ID: 1007615123

View in Genome Browser
Species Human (GRCh38)
Location 6:43175203-43175225
Sequence TTCTATAAGCATGAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 143}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007615123_1007615134 9 Left 1007615123 6:43175203-43175225 CCAGCCCCCTCATGCTTATAGAA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1007615134 6:43175235-43175257 CGAGGTTCAGAAAAGGGGACTGG No data
1007615123_1007615131 3 Left 1007615123 6:43175203-43175225 CCAGCCCCCTCATGCTTATAGAA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1007615131 6:43175229-43175251 GAAAACCGAGGTTCAGAAAAGGG 0: 1
1: 0
2: 9
3: 86
4: 550
1007615123_1007615135 19 Left 1007615123 6:43175203-43175225 CCAGCCCCCTCATGCTTATAGAA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1007615135 6:43175245-43175267 AAAAGGGGACTGGTTATTTCAGG 0: 1
1: 0
2: 0
3: 11
4: 169
1007615123_1007615136 20 Left 1007615123 6:43175203-43175225 CCAGCCCCCTCATGCTTATAGAA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1007615136 6:43175246-43175268 AAAGGGGACTGGTTATTTCAGGG No data
1007615123_1007615129 -9 Left 1007615123 6:43175203-43175225 CCAGCCCCCTCATGCTTATAGAA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1007615129 6:43175217-43175239 CTTATAGAAGAGGAAAACCGAGG No data
1007615123_1007615132 4 Left 1007615123 6:43175203-43175225 CCAGCCCCCTCATGCTTATAGAA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1007615132 6:43175230-43175252 AAAACCGAGGTTCAGAAAAGGGG 0: 1
1: 0
2: 8
3: 52
4: 361
1007615123_1007615130 2 Left 1007615123 6:43175203-43175225 CCAGCCCCCTCATGCTTATAGAA 0: 1
1: 0
2: 1
3: 17
4: 143
Right 1007615130 6:43175228-43175250 GGAAAACCGAGGTTCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007615123 Original CRISPR TTCTATAAGCATGAGGGGGC TGG (reversed) Intronic
900828472 1:4945933-4945955 TTCTTTATGCATGATGGGGCTGG + Intergenic
900982841 1:6056427-6056449 CTGTGTAAGCATGAGGGAGCAGG + Intronic
903415073 1:23177059-23177081 TTCTGTAAGGATGATGGGGGGGG + Intronic
904097043 1:27987412-27987434 TGCTATAAACATGAGTGTGCAGG + Intronic
904429181 1:30451060-30451082 TTCTACAAGCATGGATGGGCCGG - Intergenic
910721398 1:90290267-90290289 TGCTATAAACATGAGGGTGCAGG - Intergenic
924594676 1:245434899-245434921 TTGTACAAGGATGAGGGTGCTGG - Intronic
1062967449 10:1618923-1618945 TTCTACAAGCTGCAGGGGGCAGG - Intronic
1063747973 10:8907796-8907818 TTCTCCAAGCATGACGAGGCTGG + Intergenic
1065518328 10:26546846-26546868 TGCAATAAACATGAGAGGGCAGG + Intronic
1067231310 10:44412898-44412920 TTCTCTAAGCAGGATGGGGAGGG + Intergenic
1068641025 10:59408183-59408205 TGCAATAAACATGAGAGGGCAGG + Intergenic
1070468786 10:76755887-76755909 TCCTATAAGCATCTGTGGGCTGG - Intergenic
1076371189 10:129955430-129955452 TTCTAGAAGCATGAGAGGAGGGG - Intronic
1077418659 11:2437818-2437840 CTTTATGAGCATGCGGGGGCAGG + Intergenic
1078348364 11:10571793-10571815 TGCAATAAACATGAGGGTGCAGG + Intronic
1078771950 11:14359210-14359232 CTGCATATGCATGAGGGGGCGGG + Intronic
1079210746 11:18458443-18458465 TTCTAGAAGCAGGAGGTGACTGG - Intronic
1080434216 11:32224818-32224840 ATCTACAAGTAGGAGGGGGCAGG - Intergenic
1080932680 11:36829183-36829205 TTCACTCAGCATGATGGGGCTGG - Intergenic
1080983803 11:37437549-37437571 TTTTGTACGTATGAGGGGGCTGG + Intergenic
1081852308 11:46282182-46282204 TTCTCTAAGAATGTGGGGTCTGG - Intronic
1083420605 11:62550741-62550763 TGCTCTAGGCATGAGGGGCCAGG - Intronic
1086817455 11:91391026-91391048 TTCTATAAACATGTGTGTGCAGG - Intergenic
1086909401 11:92454996-92455018 TTCTATAAGCATATGGGCTCTGG - Intronic
1087812407 11:102622708-102622730 TTCCATGAGGATGAGGGAGCTGG - Intronic
1089017784 11:115181151-115181173 TTCTGGAAGCCTGAGGGGGGAGG + Intronic
1090770647 11:129916749-129916771 TTCTATAAGGTGGAGGGGGTTGG - Intronic
1091367103 11:135031485-135031507 TTCTCTAAGCAGGAATGGGCAGG + Intergenic
1096712012 12:53464532-53464554 TTCAATAAGAATGAAGGGGTGGG - Intronic
1097977775 12:65706920-65706942 TTCTATCTTCATGATGGGGCTGG + Intergenic
1098118430 12:67206555-67206577 TGCAATAAGCATGGGGGTGCAGG - Intergenic
1101410779 12:104466211-104466233 TTATAGAGGCATAAGGGGGCTGG + Intronic
1109006178 13:56881105-56881127 TTCTATAAGCATTAATGTGCAGG - Intergenic
1110754766 13:79159648-79159670 TGCAATAAACATGAGGGTGCAGG + Intergenic
1111855726 13:93634671-93634693 TTCTAGAAGCATGAAGGAGAGGG + Intronic
1114270254 14:21096649-21096671 TTCTATAAGGATGCGGGGCCAGG + Intronic
1114360291 14:21964676-21964698 TACAATAAACATGAGGAGGCAGG + Intergenic
1116046779 14:39753095-39753117 TTCCATAATAATGAGGGGGAGGG - Intergenic
1116456259 14:45123912-45123934 TTTTAAAAGAATGAGGGGGCTGG - Intronic
1118092796 14:62500741-62500763 TTCTAAAAGAATGTGGAGGCAGG - Intergenic
1121586652 14:95067574-95067596 TTCCAGCAGCATGAGGGGGAGGG + Intergenic
1121606849 14:95246855-95246877 CTCTATAAGAATTTGGGGGCAGG - Intronic
1122177332 14:99930615-99930637 TTTAATAAGCCTGAGGGAGCTGG - Intronic
1122967311 14:105137417-105137439 TTCTAGAAGCACGGAGGGGCTGG - Intergenic
1122975401 14:105168810-105168832 CTGCATATGCATGAGGGGGCGGG + Exonic
1126610046 15:50519970-50519992 TGCAATAAACATGAGGGTGCAGG - Intronic
1126659501 15:51018464-51018486 TGCAATAAACATGAGGGTGCAGG + Intergenic
1132593804 16:738994-739016 TTCTTTAAGAATGAGGGGTCTGG + Intronic
1135542910 16:23346057-23346079 TCCCATATGCATGAGAGGGCAGG - Intronic
1137772988 16:51032555-51032577 TTCTAAAAGCCAGATGGGGCTGG + Intergenic
1138637600 16:58353737-58353759 TGCAATAAACATGAGGGTGCAGG + Intronic
1141174958 16:81712788-81712810 TTCTGTCAGCATGTGGAGGCAGG - Intergenic
1144389001 17:14776426-14776448 GACTATAGGGATGAGGGGGCTGG - Intergenic
1146523294 17:33543736-33543758 TGCTCTAAGCATGAGGAGCCTGG + Intronic
1147391839 17:40114084-40114106 TTCTATAAGCCTTAGAGGGGTGG + Intergenic
1149457459 17:56799526-56799548 TGCTATAAACATCTGGGGGCAGG + Intronic
1152156441 17:78636767-78636789 CTCAAAAAGAATGAGGGGGCTGG + Intergenic
1152268590 17:79310528-79310550 TCCTAGAAGCAGGACGGGGCTGG - Intronic
1153416270 18:4849430-4849452 GTCCATAAGCATGGTGGGGCGGG - Intergenic
1155150207 18:23117017-23117039 ATCTTTAAGCATGAGAGGGGAGG - Intergenic
1156780331 18:40843245-40843267 ATCTAAAAGCTTGATGGGGCTGG - Intergenic
1160893838 19:1393676-1393698 TTCTGTAAGGCTGAGGGCGCGGG - Intronic
1162523334 19:11194408-11194430 TTCTGGAGGCCTGAGGGGGCTGG - Intronic
1165120137 19:33553609-33553631 ACCTATAAGCATGTGGGGGCAGG - Intergenic
1165510742 19:36265465-36265487 CTCTTTAAGCATGATTGGGCAGG + Intergenic
1167565494 19:50253753-50253775 TCCTCTAAGGATGGGGGGGCAGG - Intronic
925105445 2:1286977-1286999 CTCTTTCAGAATGAGGGGGCTGG + Intronic
926383448 2:12313873-12313895 TTCTATAGGCAGGAGGCTGCTGG - Intergenic
927178057 2:20424246-20424268 TTATGCCAGCATGAGGGGGCAGG + Intergenic
927190929 2:20516449-20516471 TTGTCTAAGGAAGAGGGGGCTGG - Intergenic
929228401 2:39534190-39534212 TTCTAAAAGTTTGAGGGGGAAGG - Intergenic
929431262 2:41888978-41889000 TTATAAAAGCATCAGGAGGCCGG + Intergenic
933296844 2:80500684-80500706 TTCTGTCAGCAAGAGGGGGAGGG - Intronic
934487206 2:94726271-94726293 TGCTATAAACATGAGGGTGCAGG + Intergenic
934911325 2:98257410-98257432 TGCAATAAACATGAGGGTGCAGG + Intronic
936003432 2:108858972-108858994 TGCAATAAGCATGAGAGTGCAGG + Intronic
936603233 2:113920919-113920941 TGCAATAAACATGAGGGTGCAGG + Intronic
937522323 2:122726681-122726703 ATCTCTAAGGATGAAGGGGCTGG - Intergenic
937873310 2:126802098-126802120 TTCTATAAGAAAGAGGGGAAGGG - Intergenic
938693886 2:133817384-133817406 TACAATAAACATGAGGGTGCAGG - Intergenic
938821605 2:134966178-134966200 TGCAATAAGCATGAGGATGCAGG + Intronic
940272708 2:151909128-151909150 TTCTTTAAAAAAGAGGGGGCTGG + Intronic
942417237 2:175772167-175772189 TTATCACAGCATGAGGGGGCAGG + Intergenic
945977785 2:216283990-216284012 TTCTACGAACATGAGCGGGCTGG + Intronic
1169598052 20:7223286-7223308 TGCAATAAACATGAGGGTGCAGG + Intergenic
1169819991 20:9699865-9699887 TGCCATAGGCATGAGGGGACCGG - Intronic
1172536239 20:35675580-35675602 GTATAAAAGAATGAGGGGGCCGG + Intronic
1173758124 20:45535963-45535985 TTCACTTAGCAAGAGGGGGCTGG - Intronic
1174792225 20:53489858-53489880 TTCTAGAAGCCTCAGAGGGCTGG - Exonic
1176838005 21:13812161-13812183 TGCTATAAACATGAGGGTGCTGG + Intergenic
1180205048 21:46254591-46254613 TCCTATGAGCAGGAAGGGGCAGG + Intronic
1180205213 21:46255592-46255614 TCCTATGAGCAGGAAGGGGCAGG + Intronic
1185183411 22:49377661-49377683 TTCAAGACACATGAGGGGGCGGG + Intergenic
949552904 3:5126148-5126170 TTCTATAAGAATCAGGGGTTAGG - Intronic
950311079 3:11958446-11958468 TTATATAAGCACCAGAGGGCTGG + Intergenic
959571610 3:107890752-107890774 TTCTGTAAGAATGTGGGGGAGGG + Intergenic
965921048 3:173914218-173914240 TTCTTTAAGGATGTGGGGGAGGG - Intronic
967464608 3:189789605-189789627 AACTATAGGCATGAGGAGGCGGG - Intronic
967800309 3:193651162-193651184 TTCCATAAGCAGTAGGGGGAGGG + Intronic
968483942 4:849802-849824 TCTTATAAGCATGCGGGGGCGGG + Intronic
968823761 4:2877669-2877691 TTCAAGAATCAAGAGGGGGCCGG + Intronic
969059926 4:4426349-4426371 TTCTGTAAGCAGGAGTGGGAGGG + Intronic
977882255 4:102218513-102218535 TTTTATAATCATGAGTGGGAAGG - Intergenic
981142578 4:141286637-141286659 TGCAATAAACATGAGGGTGCAGG + Intergenic
983738222 4:171090733-171090755 TAGGATAAGCAGGAGGGGGCTGG - Intergenic
985335697 4:188891351-188891373 TTCAATAAACATGAGGCTGCAGG + Intergenic
988178708 5:27761970-27761992 TTCTATATACATTATGGGGCTGG + Intergenic
992179211 5:74180471-74180493 TTCTCCAGGCATGAGGGGGCGGG - Intergenic
996254568 5:121383467-121383489 TCCTATAAGCATGAATGGGGTGG - Intergenic
996890673 5:128415655-128415677 TGCTATAAACATGAGGGTGCAGG + Intronic
999376841 5:151092617-151092639 TTCTATAAGCAATGGGGGGGGGG + Intronic
999398139 5:151243879-151243901 TTCTCTCAGCAGGAGGTGGCAGG + Intronic
1004561387 6:16754904-16754926 TTCTTTAAGGATGAGGAAGCAGG + Intronic
1006798840 6:36746773-36746795 TCCTATAAGCAAGAGGGTGGTGG - Intronic
1007615123 6:43175203-43175225 TTCTATAAGCATGAGGGGGCTGG - Intronic
1007904536 6:45445809-45445831 TTCAAGAAGGATGAGGGGGGCGG + Intronic
1010621096 6:78076184-78076206 TTATATAAGCATCTGGGGGAGGG + Intergenic
1010928192 6:81768966-81768988 TTCTGTAAGCATGGGAGGGCAGG - Intergenic
1012338678 6:98091440-98091462 TTATATGAACATGAGGGCGCTGG - Intergenic
1018154400 6:160972488-160972510 TAAGATAAGCATGAGGGGCCAGG + Intergenic
1019215824 6:170443282-170443304 GTCTGTAATCAGGAGGGGGCTGG - Intergenic
1021367406 7:19796855-19796877 TGCAATAAGCATGAGGGTGCAGG + Intergenic
1021819631 7:24483678-24483700 TTCTAGAAGCATGAGATGGGAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024421680 7:49174717-49174739 TCCTATACACATGAGTGGGCTGG + Intergenic
1026041150 7:66869205-66869227 TTCCATAAGAATGGAGGGGCCGG - Intergenic
1030763098 7:113375543-113375565 TTTAATAAGCATGAGATGGCAGG - Intergenic
1033364010 7:140657707-140657729 TTCTATAAGTAGGAGGGTGGAGG + Intronic
1033679360 7:143578902-143578924 TTCTTTAAGAATGTGAGGGCAGG + Intergenic
1033692477 7:143750542-143750564 TTCTTTAAGAATGTGAGGGCAGG - Intergenic
1034742162 7:153485752-153485774 TGCAATAAACATGAGGGTGCAGG - Intergenic
1035430351 7:158815472-158815494 ATATCTAAGCATGAGGGGGAAGG - Intronic
1037016512 8:13914467-13914489 TTCCATAATCAGGAGGGAGCCGG + Intergenic
1037051641 8:14381422-14381444 TTATATGGGAATGAGGGGGCAGG - Intronic
1037096655 8:14994285-14994307 TTTAAGATGCATGAGGGGGCTGG + Intronic
1037149179 8:15615151-15615173 TTCAATAAACATGAGAGGACAGG - Intronic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1040377339 8:46839150-46839172 ATTTTTTAGCATGAGGGGGCAGG + Intergenic
1041854008 8:62428292-62428314 TTCAATAAACATGAGAGTGCAGG + Intronic
1042063740 8:64850145-64850167 TTCTATAAGCAAGAAGATGCAGG + Intergenic
1045336174 8:101205814-101205836 TTACATAAGCGCGAGGGGGCGGG + Intronic
1047034176 8:120916380-120916402 TCCAATCAGCAGGAGGGGGCAGG - Intergenic
1047716835 8:127603351-127603373 TTCTACAAGCAGGAGAGGCCTGG + Intergenic
1048905982 8:139089511-139089533 TGCCATAAACATGAGGGTGCAGG + Intergenic
1053670596 9:40358080-40358102 TGCTATAAACATGAGGGTGCAGG - Intergenic
1053920384 9:42984424-42984446 TGCTATAAACATGAGGGTGCAGG - Intergenic
1054381718 9:64498143-64498165 TGCTATAAACATGAGGGTGCAGG - Intergenic
1054514017 9:66018220-66018242 TGCTATAAACATGAGGGTGCAGG + Intergenic
1057777157 9:98020538-98020560 GTCGATAAGCATGACAGGGCAGG + Intergenic
1058038272 9:100276799-100276821 GTATTTAAGAATGAGGGGGCTGG - Intronic
1062714990 9:138005157-138005179 TGCCATGAGCATGAGGAGGCAGG - Intronic
1185957394 X:4506280-4506302 ATGTAAAAGGATGAGGGGGCTGG + Intergenic
1187456209 X:19443425-19443447 TACTATAAGCCTGAGGGGGCAGG - Intronic
1187533837 X:20119692-20119714 TACTATAAGCATGAGGGCAATGG - Intergenic
1188722250 X:33537142-33537164 TTCTATAAACATGTGTGTGCAGG + Intergenic
1191647700 X:63500597-63500619 TACAATAAGCATGAGAGTGCAGG - Intergenic
1192493481 X:71597020-71597042 TTGTATTGGCATGAGAGGGCTGG + Intronic
1193970499 X:88045451-88045473 TGCAATAAACATGAGGGTGCAGG - Intergenic
1194689024 X:96959043-96959065 TGCAATAAACATGAGGGTGCAGG + Intronic
1198427867 X:136537889-136537911 TACTATAGGCCTGATGGGGCAGG + Intronic
1198496193 X:137196040-137196062 TTATAAAAGGGTGAGGGGGCTGG + Intergenic