ID: 1007614945

View in Genome Browser
Species Human (GRCh38)
Location 6:43174305-43174327
Sequence TGCCCATATAAGGCCGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 32}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007614939_1007614945 0 Left 1007614939 6:43174282-43174304 CCTAGATAAGCGGGCGGCCTCCG 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1007614936_1007614945 3 Left 1007614936 6:43174279-43174301 CCCCCTAGATAAGCGGGCGGCCT 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1007614935_1007614945 4 Left 1007614935 6:43174278-43174300 CCCCCCTAGATAAGCGGGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1007614938_1007614945 1 Left 1007614938 6:43174281-43174303 CCCTAGATAAGCGGGCGGCCTCC 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1007614930_1007614945 19 Left 1007614930 6:43174263-43174285 CCTGATAGAAGACCGCCCCCCTA 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1007614929_1007614945 28 Left 1007614929 6:43174254-43174276 CCTCACTTTCCTGATAGAAGACC 0: 1
1: 0
2: 0
3: 8
4: 139
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1007614937_1007614945 2 Left 1007614937 6:43174280-43174302 CCCCTAGATAAGCGGGCGGCCTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1007614933_1007614945 7 Left 1007614933 6:43174275-43174297 CCGCCCCCCTAGATAAGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG 0: 1
1: 0
2: 1
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007614945 Original CRISPR TGCCCATATAAGGCCGGCTT GGG Intronic
903483423 1:23671163-23671185 TGCCCATCTCAGGCTGGCATGGG + Intergenic
905366559 1:37454790-37454812 TGTCCATAGAAGGCCTGCATAGG + Intergenic
911974478 1:104473990-104474012 TGCCCATATAAAAGGGGCTTGGG + Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
1067049086 10:43001663-43001685 TGGCCAGATGAGGCTGGCTTGGG - Intergenic
1070072184 10:73100619-73100641 TGCCCATATAAGCCAGACTATGG + Intergenic
1074121612 10:110497827-110497849 TGCCCATATAAGGCCAAATATGG - Exonic
1095310377 12:40691604-40691626 TTCACATAAAAGGCAGGCTTGGG + Intergenic
1099890575 12:88584552-88584574 TGCCCATATAAGCCAGGAATTGG + Intergenic
1100545041 12:95593621-95593643 TGGCCATCTAAGGCCAACTTGGG - Intergenic
1113321447 13:109236243-109236265 TGCCCATTGAAGGAAGGCTTTGG + Intergenic
1113683524 13:112261704-112261726 TGCCCATTTAGGGCAGGGTTTGG - Intergenic
1127249816 15:57221208-57221230 TGCCCATATAAGCAGAGCTTTGG + Intronic
1143104405 17:4521441-4521463 TGCCCAGAGCAGGCCGGCCTTGG - Intronic
1155240611 18:23860547-23860569 TGCCCAAAGAAGGCCGGGTGTGG - Intronic
1156273884 18:35562759-35562781 AACCCATATGAGGCCTGCTTAGG - Intergenic
1159560444 18:69987087-69987109 TGCCCATATAAAAGAGGCTTCGG - Intergenic
1166844302 19:45717457-45717479 TGCCCATATAAGGCAGGCCTTGG + Intronic
938565228 2:132513006-132513028 TGCCCATATGAAGTCAGCTTGGG + Intronic
948377225 2:237529343-237529365 TGCCTATATAAAGCCTGCTAAGG - Intronic
1173457491 20:43215311-43215333 TGCCCCCAGAAGGCTGGCTTTGG + Intergenic
1173776703 20:45714500-45714522 TGTCCATATAAGCCTGGCTGGGG - Intergenic
1175904419 20:62372473-62372495 TGGCCATATAAGGCCGTCTGTGG - Intergenic
1181119575 22:20656945-20656967 TCCCTATATAAAGCCGGCTGAGG - Intergenic
1181286157 22:21753955-21753977 TGCCCAGATATGGCCAGCCTGGG + Intergenic
960974064 3:123158491-123158513 TGCCCATAAAACACCTGCTTTGG - Intronic
969630328 4:8332219-8332241 TGCCCTTATAAGAGAGGCTTGGG + Intergenic
983809680 4:172045239-172045261 AGCTTATATAAGGCCAGCTTTGG + Intronic
1001192343 5:169642741-169642763 TGCCCATATAACTACGGATTAGG - Intronic
1007614945 6:43174305-43174327 TGCCCATATAAGGCCGGCTTGGG + Intronic
1012047177 6:94292069-94292091 TGCCCATATTACGCCAGCTTTGG - Intergenic
1022571006 7:31454277-31454299 GGCCCATATCAGGCTGGTTTAGG - Intergenic
1061147727 9:128809449-128809471 TGCCCTTCCAAGCCCGGCTTTGG + Exonic
1062537077 9:137025736-137025758 TGCCCATAGCAGGCCGGGTGTGG - Intronic
1200981019 Y:9263373-9263395 TTCCCATAACAGGCCGGCTCTGG - Intergenic
1202129408 Y:21596367-21596389 TTCCCATAACAGGCCGGCTCTGG + Intergenic