ID: 1007612636

View in Genome Browser
Species Human (GRCh38)
Location 6:43160406-43160428
Sequence GCAGTATTTTCGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007612636_1007612639 -7 Left 1007612636 6:43160406-43160428 CCACACCTGGCCGAAAATACTGC 0: 1
1: 0
2: 2
3: 53
4: 438
Right 1007612639 6:43160422-43160444 ATACTGCAATACTTCTATATTGG No data
1007612636_1007612640 -3 Left 1007612636 6:43160406-43160428 CCACACCTGGCCGAAAATACTGC 0: 1
1: 0
2: 2
3: 53
4: 438
Right 1007612640 6:43160426-43160448 TGCAATACTTCTATATTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007612636 Original CRISPR GCAGTATTTTCGGCCAGGTG TGG (reversed) Intronic
900211332 1:1457302-1457324 ACAGCATTTTTGGCCAGGTGTGG + Intronic
900565204 1:3328772-3328794 GCAGAATCTGCAGCCAGGTGGGG + Intronic
901546294 1:9960369-9960391 TCAGTTATTTTGGCCAGGTGTGG + Intronic
902898981 1:19500805-19500827 GCAGGATTTCCAGCCAGGTGCGG + Intergenic
903114653 1:21168714-21168736 GTACTTTTTTTGGCCAGGTGTGG - Intronic
903729799 1:25484076-25484098 GCAGCATTTTCATCTAGGTGAGG - Intronic
904138352 1:28331620-28331642 TAAGTATTTTAGGCCAGGCGCGG - Intronic
904765250 1:32840868-32840890 GGATTATTTTCGGCCAGGCGCGG + Intronic
904855179 1:33492482-33492504 GGAGAATTTATGGCCAGGTGCGG + Intronic
905070519 1:35221088-35221110 GCAATTTTTGTGGCCAGGTGTGG - Intergenic
905132924 1:35774990-35775012 AAAATAATTTCGGCCAGGTGAGG + Intergenic
905563861 1:38947949-38947971 GCCCTATCTTTGGCCAGGTGTGG - Intergenic
905622565 1:39461496-39461518 GAAGTATTTCTGGCCAGGCGTGG + Intronic
905720772 1:40199150-40199172 GCAGAATTTGAGCCCAGGTGAGG + Intronic
906193888 1:43916867-43916889 TAAGAATTTTGGGCCAGGTGCGG - Intronic
907351414 1:53834815-53834837 GGAACATTTTAGGCCAGGTGCGG + Intronic
907362069 1:53925808-53925830 AAAGTATTTTAGGCCAGGTGTGG + Intronic
908504815 1:64786498-64786520 TCACTACTTTGGGCCAGGTGCGG + Intronic
908542326 1:65133363-65133385 TTAATATTTTCGGCCAGGCGCGG + Intergenic
909853199 1:80495579-80495601 GCAGATTTTTGGGCCGGGTGCGG - Intergenic
910789364 1:91035394-91035416 TCACTATTTTTGGCCAGGTGTGG - Intergenic
910944061 1:92569563-92569585 GAAATATTTTGGGCCAGGCGCGG + Intronic
911203647 1:95071255-95071277 GCAGGATTTTAGGCCAGGGGTGG + Intronic
912579653 1:110708599-110708621 AAAGTGTTTTGGGCCAGGTGTGG - Intergenic
914229718 1:145754625-145754647 ACAATGTTTTCAGCCAGGTGGGG - Intronic
914516944 1:148382409-148382431 AGAGTATTTTAGGCCAGGTATGG - Intergenic
914708981 1:150195624-150195646 GGAGTATTACTGGCCAGGTGTGG + Intergenic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
914891115 1:151624254-151624276 TTAGAATTTTAGGCCAGGTGAGG - Intronic
914896459 1:151679013-151679035 ACAGTGTTTGTGGCCAGGTGCGG - Intronic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
917335193 1:173918517-173918539 TCAGTATTTTAGGCCAAGCGTGG + Intergenic
918109268 1:181441438-181441460 GCAGTGAATTGGGCCAGGTGCGG - Intronic
919449938 1:197759257-197759279 GAAGTATTTAAGGCCAGGTATGG - Intronic
920789676 1:209077832-209077854 GCAGCATTATTGGCCAGGCGCGG - Intergenic
921284682 1:213598625-213598647 ACATTATTTTAGGCCGGGTGTGG + Intergenic
922201768 1:223409060-223409082 TCAGTATTTGGGGCCAGGTGGGG - Intergenic
922487229 1:225983692-225983714 TGCGTATTTTAGGCCAGGTGTGG - Exonic
923229815 1:231974808-231974830 GAAATATTTTAGGCCGGGTGTGG + Intronic
923489445 1:234470904-234470926 GCACAATTTTGGGCCAGGCGTGG - Intronic
923587096 1:235283064-235283086 GAAGTAGTATCGGCCAGGTGCGG - Intronic
924077229 1:240352818-240352840 GCAGAATTTCCAGCCACGTGAGG + Intronic
924118743 1:240774467-240774489 GAAGTATTTTGTGCCAGGTGCGG - Intergenic
924670508 1:246119701-246119723 TGAGTGTTTTAGGCCAGGTGTGG - Intronic
1062891865 10:1068189-1068211 GCAGTATCTTAGGCCGGGCGCGG + Intronic
1062950255 10:1494040-1494062 GCCCTATTATGGGCCAGGTGCGG - Intronic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064773404 10:18749042-18749064 AAAGAATTTTGGGCCAGGTGTGG - Intergenic
1064939229 10:20714155-20714177 AAAGTTTTTTAGGCCAGGTGTGG - Intergenic
1065769367 10:29063019-29063041 ACAATTTTTTGGGCCAGGTGTGG - Intergenic
1065911711 10:30312288-30312310 ACAGTATTCTCGGCCAGGCATGG + Exonic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1066439299 10:35423182-35423204 TAAAAATTTTCGGCCAGGTGTGG + Intronic
1066599035 10:37084289-37084311 GCTGTCCTTTCGGCCAGGCGCGG + Intergenic
1069458754 10:68575091-68575113 GAAGTATTGTAGGCCTGGTGTGG + Intronic
1069517998 10:69095015-69095037 AAAGTACTTTCGGCCGGGTGTGG + Intronic
1070209262 10:74298613-74298635 TGAGGATTTTAGGCCAGGTGTGG + Intronic
1070460189 10:76659208-76659230 TGATTATTTTCAGCCAGGTGTGG - Intergenic
1070795786 10:79215587-79215609 GCAGTGATTTAGGCCAGGTGTGG - Intronic
1071588749 10:86850789-86850811 GGAGAACTTTAGGCCAGGTGTGG - Intronic
1071832772 10:89388394-89388416 GAATTTTTTTCGGCCAGGCGCGG - Intronic
1072331074 10:94352529-94352551 GCAGTCGTTTAGGCCAGGCGTGG + Intronic
1072490147 10:95897387-95897409 GTAGTATTATAGGCCGGGTGCGG + Intronic
1072977860 10:100074705-100074727 GCAGGGTTTTCGGCCGGGCGTGG - Intronic
1073154481 10:101335631-101335653 AAAGAATTTTGGGCCAGGTGTGG + Intergenic
1073422121 10:103433202-103433224 TATGTATTTACGGCCAGGTGTGG + Intronic
1073537185 10:104288178-104288200 AAAGTGTTTTCGGCCGGGTGAGG - Intronic
1073968216 10:109015634-109015656 ACAGTATTTTAGGCCGGGAGCGG + Intergenic
1074057190 10:109933392-109933414 GAAGAAATTTCGGCCAGGCGCGG + Intergenic
1078002714 11:7510792-7510814 ATAGTATTTTAAGCCAGGTGTGG - Exonic
1079247675 11:18765000-18765022 CAAGTCTTTTGGGCCAGGTGCGG - Intronic
1081965385 11:47166150-47166172 AGAGCATTTTCGGCCGGGTGTGG - Intronic
1082008212 11:47432740-47432762 CCAGTATCGTTGGCCAGGTGCGG + Intergenic
1082262625 11:50089018-50089040 GTATTAATTTTGGCCAGGTGCGG + Intergenic
1083826608 11:65207488-65207510 GCAAGAGTTTGGGCCAGGTGCGG - Intronic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1085061270 11:73449258-73449280 ACAGTAGCTTAGGCCAGGTGCGG - Intronic
1085092837 11:73733256-73733278 GCTGTATTTTAGGCCAGGCGCGG + Intronic
1085370845 11:76003509-76003531 TCATTATTTTAGGCCAGGTGCGG - Intronic
1087391115 11:97536675-97536697 AAAGAATTTTTGGCCAGGTGTGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1088168257 11:106964687-106964709 AAAATATTTTTGGCCAGGTGAGG + Intronic
1088501461 11:110487431-110487453 TTAATATTTTGGGCCAGGTGCGG + Intergenic
1089167368 11:116487497-116487519 GAAGAATTTGGGGCCAGGTGTGG + Intergenic
1089227885 11:116941294-116941316 AAGGTATTTTCGGCCAGGCGCGG - Intronic
1089384250 11:118057619-118057641 GCAGTGTTGCTGGCCAGGTGTGG + Intergenic
1089787268 11:120916953-120916975 CCAGGCTTTCCGGCCAGGTGTGG + Intronic
1089961438 11:122620594-122620616 GCATGAATTTTGGCCAGGTGTGG + Intergenic
1089992573 11:122875481-122875503 ACAGTAATATTGGCCAGGTGCGG + Intergenic
1091416572 12:292194-292216 GCATTATTTTAGGCCAGGCAAGG - Intronic
1091774682 12:3176774-3176796 GCACGATTCTCAGCCAGGTGTGG - Intronic
1091861900 12:3792877-3792899 GCAGTCTTTTCAGGCAGGAGTGG + Intronic
1092427372 12:8385633-8385655 GCAGCACTTTCGGCCCGGGGGGG + Intergenic
1092690245 12:11101196-11101218 GTAATGTTTTGGGCCAGGTGTGG + Intronic
1093871384 12:24295851-24295873 ACAGTATTCAAGGCCAGGTGCGG - Intergenic
1095206591 12:39445382-39445404 GAACTTTTTTTGGCCAGGTGAGG - Intergenic
1095974909 12:47933321-47933343 AAACTATTTTCAGCCAGGTGTGG - Intronic
1096142855 12:49256887-49256909 ACAGTAATTTAGGCCAGGAGCGG + Intronic
1097014935 12:55979061-55979083 ACTGTATTTCTGGCCAGGTGTGG - Intronic
1097019838 12:56012561-56012583 AAAGTAATTTAGGCCAGGTGTGG - Intronic
1097064242 12:56309113-56309135 TAAGAATTTTCTGCCAGGTGCGG + Intronic
1097395954 12:59074992-59075014 GCAGTATGTTCTGTCAGGTGAGG + Intergenic
1097664571 12:62465017-62465039 GCATCATTTTTGGCCAGGTGTGG + Intergenic
1099080854 12:78178449-78178471 ACAGTATTTTGGGCCAGGTGGGG - Intronic
1100977279 12:100135555-100135577 GCAATATTTGAGGCCGGGTGTGG - Intronic
1101381841 12:104220431-104220453 AGTGTATTTTAGGCCAGGTGCGG + Intronic
1102087453 12:110154338-110154360 AAAGTATTTTTGGCCGGGTGCGG + Intronic
1102101884 12:110285532-110285554 GCAGTATTATCCTCCAGGTAAGG - Intronic
1102249581 12:111377182-111377204 GCTGTAATATGGGCCAGGTGTGG + Intergenic
1102699981 12:114830626-114830648 GAAGTATTTGAGGCCAGGTGTGG - Intergenic
1103686935 12:122739585-122739607 ACTTTATTTTAGGCCAGGTGTGG + Intergenic
1103818613 12:123679085-123679107 GCTGAATTATCGGCCAGGCGCGG - Intronic
1105718433 13:23090605-23090627 GTAAAATATTCGGCCAGGTGGGG - Intergenic
1107032553 13:35868309-35868331 GCTGTAGGTTGGGCCAGGTGCGG - Intronic
1107160583 13:37222691-37222713 AAAATATTTTTGGCCAGGTGCGG + Intergenic
1107533949 13:41310378-41310400 ACCGTAATTCCGGCCAGGTGTGG + Intergenic
1109305681 13:60638217-60638239 GTAGAGTTTTCGGCCAGGTGCGG + Intergenic
1109634741 13:65100515-65100537 GCAGTAATTTGGGCCAGGATGGG + Intergenic
1110739307 13:78976068-78976090 GGAGAATTTGGGGCCAGGTGCGG - Intergenic
1112184759 13:97116808-97116830 CCATTGTTTTCGGCCAGGAGGGG + Intergenic
1112274959 13:98008549-98008571 TCTGTATTTTCTGCCAGGGGAGG - Intronic
1112500227 13:99937337-99937359 GCATTTTTTTTGGCCAGGCGCGG - Intergenic
1113435949 13:110291103-110291125 CCAGTGTTCTCGGACAGGTGAGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114228132 14:20757209-20757231 ACAGTATTGTAGGCCTGGTGAGG - Intergenic
1115212297 14:30979956-30979978 GAATTATTTCAGGCCAGGTGCGG + Intronic
1116450036 14:45054159-45054181 GCTGTATTTTGGGCTGGGTGTGG - Intronic
1116810836 14:49538571-49538593 GCAGAATGCTGGGCCAGGTGTGG + Intergenic
1117835502 14:59800688-59800710 GATGTATTTTTGGCCCGGTGTGG - Intronic
1118213096 14:63784200-63784222 GTAATTTTTTGGGCCAGGTGCGG + Intergenic
1118664852 14:68056786-68056808 GAAATATTTACGGCCAGGCGCGG + Intronic
1118868512 14:69722190-69722212 ATAGTATTTTCAGCCAGGTGCGG + Intergenic
1119512804 14:75224976-75224998 AAGGTATTTTTGGCCAGGTGCGG + Intergenic
1119831031 14:77702862-77702884 ACATTTTTTTTGGCCAGGTGAGG + Intronic
1120196978 14:81495346-81495368 GTACCATTTGCGGCCAGGTGCGG + Intronic
1120364290 14:83545825-83545847 GAATTATTTGTGGCCAGGTGCGG - Intergenic
1121100344 14:91245793-91245815 AAACTATTTCCGGCCAGGTGCGG + Intronic
1121186288 14:91973312-91973334 CTAGTATTTTAGGCCAGGTGTGG - Intronic
1121766938 14:96495769-96495791 TCAGTAATCTGGGCCAGGTGCGG + Intergenic
1121768389 14:96507563-96507585 AAACTATTTTCGGCCAGGCGCGG - Intronic
1122641005 14:103159370-103159392 GAGTTATTATCGGCCAGGTGTGG - Intergenic
1122977511 14:105176957-105176979 GAAGCAGTTCCGGCCAGGTGAGG - Exonic
1124291635 15:28457220-28457242 GCAGCACTTGGGGCCAGGTGAGG - Intergenic
1124446146 15:29734774-29734796 GTGATATTTTCGGCCGGGTGTGG - Intronic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1124916259 15:33977780-33977802 GGACTATTTCAGGCCAGGTGTGG + Intronic
1125427176 15:39560792-39560814 GCTGTCATTTCGGCCGGGTGTGG + Intergenic
1125660541 15:41391327-41391349 ACAGAATTTAGGGCCAGGTGTGG + Intronic
1127063140 15:55207944-55207966 TCAGGTTTTTTGGCCAGGTGTGG - Intronic
1127226965 15:56941074-56941096 TTATTATTTTAGGCCAGGTGTGG + Intronic
1127512751 15:59658558-59658580 GCCATGTTTTCGGCCAGGGGCGG + Intergenic
1127851715 15:62919070-62919092 GTAGTCTTTTGGGCCAGGTGCGG - Intergenic
1127942811 15:63717561-63717583 TAAGTAGTTTCGGCCAGGTGAGG + Intronic
1128200247 15:65799134-65799156 GCCTTTCTTTCGGCCAGGTGTGG - Intronic
1128492702 15:68165409-68165431 GTAAAATTTTTGGCCAGGTGCGG - Intronic
1128632106 15:69278319-69278341 GGAATATTTTTGGTCAGGTGTGG - Intergenic
1128711442 15:69875246-69875268 GCAGTATTTGGGGTCAGCTGTGG - Intergenic
1129834588 15:78694085-78694107 GCAGAATATTCAGCCAGGTGTGG - Intronic
1130796057 15:87210676-87210698 GCAGAATTTTCTTCCAGCTGAGG + Intergenic
1131074667 15:89487391-89487413 TCAGAATTTGGGGCCAGGTGTGG + Intronic
1131501191 15:92968229-92968251 TTAATATTTTCAGCCAGGTGTGG + Intronic
1132202008 15:99961488-99961510 AGAGTATGTTTGGCCAGGTGCGG + Intergenic
1132353078 15:101152482-101152504 GTAGTAGTGTAGGCCAGGTGCGG - Intergenic
1132373350 15:101312538-101312560 AAAATATTTTAGGCCAGGTGTGG + Intronic
1132982997 16:2748812-2748834 GCACTAATTGGGGCCAGGTGTGG - Intergenic
1133179133 16:4039386-4039408 GCAGGATTGCAGGCCAGGTGCGG + Intronic
1133749241 16:8711947-8711969 TTACTATTTTTGGCCAGGTGCGG + Intronic
1133788107 16:8988599-8988621 GCACTGTTTTTGGCCGGGTGCGG - Intergenic
1134334798 16:13288503-13288525 GATCTGTTTTCGGCCAGGTGGGG + Intergenic
1135276565 16:21118269-21118291 GAAGTAGTTTAGGCCAGATGTGG - Intronic
1135594209 16:23729036-23729058 AAAATATTTTCGGCCGGGTGCGG - Intergenic
1135638930 16:24103161-24103183 TCATTATTTTTGGCCACGTGCGG - Intronic
1138254964 16:55548056-55548078 ACATTTTTTTTGGCCAGGTGCGG - Intronic
1138645303 16:58420301-58420323 TCCGTTTTTTTGGCCAGGTGTGG + Intergenic
1139878399 16:70164567-70164589 TAAGGATTTTAGGCCAGGTGCGG + Intergenic
1140169714 16:72591721-72591743 TCAGTGTTTTCAGTCAGGTGCGG + Intergenic
1140359165 16:74330249-74330271 TAAGGATTTTAGGCCAGGTGCGG - Intergenic
1143160944 17:4870532-4870554 AAAATATTTTAGGCCAGGTGTGG + Intronic
1143909512 17:10236175-10236197 GCATTGCTTTGGGCCAGGTGTGG + Intergenic
1144340327 17:14304327-14304349 GCAGTGTTTGGGGCCAGTTGCGG - Intronic
1145229706 17:21164534-21164556 GCAGTGGCCTCGGCCAGGTGCGG + Intronic
1146020875 17:29277720-29277742 GCATGTTTTCCGGCCAGGTGCGG + Intronic
1146218671 17:30999402-30999424 GTGGTATTCTTGGCCAGGTGTGG - Exonic
1146953742 17:36923832-36923854 GCAGTCTTCTCTGGCAGGTGTGG + Intergenic
1146999109 17:37347610-37347632 TAACTATTTTAGGCCAGGTGCGG + Intronic
1147198397 17:38782895-38782917 GCTATATTTCAGGCCAGGTGCGG + Intronic
1147850761 17:43440854-43440876 ACATTATATACGGCCAGGTGCGG + Intergenic
1149770638 17:59318127-59318149 GCAAGAATTTCGGCCAGGTGCGG - Intergenic
1149842172 17:59975070-59975092 GCACTATTTGTGGCCAGGTGCGG + Intergenic
1149908687 17:60550517-60550539 ACAGTACTTCTGGCCAGGTGTGG - Intergenic
1149930054 17:60742821-60742843 GTAATATTTTCGGCCAGGCACGG + Intronic
1149968611 17:61193465-61193487 ACTGAATTTTTGGCCAGGTGCGG + Intronic
1149970845 17:61216989-61217011 GCACTAGTTTTGGCCGGGTGGGG + Intronic
1150231954 17:63558744-63558766 GGAGTATTTTTGGCCAGGTATGG - Intronic
1150751844 17:67871059-67871081 GAAGCATTTTCGGCCGGGCGCGG - Intronic
1150910975 17:69387169-69387191 ACAGGATTTCTGGCCAGGTGCGG + Intergenic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1152789493 17:82271358-82271380 GGAGTATTTTGGGCCGGGTGTGG - Intronic
1152872384 17:82763447-82763469 ACAGGGTTTTGGGCCAGGTGCGG + Intronic
1152899926 17:82934760-82934782 TCAATATTTTAGGCCAGGTACGG - Intronic
1153291462 18:3505944-3505966 GCAAATTTTTGGGCCAGGTGCGG + Intronic
1153600896 18:6780596-6780618 TCAGTCTCTTAGGCCAGGTGCGG + Intronic
1153706190 18:7748107-7748129 GCAGTAGGTGTGGCCAGGTGTGG + Intronic
1155031274 18:21986371-21986393 GCTGTACTTCAGGCCAGGTGCGG - Intergenic
1155343847 18:24839242-24839264 TCTGTATTATCGGCCAGGCGTGG + Intergenic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1157093299 18:44661662-44661684 AAAGCATTTTTGGCCAGGTGTGG - Intergenic
1157987432 18:52454613-52454635 AAAGTATTTTCGACAAGGTGAGG - Intronic
1159018485 18:63122623-63122645 GCAGTATTTGAGCCCTGGTGTGG - Intergenic
1159704530 18:71670279-71670301 CCAGCATTTTCGGCCAGGCATGG - Intergenic
1161292963 19:3505708-3505730 ACAGGTTTTTAGGCCAGGTGCGG - Intergenic
1161610764 19:5241177-5241199 GGAGATTTTTAGGCCAGGTGTGG - Intronic
1162250666 19:9440572-9440594 TCAGTATTCTTGGTCAGGTGTGG + Intergenic
1162354345 19:10172123-10172145 AAAGTATTTTAGGCCGGGTGTGG + Intronic
1162648837 19:12069662-12069684 TTTGTATTTTAGGCCAGGTGCGG + Intronic
1163930283 19:20383652-20383674 GAAAAATTTTTGGCCAGGTGCGG - Intergenic
1163988287 19:20972854-20972876 GAAACATTTTTGGCCAGGTGCGG + Intergenic
1164064471 19:21703668-21703690 GCAAGTTTTTGGGCCAGGTGTGG - Intergenic
1164184184 19:22847808-22847830 AAATTATTTTCGGCCAGGCGTGG + Intergenic
1164211084 19:23097846-23097868 GAGGTATTGTGGGCCAGGTGTGG + Intronic
1165163227 19:33831036-33831058 GAAGTATTTGAGGCCAGGTGCGG - Intergenic
1165689361 19:37851314-37851336 GAAATATTCTAGGCCAGGTGTGG + Intergenic
1165808953 19:38599036-38599058 GGACTAATTTAGGCCAGGTGCGG + Intronic
1166548861 19:43651724-43651746 AAATTATTTTTGGCCAGGTGTGG - Intronic
1166816063 19:45546957-45546979 GCAGAGTTTTAGGCCAGGCGCGG - Intronic
1167408625 19:49331470-49331492 ACATTATTATGGGCCAGGTGAGG - Intergenic
1168162023 19:54517063-54517085 ACACTATTTTCGGACAGGCGCGG + Intergenic
1168592663 19:57650356-57650378 GTATAATTTTCGGCCGGGTGTGG + Intergenic
925415759 2:3669181-3669203 ACAGTAATTCCGGCCAGGTGTGG + Intronic
926039432 2:9660904-9660926 GCAGTGATTTCTGCCAGTTGAGG - Intergenic
926935884 2:18086297-18086319 CCCCAATTTTCGGCCAGGTGCGG - Intronic
927158103 2:20233623-20233645 TCTGACTTTTCGGCCAGGTGTGG + Intergenic
927229914 2:20811772-20811794 GAACTAGTTTAGGCCAGGTGAGG - Intronic
927421520 2:22937288-22937310 TTATTACTTTCGGCCAGGTGTGG - Intergenic
927608656 2:24513996-24514018 GCAAATTTTTAGGCCAGGTGCGG + Intronic
927662624 2:25005754-25005776 GCAGTATTTTGGGCCGGGTGCGG + Intergenic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
929581333 2:43083332-43083354 GGAATATTTTCGGGCAGGGGAGG - Intergenic
929863133 2:45696244-45696266 AAAGTTATTTCGGCCAGGTGTGG - Intronic
930567746 2:53043921-53043943 ACACTATTTAAGGCCAGGTGTGG - Intergenic
930759014 2:55011315-55011337 GTAAAATTTTAGGCCAGGTGTGG - Intronic
931365053 2:61612105-61612127 GAAATTTTTTTGGCCAGGTGTGG - Intergenic
931398868 2:61912444-61912466 GTTTTATTTTAGGCCAGGTGCGG + Intronic
931548637 2:63416810-63416832 AAAGTATTTTGGGCCAGGTGTGG - Intronic
931920323 2:67008315-67008337 GCAGCATTTTGGGCTAGATGTGG + Intergenic
932663229 2:73675165-73675187 AGAATATTTTAGGCCAGGTGCGG + Intergenic
932671112 2:73738580-73738602 GAAGAACATTCGGCCAGGTGCGG + Intergenic
933108920 2:78372730-78372752 GCAAAAGCTTCGGCCAGGTGCGG + Intergenic
933408208 2:81889663-81889685 GAAGTGTTATAGGCCAGGTGTGG - Intergenic
933414010 2:81961856-81961878 GTAATATTTTCGGCCGGGCGCGG + Intergenic
933600152 2:84320701-84320723 TTAATATTTTAGGCCAGGTGTGG + Intergenic
933703034 2:85269596-85269618 CCAGTATTTTTGGCTGGGTGTGG - Intronic
933825600 2:86157493-86157515 ACAGTGTTTTGAGCCAGGTGTGG + Intronic
935982418 2:108640419-108640441 GCAGTACTTTCTGCCTGTTGTGG + Intronic
936037208 2:109122577-109122599 ACAGTAATTTAGGCCAGCTGTGG + Intergenic
936938928 2:117863070-117863092 TCACTATTTTTGGCCAGGTGCGG + Intergenic
937702414 2:124878971-124878993 AAAGTATTATTGGCCAGGTGTGG - Intronic
939928499 2:148202735-148202757 GCAGTTCTTTAGGCCAGGTGTGG + Intronic
941694794 2:168539253-168539275 ACAATATTTTCGGCCGGGCGCGG - Intronic
941800133 2:169650806-169650828 AAAATATTTTAGGCCAGGTGTGG + Intronic
942884048 2:180900422-180900444 GTAGCATTCTGGGCCAGGTGCGG - Intergenic
944121236 2:196242981-196243003 GAAGTTTTGTAGGCCAGGTGCGG - Intronic
944657326 2:201889104-201889126 GCAGAAGTTTAGGCCAGGCGAGG + Intronic
944679763 2:202066284-202066306 ACAATATTTTCAGCCGGGTGTGG + Intergenic
945050452 2:205819118-205819140 AAAATATCTTCGGCCAGGTGCGG - Intergenic
945222295 2:207497248-207497270 GAAGTATTTGCCGCCAGATGTGG - Intergenic
945243075 2:207694274-207694296 AAAGTACTTACGGCCAGGTGGGG + Intergenic
945590191 2:211719563-211719585 AAAGTGTTTTTGGCCAGGTGCGG + Intronic
945773690 2:214078260-214078282 GAATTATTCTAGGCCAGGTGTGG + Intronic
946064194 2:216972411-216972433 GCAGTGTTTTAGGGAAGGTGAGG - Intergenic
946242186 2:218363188-218363210 ACATCATTTTGGGCCAGGTGTGG + Intronic
946250575 2:218409007-218409029 AAAATATTTTTGGCCAGGTGCGG - Intergenic
947150585 2:227110968-227110990 GCAGTTTTGCCGGCCAGGCGTGG - Intronic
947413190 2:229865015-229865037 GCACAATATTGGGCCAGGTGTGG + Intronic
948800047 2:240429394-240429416 GCAGGGTTGTCAGCCAGGTGAGG - Intergenic
1168751893 20:288439-288461 GCACTGTCTTCTGCCAGGTGGGG - Intronic
1170246719 20:14228715-14228737 ACATTAATTTCGGCCAGCTGAGG + Intronic
1170384934 20:15805764-15805786 TCCGTATTTTTGGCCAGATGCGG - Intronic
1170476617 20:16721391-16721413 GCAATTTTTTCAGCCAGCTGGGG + Intergenic
1172398377 20:34626592-34626614 GGAGTTTTTTTGGCCAGGCGCGG - Intronic
1172769784 20:37374863-37374885 GTATTATTATTGGCCAGGTGTGG - Intronic
1174438297 20:50527647-50527669 GAATTATTTCAGGCCAGGTGCGG - Intronic
1176929292 21:14789052-14789074 GTTTTATTTTCGGCCAGGCGCGG + Intergenic
1177910101 21:27020170-27020192 ACATTATTTTTGGCCAGGCGCGG + Intergenic
1178363237 21:31967569-31967591 ACATTATTTTTGGCCAGGCGTGG + Intronic
1180202254 21:46231201-46231223 TCCCTATTTTAGGCCAGGTGTGG - Intergenic
1180941563 22:19662646-19662668 TAAGAATTTTAGGCCAGGTGCGG - Intergenic
1181460641 22:23083935-23083957 GCTGTGTTTTCAGCCAGGTGGGG + Intronic
1181874127 22:25926583-25926605 ACAAAACTTTCGGCCAGGTGTGG - Intronic
1182210519 22:28672588-28672610 TAAATATTTTAGGCCAGGTGTGG - Intronic
1182228194 22:28816403-28816425 GCTGTGTTTTCGGCTGGGTGCGG - Intergenic
1182617288 22:31595960-31595982 GGAGGATTTCAGGCCAGGTGTGG + Intronic
1183436882 22:37801506-37801528 GAAGTAAATTAGGCCAGGTGCGG - Intergenic
1183572019 22:38660483-38660505 GATGCATTTTCGGCCTGGTGTGG - Intronic
1183595808 22:38810170-38810192 ACATTATTTCCGGCCAGGTGTGG + Intergenic
1184958023 22:47905442-47905464 AAAGTATTTTAGGCTAGGTGTGG - Intergenic
1185262603 22:49877581-49877603 GCTGTTTTTTAGGCCAGGCGTGG - Intronic
949635438 3:5976839-5976861 GAAGCATTTTCGGCCGGGCGTGG - Intergenic
950033457 3:9867139-9867161 GCAGTATCTTCAGACAGGTCGGG + Exonic
950055101 3:10017916-10017938 GCAGTATCTTCAGACAGGTCGGG + Intergenic
950750417 3:15123872-15123894 GCAGCACTTTTGGCCAGGGGGGG - Intergenic
950867591 3:16201469-16201491 GACGAATTTTCGGCCAGGCGCGG - Intronic
951483056 3:23182207-23182229 AGAGTATTCTGGGCCAGGTGCGG - Intergenic
952459442 3:33508617-33508639 AAATTATTTTTGGCCAGGTGTGG - Intronic
953714922 3:45309004-45309026 ACAATATTTTAGGCCAGGAGTGG - Intergenic
954975994 3:54695306-54695328 AAAATATTTTCAGCCAGGTGTGG - Intronic
955262226 3:57404423-57404445 ACAAAAGTTTCGGCCAGGTGTGG + Intronic
955305825 3:57830296-57830318 TTACTATTTTAGGCCAGGTGTGG - Intronic
956823086 3:72971656-72971678 GAAGTTGTTTTGGCCAGGTGCGG + Intronic
956885289 3:73553281-73553303 GACCTATTATCGGCCAGGTGTGG + Intronic
957479428 3:80772450-80772472 GCCTTATTTTAGGCCGGGTGCGG + Intergenic
958029263 3:88087363-88087385 CCAGGATTTTCAGCCAGGTGTGG - Intronic
960041585 3:113155460-113155482 CAAACATTTTCGGCCAGGTGCGG + Intergenic
961282062 3:125771759-125771781 GCAGCACTTTCGGCCAAGCGGGG - Intergenic
961529738 3:127533232-127533254 GAAGTCTTTTGGCCCAGGTGGGG - Intergenic
961598800 3:128042866-128042888 TCTGTATCTTAGGCCAGGTGTGG - Intergenic
962810365 3:138954497-138954519 GCTATTTTTTTGGCCAGGTGTGG - Intergenic
963598468 3:147357217-147357239 CCAGTCTTTTCCGCCAGGCGCGG + Intergenic
965534432 3:169810772-169810794 GCTGCATTTCCGGCCGGGTGCGG + Intronic
965765692 3:172127946-172127968 GCTGTATCCTCGGCCGGGTGTGG - Intronic
966379667 3:179331486-179331508 GCACAACTTTAGGCCAGGTGCGG + Intronic
966550110 3:181195284-181195306 AAAGAATTTACGGCCAGGTGCGG - Intergenic
966796439 3:183718983-183719005 GAAGTATTTTAGGCCAGGCATGG - Intronic
967007249 3:185396078-185396100 TAGGTATATTCGGCCAGGTGCGG + Intronic
967194377 3:187013873-187013895 CCAGTATTTGCGGCCGGGTGCGG - Intronic
967547728 3:190751476-190751498 GGATTCATTTCGGCCAGGTGTGG - Intergenic
970640886 4:18064755-18064777 TCAGTATTTTTTGCCATGTGTGG + Intergenic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
971289600 4:25324951-25324973 GAAATATTTTCGGCCGGGCGCGG + Intronic
972595692 4:40528120-40528142 GAAATGTTTTGGGCCAGGTGTGG + Intronic
972675232 4:41254098-41254120 GCAGAATTCTTAGCCAGGTGTGG - Intergenic
972741507 4:41891444-41891466 GCATTTTTTTGGGCAAGGTGGGG + Intergenic
973259097 4:48142970-48142992 AAAATATTATCGGCCAGGTGTGG - Intronic
973752034 4:54030821-54030843 TTAGCATTTTAGGCCAGGTGCGG - Intronic
973988378 4:56378094-56378116 TCTATATTTTAGGCCAGGTGTGG - Intronic
974521649 4:62987998-62988020 GTATTATTTATGGCCAGGTGTGG + Intergenic
974534077 4:63152337-63152359 TCTGTATTTCCAGCCAGGTGAGG + Intergenic
974708649 4:65558165-65558187 TAAGAATTTTGGGCCAGGTGTGG - Intronic
975264185 4:72342660-72342682 GAAGTAATTGGGGCCAGGTGTGG - Intronic
976567485 4:86567508-86567530 TAAGAATTTTCAGCCAGGTGTGG - Intronic
976657019 4:87499164-87499186 CCAAGATTTTAGGCCAGGTGCGG - Intronic
976729713 4:88249454-88249476 ACCGTATTTCTGGCCAGGTGAGG - Intergenic
977284097 4:95080524-95080546 TAAATATTTTAGGCCAGGTGTGG - Intronic
977566341 4:98584229-98584251 AGAGTATTTCAGGCCAGGTGTGG - Intronic
978009966 4:103668555-103668577 ACAGTTGTTTCGGCCAGGTGTGG + Intronic
978172989 4:105696139-105696161 GGTGTAGTTTGGGCCAGGTGTGG - Intronic
978335205 4:107659862-107659884 GCAGTATTTGAGGCCAGGGGTGG - Intronic
979750749 4:124275878-124275900 GCAGAATTTTCCACCAGGTATGG + Intergenic
980042595 4:127956213-127956235 GAAATACTTTTGGCCAGGTGCGG + Intronic
980922139 4:139097342-139097364 GCAATATTTTCGGCCAGACGCGG + Intronic
980973434 4:139588160-139588182 CCAGTGTTTTAGGCCGGGTGTGG + Intronic
983614481 4:169686703-169686725 CCCATATTTTTGGCCAGGTGTGG - Intronic
985255975 4:188070408-188070430 GCACTATACTTGGCCAGGTGTGG + Intergenic
987706322 5:21465048-21465070 GAAATATATTTGGCCAGGTGCGG - Intergenic
988504863 5:31813158-31813180 TAAGTATTCACGGCCAGGTGCGG + Intronic
989008911 5:36847410-36847432 TAATTATTTTTGGCCAGGTGTGG - Intergenic
989082383 5:37637049-37637071 GAAGAATTTTAGGCCAGGCGTGG + Intronic
989495361 5:42105485-42105507 TAAATATTTTTGGCCAGGTGTGG - Intergenic
990574119 5:57108438-57108460 TAAGAATTTTAGGCCAGGTGCGG + Intergenic
990899718 5:60737446-60737468 GTAGTATTTATGGCCGGGTGCGG + Intergenic
992470870 5:77052060-77052082 TAAGAATTTTTGGCCAGGTGTGG + Intronic
992731250 5:79671810-79671832 TTACTATTTTCGGCCGGGTGTGG + Intronic
993005374 5:82423530-82423552 AAAGTGTTCTCGGCCAGGTGCGG - Intergenic
993827508 5:92709679-92709701 GTAGTATTTTAGGCCAGTTGTGG - Intergenic
994079303 5:95688536-95688558 GCATGATTTCTGGCCAGGTGTGG - Intronic
995027853 5:107445311-107445333 GCAATCTTTGAGGCCAGGTGTGG - Intronic
996087404 5:119319116-119319138 AAAGTATTCTTGGCCAGGTGTGG + Intronic
996435054 5:123424846-123424868 GAAGACTTTTTGGCCAGGTGTGG + Intergenic
997446533 5:133944282-133944304 GCATGATTATCGGCCAGGCGCGG - Intergenic
997535645 5:134619037-134619059 ACATTATTTTTGGCCAAGTGTGG + Intronic
997826813 5:137113852-137113874 GAAATATTTTCTACCAGGTGTGG + Intronic
999294757 5:150452106-150452128 GTACTATTATCGGCCAGGCGCGG - Intergenic
999315072 5:150578416-150578438 ACAGCAGTTTCGGCCGGGTGCGG + Intergenic
999395615 5:151225122-151225144 TTAGTATTATTGGCCAGGTGTGG - Intronic
1000235497 5:159355722-159355744 GATTTATTTTAGGCCAGGTGCGG - Intergenic
1001533414 5:172480936-172480958 AAAGTATATTAGGCCAGGTGTGG - Intergenic
1002129791 5:177073592-177073614 TAAGTCTTTCCGGCCAGGTGCGG - Intronic
1002149289 5:177214039-177214061 ACGGTATTTACGGCCAGGTGCGG + Intronic
1002396645 5:178961523-178961545 ACAGCATTTTTGGCCAGGTGTGG + Intronic
1002546596 5:179950405-179950427 GCAGTTATTTAGGCCGGGTGGGG - Intronic
1002765315 6:234152-234174 ACAATGTTTTCGGCCTGGTGTGG - Intergenic
1002939917 6:1706955-1706977 GCAGTATTTTCGGGAAGGCAAGG + Intronic
1003028060 6:2576374-2576396 CCAGGGTTTTAGGCCAGGTGTGG - Intergenic
1004126302 6:12877408-12877430 ACAGTATTTTCTTCCAGGAGAGG - Intronic
1004545837 6:16597391-16597413 GCAGTATTCTCAACCATGTGAGG - Intronic
1005439167 6:25846899-25846921 ATAATATTTCCGGCCAGGTGCGG - Intronic
1006660162 6:35634897-35634919 ACAGCATTTGAGGCCAGGTGTGG + Intronic
1006766059 6:36508224-36508246 GTGGTAATTTTGGCCAGGTGTGG - Intronic
1006859904 6:37164674-37164696 CCAGCATTTTCGGCCGGGCGCGG + Intergenic
1006895801 6:37469816-37469838 ACAATATATTAGGCCAGGTGCGG - Intronic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1007876282 6:45106139-45106161 GCAATTTTCTTGGCCAGGTGTGG + Intronic
1009021797 6:57954597-57954619 GAAATATATTTGGCCAGGTGCGG + Intergenic
1009418162 6:63438120-63438142 AAACTATTTTTGGCCAGGTGCGG + Intergenic
1009425517 6:63509353-63509375 ATAGTATTTTTGGCCAGGCGTGG - Intergenic
1010138604 6:72585945-72585967 TAAGAATTTTGGGCCAGGTGTGG - Intergenic
1013743674 6:113319462-113319484 GAAGTATTATTGGCCAGGTGTGG + Intergenic
1015963648 6:138675822-138675844 TAAGAATTTTAGGCCAGGTGCGG - Intronic
1016888392 6:148981013-148981035 GTGGTCTTTCCGGCCAGGTGTGG - Intronic
1017930216 6:158946003-158946025 ACATTATTTCTGGCCAGGTGTGG - Intergenic
1020448350 7:8293859-8293881 GTAAGATTTTTGGCCAGGTGTGG + Intergenic
1022168368 7:27796569-27796591 TTACTATTATCGGCCAGGTGCGG + Intronic
1022568371 7:31426439-31426461 GAAGTATCTTAGGCCGGGTGCGG - Intergenic
1023013342 7:35942452-35942474 TCAGTGTTGTTGGCCAGGTGCGG - Intergenic
1023190551 7:37576472-37576494 TAAATATTTTCGGCCAGGTGCGG + Intergenic
1023719955 7:43082874-43082896 GATGTATTGTAGGCCAGGTGTGG + Intergenic
1023810713 7:43909434-43909456 CCAGTATTTTAGGCCAGGTACGG + Intronic
1024077789 7:45831380-45831402 TCAGTGTTGTTGGCCAGGTGCGG + Intergenic
1024329896 7:48145174-48145196 GCAGAGTTTATGGCCAGGTGTGG - Intergenic
1025119844 7:56292301-56292323 TAAGTTTTTTTGGCCAGGTGCGG - Intergenic
1025155496 7:56602466-56602488 GCATGATTATCAGCCAGGTGCGG - Intergenic
1025588001 7:62817591-62817613 ACAGTGTTTCCAGCCAGGTGTGG + Intergenic
1025865673 7:65378450-65378472 GAAGTATTTTTGGCCGGGCGTGG + Intronic
1027000348 7:74648654-74648676 GTAGCATTTGCAGCCAGGTGCGG - Intergenic
1027024924 7:74844299-74844321 AAAGAATTTTCGGCCAGGCGTGG - Intronic
1027062840 7:75099820-75099842 AAAGAATTTTCGGCCAGGCGTGG + Intronic
1027171155 7:75873612-75873634 GCAACATTCTTGGCCAGGTGTGG + Intronic
1029074338 7:97924283-97924305 GTAGCACTTTCGGCCAGGGGGGG + Intergenic
1029280349 7:99431416-99431438 CTATTATTTTTGGCCAGGTGCGG - Intronic
1029815969 7:103095382-103095404 TTGGTATTTTTGGCCAGGTGCGG - Intronic
1030228399 7:107178740-107178762 GTACTTTTTTTGGCCAGGTGCGG + Intronic
1030839623 7:114332623-114332645 GCAGTATTTGCAGTCAGGAGAGG - Intronic
1032222560 7:130005770-130005792 GGAAAATTTTGGGCCAGGTGCGG - Intergenic
1033080023 7:138287380-138287402 ATAGTAATTTCTGCCAGGTGTGG - Intergenic
1033090626 7:138382529-138382551 ATAGTAATTTAGGCCAGGTGTGG + Intergenic
1034648177 7:152667114-152667136 AAAGTATTATAGGCCAGGTGCGG + Intronic
1036160384 8:6382195-6382217 GCAGGATTTTGGGCTGGGTGTGG + Intergenic
1036243367 8:7097007-7097029 GCAGCACTTTTGGCCAGGGGAGG - Intergenic
1036257444 8:7217062-7217084 GCAGCACTTTCGGCAAGGGGAGG + Intergenic
1036309490 8:7675658-7675680 GCAGCACTTTCGGCAAGGGGAGG + Intergenic
1036360047 8:8070461-8070483 GCAGCACTTTCGGCAAGGGGAGG - Intergenic
1036579852 8:10063671-10063693 CTAGTCTTTTCGGCCATGTGAGG + Intronic
1036890917 8:12596507-12596529 GCAGCACTTTCGGCAAGGGGAGG + Intergenic
1036898463 8:12654423-12654445 GCAGCACTTTTGGCCAGGGGAGG + Intergenic
1037237821 8:16741373-16741395 GTGATATTTTTGGCCAGGTGGGG + Intergenic
1037632344 8:20669639-20669661 GCAGAATTTACTGCCAGGAGAGG - Intergenic
1039681165 8:39738094-39738116 GCTGCATTTTTGGCCAGGTACGG + Intergenic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1043093637 8:75937035-75937057 ACAATATTTTGGGCCGGGTGTGG + Intergenic
1044690294 8:94870339-94870361 GTATTATTTCAGGCCAGGTGCGG - Intronic
1045847087 8:106649984-106650006 AAAATATTTTTGGCCAGGTGCGG - Intronic
1046173099 8:110538353-110538375 AAAGCACTTTCGGCCAGGTGTGG + Intergenic
1046932172 8:119852643-119852665 GAAGAAATTTGGGCCAGGTGTGG - Intronic
1048162835 8:132036921-132036943 TCAGTATCTTCTCCCAGGTGTGG - Intronic
1049111257 8:140645271-140645293 GAAGTAATCTAGGCCAGGTGCGG - Intergenic
1050568102 9:6908525-6908547 GGAGCATGTTGGGCCAGGTGGGG - Intronic
1052096137 9:24386744-24386766 ACAGTCTTTTAGGCCAGGTATGG + Intergenic
1052794471 9:32910679-32910701 GAAGAATTTAGGGCCAGGTGTGG + Intergenic
1052939540 9:34121652-34121674 GCCCTCTTTTCGGCCAGGCGCGG + Intronic
1053203017 9:36165523-36165545 AGGGTATTTTTGGCCAGGTGCGG + Intergenic
1053342395 9:37348666-37348688 GTTGTAGTTTGGGCCAGGTGTGG - Intronic
1053586395 9:39463565-39463587 TCAGAATTTTTGGCCAGGCGCGG - Intergenic
1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG + Intronic
1054789871 9:69246381-69246403 CATGTGTTTTCGGCCAGGTGTGG - Intronic
1055379751 9:75693327-75693349 GCAGTATTCTAAGCCAGGTGCGG + Intergenic
1056919904 9:90778196-90778218 TCAGGATTTTCAGCCGGGTGCGG + Intergenic
1058203687 9:102074873-102074895 GTAGTATTTTCGGCTGGGCGCGG + Intergenic
1058339321 9:103874920-103874942 TAAATATTTTTGGCCAGGTGTGG + Intergenic
1058405800 9:104673014-104673036 ACAGTGTTTCAGGCCAGGTGTGG + Intergenic
1059291213 9:113225857-113225879 GCAAAGTGTTCGGCCAGGTGTGG + Intronic
1059493292 9:114687901-114687923 GGAGTAAATTAGGCCAGGTGTGG - Intergenic
1060380343 9:123164335-123164357 GCTGTATTTCTGGCCGGGTGCGG - Intronic
1060970762 9:127736327-127736349 TAAGTATTTCCGGCCAGGTGCGG + Intergenic
1061022384 9:128024610-128024632 GCAGTCTTTATGGCCTGGTGTGG + Intergenic
1061099419 9:128481178-128481200 ACAGTTTTTTGGGCCAGGTGTGG + Intronic
1061654167 9:132075825-132075847 GCAGTTTTTTAGGCCAGACGTGG - Intronic
1061800433 9:133110633-133110655 GTAGAATTTCAGGCCAGGTGTGG + Intronic
1062153853 9:135035122-135035144 GCAGGATTGCCAGCCAGGTGCGG + Intergenic
1062576366 9:137210498-137210520 GAACTATTTCTGGCCAGGTGTGG - Intronic
1062608942 9:137364329-137364351 TCATTAATTTAGGCCAGGTGCGG + Intronic
1185482558 X:458730-458752 GCGGTGTTTGCGGCCAGGCGTGG - Intergenic
1186296613 X:8155634-8155656 GCATAATTTGTGGCCAGGTGTGG + Intergenic
1186842234 X:13495548-13495570 ACACTATGTTCTGCCAGGTGTGG + Intergenic
1187085973 X:16044304-16044326 GAAAGATTTTAGGCCAGGTGCGG + Intergenic
1187086955 X:16050868-16050890 GAAAGATTTTAGGCCAGGTGCGG + Intergenic
1187539189 X:20174635-20174657 GTAGAGTTTTAGGCCAGGTGCGG - Intronic
1187919100 X:24183475-24183497 ATAGCATTTTCGGCCAGGCGTGG - Intronic
1187970379 X:24652791-24652813 ACATTATTTTCGGCCAGGCACGG + Intronic
1189778219 X:44488991-44489013 GCAGGATATAGGGCCAGGTGCGG + Intergenic
1189966933 X:46383051-46383073 ACAATATCTTGGGCCAGGTGTGG + Intergenic
1190307084 X:49090351-49090373 GCTTTATTTTGGGCCGGGTGTGG - Intronic
1193861463 X:86673043-86673065 AGAATATTTTAGGCCAGGTGTGG + Intronic
1193889790 X:87031151-87031173 ACAGAATTTCCAGCCAGGTGCGG - Intergenic
1194052877 X:89093819-89093841 GCAGTATTATGGGCCTTGTGAGG + Intergenic
1195896020 X:109747071-109747093 GAAGAAACTTCGGCCAGGTGCGG + Intergenic
1197201625 X:123753706-123753728 GTAATAATTCCGGCCAGGTGCGG + Intergenic
1197642463 X:128981991-128982013 TAAGAGTTTTCGGCCAGGTGTGG - Intergenic
1197804538 X:130386325-130386347 GCAGCATGTTGGGCCAGGTCTGG + Intergenic
1198374348 X:136023099-136023121 GGAGTATTATAGGCCAGGCGTGG - Intronic
1198729600 X:139714730-139714752 TCAGTGTTTTGGGCCAGGTGTGG - Intergenic
1200112320 X:153747390-153747412 GAAGTATTAGCGGCCAGGCGCGG + Intergenic
1200171856 X:154082540-154082562 AAAGCATTTTCGGCCGGGTGTGG - Intronic
1200947459 Y:8859992-8860014 ACAGACTTTTTGGCCAGGTGTGG + Intergenic
1202046625 Y:20742215-20742237 GGACCATTTTTGGCCAGGTGTGG + Intergenic