657423 AGGTGAGGAATTGGGGGCACAGG - Intergenic
1057903288 9:98965861-98965883 GGACAAGGAATTGGGTCCCCTGG - Intronic
1057903314 9:98965954-98965976 GGACAAGGAATTGGGTCCCCTGG - Intronic
1061045176 9:128160829-128160851 GGACGTGGAGTTGGGGACGCGGG + Intronic
1061045268 9:128161534-128161556 GGAGGAGGAATTGGGGAGGCAGG - Intronic
1062613797 9:137387096-137387118 AGACAAGGAGTAGGGGCCGGGGG - Intronic
1186500610 X:10047501-10047523 AGGGGAGGAATGGGGGACGCTGG - Intronic
1187399196 X:18944621-18944643 AGGGGAGGAATTGGGGACACTGG - Intronic
1190317937 X:49163382-49163404 AGACGGGGAATTGGGGGTTCCGG + Intronic
1193169768 X:78322016-78322038 AGAAGAGGAAGTGGGGAGGCTGG + Intronic
1193515119 X:82452742-82452764 AAGAGAGGAATTGGGGCCTCTGG - Intergenic