ID: 1007618356

View in Genome Browser
Species Human (GRCh38)
Location 6:43196035-43196057
Sequence ATGTGAAAGCAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 903
Summary {0: 1, 1: 0, 2: 7, 3: 74, 4: 821}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007618356_1007618365 22 Left 1007618356 6:43196035-43196057 CCCTCCTCACTCTGCTTTCACAT 0: 1
1: 0
2: 7
3: 74
4: 821
Right 1007618365 6:43196080-43196102 GCTGGCCGTCGCCAGCTCCTCGG 0: 1
1: 0
2: 1
3: 9
4: 178
1007618356_1007618364 4 Left 1007618356 6:43196035-43196057 CCCTCCTCACTCTGCTTTCACAT 0: 1
1: 0
2: 7
3: 74
4: 821
Right 1007618364 6:43196062-43196084 CTCACAGGCACTGAAGATGCTGG 0: 1
1: 0
2: 2
3: 25
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007618356 Original CRISPR ATGTGAAAGCAGAGTGAGGA GGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900722368 1:4185662-4185684 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
900847659 1:5116411-5116433 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
901056390 1:6450402-6450424 AAGTGACAGCGGAGTTAGGAGGG - Intronic
902477959 1:16698083-16698105 AAGTGACAGCGGAGTTAGGAGGG + Intergenic
903252542 1:22066620-22066642 ATATGAAAGGAGTGTAAGGAGGG + Intronic
903806984 1:26012640-26012662 ATCTGAAAGCAGAGATAAGAGGG + Intergenic
904265019 1:29313168-29313190 GGGAGAAAGCAGAGAGAGGAGGG - Intronic
904315621 1:29658689-29658711 AATTGAAAGCAGAGTTCGGAAGG - Intergenic
904996309 1:34634377-34634399 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905313580 1:37066894-37066916 ATGTCAAAACAAAGGGAGGAAGG - Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905499957 1:38428359-38428381 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
905507668 1:38493065-38493087 AAATAAAAGCAGAGTAAGGAAGG + Intergenic
906378877 1:45318839-45318861 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
906744343 1:48211402-48211424 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907503399 1:54900288-54900310 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
907548137 1:55280284-55280306 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
909035645 1:70591586-70591608 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
909222492 1:72982261-72982283 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
909704718 1:78568139-78568161 ATGTGAACACAGGGTGACGACGG + Intergenic
910292310 1:85611498-85611520 AAGTTACATCAGAGTGAGGAGGG + Intergenic
911296628 1:96125347-96125369 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
911931183 1:103905861-103905883 ATGCCAAAGCATATTGAGGAGGG + Intergenic
912369633 1:109164131-109164153 ATGTGAAATGAGAGTGATGATGG - Intronic
912813744 1:112812721-112812743 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
913996568 1:143655631-143655653 ATATGAAAGAAGAGAGTGGAGGG - Intergenic
914505685 1:148287180-148287202 ATATGAAAGAAGAGAGTGGAGGG + Intergenic
914672854 1:149885143-149885165 ATGTGAAGGCACAGTGAAAATGG - Exonic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916150803 1:161787488-161787510 GAGTCACAGCAGAGTGAGGAGGG - Intronic
916169691 1:161992528-161992550 ATGTCAGAGCTGAGCGAGGATGG - Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
917903220 1:179564446-179564468 AAGTGAAAGCAGAGTGACATGGG + Intronic
918347295 1:183616938-183616960 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
918362694 1:183775011-183775033 ATGAGAAAACAAAGTCAGGAGGG - Intronic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
919459014 1:197854691-197854713 ATGTGAAAGGAAAGGGAGAAAGG + Intergenic
919476578 1:198038066-198038088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
919845389 1:201639208-201639230 AGGTGAAGCCAGAGTGGGGAAGG + Intronic
920318228 1:205095618-205095640 ATGTGAGAGCAGAAAGAGAATGG + Intronic
920425579 1:205872512-205872534 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
920568466 1:206996289-206996311 ATGTGAAGACAAAGTGAGAAGGG + Intergenic
920868161 1:209770219-209770241 ATATTAAAGCAGAGTGAGGGCGG - Intronic
920903146 1:210132363-210132385 ATGTCCAAGCAGGGTGAGGAGGG - Intronic
921214004 1:212922061-212922083 ATGTGAAAGTAGGGAGAGGTGGG - Intergenic
921419753 1:214932714-214932736 ATGTGAAAGCACATTGAGGAAGG + Intergenic
921459598 1:215412365-215412387 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
921509435 1:216011287-216011309 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
921537981 1:216375754-216375776 ATGAGTAAGCTTAGTGAGGAAGG - Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921938238 1:220814429-220814451 CTGTGAAAGCTGACTGAGGCTGG + Exonic
921950099 1:220920656-220920678 ATGAGGAAGCAGGGAGAGGAAGG + Intergenic
922048584 1:221969231-221969253 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
922049359 1:221975525-221975547 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922153884 1:223026829-223026851 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
922363362 1:224842879-224842901 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923146529 1:231202439-231202461 AGGTGAGAGCAGAATGAGCAAGG + Intronic
923244928 1:232121469-232121491 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
923257163 1:232232055-232232077 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923408448 1:233685855-233685877 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923770565 1:236934686-236934708 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
923962957 1:239104652-239104674 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1062986620 10:1775072-1775094 ATTTGAGAGCAGAGAGAGGTGGG + Intergenic
1063120595 10:3103076-3103098 ATGAGAAATCAGTGTGAAGATGG + Intronic
1063243601 10:4195484-4195506 AGTTGAAAGCAGAGTGAGGCTGG + Intergenic
1063349028 10:5337609-5337631 CTGTGAAAGCCGTGTGAGGGGGG + Intergenic
1063363333 10:5474397-5474419 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1063814241 10:9755017-9755039 ATGTTCAGGCAGAGTGTGGAGGG + Intergenic
1063865457 10:10360447-10360469 ATGTGAAAAAAGAGGAAGGAAGG + Intergenic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065316598 10:24470219-24470241 TTGTGAAGGCAGAGTGAGAGAGG + Intronic
1065385117 10:25126383-25126405 TTGTAAAAGCAGATTGAGGCTGG - Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067761900 10:49054706-49054728 TTTTGAAAGCAGAGTGTGGCTGG - Intronic
1068360948 10:55974485-55974507 AAGTGAAAGCACAGAGAGGCTGG - Intergenic
1068727939 10:60324140-60324162 ATATGAAAGCAGAAAGAGAAGGG + Intronic
1069267146 10:66474040-66474062 ATGTTATAGCAGTGTGAGAATGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1071805840 10:89119893-89119915 GAGTGAAAGGAGAGTGAGGAGGG - Intergenic
1071897564 10:90083462-90083484 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1071916374 10:90298282-90298304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1072086835 10:92087963-92087985 ATGTGAGGGCAGGGTGAGGTGGG + Intronic
1072246176 10:93546093-93546115 ATGTGAAAGCACATTGCAGATGG + Intergenic
1072268572 10:93753853-93753875 TGTTGAAAGCAGAGTGAGAAAGG - Intergenic
1072501513 10:96022900-96022922 ATGAGAAACATGAGTGAGGAAGG + Intronic
1073394854 10:103209179-103209201 ATGTGAAAGCGAAGAGAGGCTGG - Intergenic
1074365054 10:112851039-112851061 ATGTGAAAGCAGAGTTCGGAAGG - Intergenic
1074495614 10:113977837-113977859 ATGGGAAAGAGGAGTGAGGTGGG - Intergenic
1074552173 10:114454469-114454491 ATGAGAAAGGAGGGTGTGGAAGG + Intronic
1074740958 10:116483937-116483959 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075014009 10:118896840-118896862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075211386 10:120494090-120494112 TTGTGAAAGCAGAGTAGGGAGGG + Intronic
1075248877 10:120848129-120848151 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1075413684 10:122247417-122247439 TGGTGACAGCAGAGTGGGGAAGG - Intronic
1075542451 10:123326399-123326421 ATATGAAAGCAGAGGCAGGAAGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076742554 10:132494005-132494027 ACGAGGAAGCAGAGTGGGGAGGG - Intergenic
1077067829 11:651638-651660 CTTTGAAAGGAGACTGAGGAGGG + Intronic
1077096794 11:802388-802410 ACAGGAAAGCTGAGTGAGGAAGG + Exonic
1077612368 11:3651226-3651248 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1077698613 11:4418697-4418719 ATATGAAAGCATGATGAGGAAGG - Intergenic
1077809964 11:5627065-5627087 AGATGAGAGCAGAGTGAAGAAGG + Intronic
1077850624 11:6072258-6072280 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078334011 11:10450191-10450213 AGGTGAAGGCAGAGCGAGGAGGG + Intronic
1078398617 11:11003314-11003336 ATATGAAAGCAGAGATTGGATGG + Intergenic
1078558748 11:12352783-12352805 CTGTAAAAGGAGAGTGGGGAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1080430593 11:32195345-32195367 AGGAGAGAGCAAAGTGAGGAAGG + Intergenic
1080994310 11:37581133-37581155 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1081085993 11:38802092-38802114 ATGTTGAAGCAGAGTGAGTTTGG + Intergenic
1081356987 11:42123866-42123888 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082813917 11:57495883-57495905 ATGAGAAAGCAGAGCTTGGAGGG + Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083534583 11:63456195-63456217 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1083657308 11:64235689-64235711 TTGTGAGGGCAGAGTGGGGAGGG + Intronic
1084059364 11:66660071-66660093 ATCTGAAAGGAGAGTCAGTATGG - Intronic
1084354377 11:68627427-68627449 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1084361267 11:68669905-68669927 ATCTGAAACCAGGGTGGGGAGGG + Intergenic
1084613107 11:70216739-70216761 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085539878 11:77257150-77257172 ATGTGACAGCAGAGATAGCAAGG - Intronic
1086550390 11:88046472-88046494 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1086855112 11:91856470-91856492 ATGAGAAAGCAGACAAAGGAGGG + Intergenic
1086931670 11:92700258-92700280 GTGTAAAGGCAGAGTGGGGATGG + Intronic
1087127988 11:94644893-94644915 AAGTGAAAGCGAAGAGAGGATGG - Intergenic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1087689924 11:101308819-101308841 AGGAGAAAGAACAGTGAGGAAGG + Intergenic
1087839366 11:102906506-102906528 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1088435905 11:109812852-109812874 AGGGGAAAAAAGAGTGAGGAGGG - Intergenic
1088469050 11:110174966-110174988 ACATGAAAGCAGAGTGATGAAGG - Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088971798 11:114780443-114780465 ATGTGGTAGAAGAGTTAGGAAGG + Intergenic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089415271 11:118283916-118283938 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
1089953485 11:122550236-122550258 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090107426 11:123868015-123868037 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1090217060 11:124977987-124978009 GGGTGAAAGGAGGGTGAGGATGG - Intronic
1090338446 11:125992511-125992533 ATGGGAAAGCAGAGCCTGGAAGG - Intronic
1090871786 11:130755939-130755961 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1090908205 11:131095842-131095864 ACGAGGAAGGAGAGTGAGGAGGG - Intergenic
1091099527 11:132858012-132858034 ATGTGAACACAGAGAGAGGGAGG + Intronic
1091661005 12:2383559-2383581 ATGAGACAGCAGAGTAAGTAGGG + Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092395428 12:8121789-8121811 GAGTGCAAGCAGGGTGAGGAGGG + Intergenic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092924677 12:13262390-13262412 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1093024519 12:14233861-14233883 ATGTGAAAGCAAAAAGAGGTTGG - Intergenic
1093358604 12:18198244-18198266 AGGTGAAAGCAAAGAGAGGCTGG - Intronic
1093558455 12:20507888-20507910 TTGTGAATACACAGTGAGGAAGG - Intronic
1094659296 12:32451005-32451027 AAGTGCAAGCCAAGTGAGGAGGG - Intronic
1094773821 12:33697750-33697772 ATCTGAAAGCAGACTTAGGCAGG - Intergenic
1095542307 12:43324721-43324743 ATGTGAACTCACAGTGAGAATGG - Intergenic
1095637823 12:44453083-44453105 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1095778362 12:46033430-46033452 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1096738582 12:53675686-53675708 AAGAGAAAGCAGAGATAGGAGGG + Intronic
1096966792 12:55634754-55634776 TTGAGAGAGCAGAGTGAGGGTGG + Intergenic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1098629235 12:72706640-72706662 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098967881 12:76812288-76812310 CAGTTAAAGCAGAGTGATGATGG - Intronic
1099114820 12:78610815-78610837 ATGTGAAAGATGAGTGTTGAGGG + Intergenic
1099156332 12:79180991-79181013 AGGAGAATGCAGAGTGAAGAGGG - Intronic
1099188896 12:79543151-79543173 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1099465982 12:82988563-82988585 AGTTGAAGGCAGAATGAGGAGGG + Intronic
1099872969 12:88370965-88370987 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1100289682 12:93201933-93201955 ATGTGAAAGCAGTCTTAAGAAGG - Intergenic
1100361167 12:93880860-93880882 TACTGAAACCAGAGTGAGGAAGG - Intronic
1100561535 12:95752450-95752472 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1100799505 12:98216467-98216489 GGGTGAAAGCAGAATGAGTAAGG - Intergenic
1101278221 12:103225099-103225121 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1101814084 12:108131736-108131758 ATGAGAAAGCAGAGAGAGGGCGG - Exonic
1101873731 12:108585085-108585107 ATGAGAAGGAAGAGTAAGGAAGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102698496 12:114818263-114818285 ACATGACAGCAGAGTCAGGAGGG - Intergenic
1102754701 12:115328044-115328066 ATGTGGAAGAAAATTGAGGAAGG - Intergenic
1103615365 12:122148405-122148427 AGGAGAAAGCAGAGTTTGGATGG + Intergenic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1105600818 13:21885483-21885505 ATGTGAACGAATAATGAGGATGG - Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1106074181 13:26443259-26443281 ATGTGAAAGGAGTGTCTGGAGGG + Intergenic
1106245721 13:27948307-27948329 ATGAGAAAGCAATGTGAAGAAGG - Intergenic
1106508542 13:30392921-30392943 ATGTGCAAGGAAAGGGAGGAGGG - Intergenic
1106943621 13:34801924-34801946 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1108292062 13:48971902-48971924 ATGGGACAGCAGATTGAGGTGGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108513171 13:51173154-51173176 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1108646846 13:52438882-52438904 ATGTGAAAGCAAAGTGTCTACGG + Intronic
1108793280 13:53999049-53999071 ATATAAAAGCAGAGTTGGGAGGG - Intergenic
1108919373 13:55657396-55657418 AAGTGAAAGCAAAGAGAGGATGG + Intergenic
1108949609 13:56074534-56074556 AAGTGAAAGCAGAGGTAGAAGGG - Intergenic
1109170208 13:59086043-59086065 ATAAGAAACCAGAGTAAGGATGG + Intergenic
1109343752 13:61091646-61091668 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109353089 13:61208090-61208112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109499472 13:63216401-63216423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1109716564 13:66228806-66228828 AAGTGAAAGCAGAGAGAGGCTGG + Intergenic
1110040142 13:70744633-70744655 ATGAGAAAACAATGTGAGGATGG - Intergenic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110978659 13:81869467-81869489 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1111125863 13:83910705-83910727 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111447079 13:88360848-88360870 ACAGGAGAGCAGAGTGAGGAGGG - Intergenic
1111529527 13:89518630-89518652 ATGTTAAACCAGAGTTAGGTTGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1111741147 13:92207179-92207201 ATGGGAAAGGAAAGAGAGGAGGG - Intronic
1112237002 13:97645602-97645624 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1113059368 13:106305368-106305390 ATATGAAACCAGACTGAGCAAGG + Intergenic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1113140280 13:107140169-107140191 CTGTGAAAGCAGACTGTGGTAGG - Intergenic
1113560684 13:111278178-111278200 ATGTGACAGCAGATTTGGGAAGG + Intronic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1114564962 14:23623909-23623931 AACTGAAAGCAGAATAAGGAGGG + Intergenic
1115240433 14:31247823-31247845 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1115273905 14:31584980-31585002 ATGTGAAAGCACTGGGAGGTGGG - Intronic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1116179852 14:41519234-41519256 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1116490404 14:45497806-45497828 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1116534603 14:46014847-46014869 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1116702228 14:48257807-48257829 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1117200694 14:53386948-53386970 AAGTGAAAGAAGACTGAAGAAGG - Intergenic
1118818696 14:69330684-69330706 GGGTGAAAGCAGAGTGGGGAAGG + Intronic
1118937079 14:70298223-70298245 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1119022593 14:71127598-71127620 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119317375 14:73706773-73706795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1119600378 14:75971972-75971994 ATGTCAAGGCAGTGGGAGGAGGG - Intronic
1120539387 14:85735395-85735417 AAGTGAAAGCGAAGAGAGGATGG + Intergenic
1120618415 14:86734607-86734629 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1120659783 14:87237462-87237484 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1121351566 14:93177477-93177499 CTCTAAAAGCAGAGTGAGGCTGG + Intergenic
1121737555 14:96228937-96228959 ATGGGAAAGCAGAGTCAGCGAGG - Intronic
1121941430 14:98074574-98074596 GTGAGAAAGGAGGGTGAGGAAGG - Intergenic
1122092513 14:99349722-99349744 TTCTGATGGCAGAGTGAGGAAGG - Intergenic
1122147277 14:99699115-99699137 CTCTGAAACCAGAGTGAGAAGGG - Intronic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123882318 15:24688004-24688026 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1125213040 15:37238637-37238659 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1125697662 15:41652314-41652336 AGGTGAAAGAAGAGAGGGGAGGG - Intronic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126529978 15:49701562-49701584 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1126843923 15:52741868-52741890 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1130123739 15:81074607-81074629 ATGTGAAAGCAAAGTGAGCATGG + Intronic
1130846221 15:87748711-87748733 AGATGAGAGCAGAGTGAAGACGG + Intergenic
1131105642 15:89732368-89732390 AAGTGATAGCCAAGTGAGGAAGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131360121 15:91783394-91783416 ATATGAGAGGAGAGTGAGGCTGG + Intergenic
1131684353 15:94754060-94754082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1131779258 15:95838657-95838679 ATGTGAAAACAGATTCAGGCAGG - Intergenic
1131882336 15:96874245-96874267 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133392825 16:5423007-5423029 AGGAGAAAGGAGAGGGAGGAAGG + Intergenic
1133766580 16:8842514-8842536 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
1133938349 16:10286445-10286467 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135137339 16:19894953-19894975 ATGTGAAAACAGAGAGAGAGAGG - Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136346502 16:29679389-29679411 AGGAGAAAGAAGAGTGAGAAGGG - Intronic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1137489312 16:48918418-48918440 CTGTGAAAACAGAGTTGGGAGGG - Intergenic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1137915857 16:52429204-52429226 ATGTGAATGCTTAGTGAGCAAGG - Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139957696 16:70700945-70700967 ATGTGAGGGCAGGCTGAGGAGGG + Intronic
1140467795 16:75196284-75196306 CTGTGCAAGCAGAGTCATGATGG - Intergenic
1140767164 16:78170819-78170841 TTGAGAAAGCAGAGAGATGAGGG + Intronic
1140872889 16:79123016-79123038 ATGTGAACGCAAGGTGAGGATGG + Intronic
1141414405 16:83859013-83859035 AGGGGAAAGCAGAGTGAGTCAGG + Intergenic
1141796715 16:86279825-86279847 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1142288953 16:89183987-89184009 ATGTGAGTACAGGGTGAGGATGG - Intronic
1142291811 16:89196524-89196546 ATGTGACTCCAGAGTGAGCAGGG + Intronic
1143035125 17:3990697-3990719 ATGAGAAAGCTGAGTGTGGGCGG - Intergenic
1143208957 17:5169016-5169038 ATGTTAGCGCTGAGTGAGGATGG - Exonic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1143755092 17:9061242-9061264 AGTTGAAAATAGAGTGAGGAAGG + Intronic
1143755095 17:9061269-9061291 AGTTGAAAATAGAGTGAGGAAGG + Intronic
1144618448 17:16798491-16798513 ATGTTAGCGCTGAGTGAGGATGG - Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144894258 17:18517202-18517224 ATGTTAGCGCTGAGTGAGGATGG + Intergenic
1145137973 17:20427040-20427062 ATGTTAGCGCTGAGTGAGGATGG - Intergenic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1147268987 17:39253631-39253653 ATTTGGAAGTAGGGTGAGGAGGG + Intergenic
1147356033 17:39897485-39897507 TTCAGAAAGCAGAGGGAGGAGGG + Intergenic
1147888890 17:43703264-43703286 GTGTGAGAGAAGAGTGAGGCAGG - Intergenic
1148384916 17:47227518-47227540 AGGTGAAAGGAGAGGCAGGAGGG - Intergenic
1148582282 17:48752348-48752370 AGGTGACAGGAGAGGGAGGAAGG + Intergenic
1149434091 17:56618724-56618746 GTGGGAGAGCAGAGTGAGCATGG + Intergenic
1149573710 17:57696273-57696295 ATGTCACGGCAGAGTGTGGAAGG + Intergenic
1149871173 17:60183182-60183204 ATGTTAGCGCTGAGTGAGGATGG + Exonic
1150378326 17:64700713-64700735 CTGTGAAAACAGAGTAGGGATGG + Intergenic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1151199208 17:72455466-72455488 ATGTGAAAGCCCAGTGCCGAAGG + Intergenic
1151316747 17:73327388-73327410 ATGAGAAAGAAGAGAGAGGCTGG - Intergenic
1151622662 17:75255859-75255881 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1151839572 17:76608379-76608401 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152228773 17:79104506-79104528 ATGTCCTAGCAGGGTGAGGAGGG - Intronic
1152496907 17:80679813-80679835 AAGAGAAAGCAGAGAAAGGAAGG - Intronic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155117892 18:22787635-22787657 CAGTGAAAGCAGAGTGAGCGGGG + Intergenic
1155572069 18:27205807-27205829 ATGTGAAGACACAGTGAGAAGGG - Intergenic
1155663034 18:28274762-28274784 TTTTTAAAGCAGAGTGGGGAAGG - Intergenic
1155696845 18:28695536-28695558 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1155720744 18:29008726-29008748 ATGTTATACCAGAGTGAGGCTGG + Intergenic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1159082448 18:63751076-63751098 ATTTGAAGGCAGAGTGACAAGGG - Intergenic
1159164650 18:64684916-64684938 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1159370660 18:67523584-67523606 ACTTGAAGGTAGAGTGAGGAAGG + Intergenic
1160872044 19:1282122-1282144 ATGTGAATGGAGAGGAAGGATGG + Intergenic
1161657953 19:5527296-5527318 ATATTAAAGTAGAGTGAGGCTGG + Intergenic
1161661907 19:5551762-5551784 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1162163243 19:8734616-8734638 AAGAGAAAGCAGATTGATGATGG + Intergenic
1162274025 19:9638977-9638999 ATGTGAAAGCAAAAAGAGGTCGG + Intronic
1162810997 19:13164251-13164273 ATCTGAAATCAGATGGAGGAGGG + Intergenic
1163900038 19:20093042-20093064 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
1164153153 19:22571532-22571554 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1165163320 19:33831726-33831748 CACTGAGAGCAGAGTGAGGAGGG - Intergenic
1165249420 19:34517282-34517304 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1165338971 19:35196943-35196965 ATGTGAAGACACAGTGAGAAGGG - Intergenic
1165835535 19:38752898-38752920 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166498761 19:43325929-43325951 AAGTGAAAGCAAAGAGAGGCGGG + Intergenic
1167482221 19:49740049-49740071 AGATGAAGCCAGAGTGAGGAAGG - Exonic
1167512316 19:49901878-49901900 ATCTAAAACCAGAGTGAGCAGGG + Exonic
1167623107 19:50569495-50569517 AGGTGAGAGGAGAGTGAGTAGGG - Intergenic
1167798391 19:51725403-51725425 AGGTAAAAGCAGAGAGAGAATGG - Intergenic
1168135944 19:54352034-54352056 TTATCAAAGCAGAGTAAGGAGGG - Exonic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1202711979 1_KI270714v1_random:23910-23932 AAGTGACAGCGGAGTTAGGAGGG + Intergenic
925153856 2:1635398-1635420 TTGTGAATGCAAAGTGAGTATGG - Exonic
925525041 2:4790582-4790604 AGGAGAAAGGAGAGTGAGGGAGG - Intergenic
925560033 2:5181732-5181754 ATGTTAAAACAAACTGAGGAGGG + Intergenic
925749206 2:7072359-7072381 ATTTCAAAGCAAAGTGTGGAAGG + Intergenic
925828645 2:7875097-7875119 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
926463772 2:13165348-13165370 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
926463913 2:13166415-13166437 AAGTGAAAGCCAAGAGAGGATGG + Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
926815370 2:16794359-16794381 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
927106395 2:19831046-19831068 ATGTGATGGCAGTGAGAGGATGG + Intergenic
927134334 2:20085600-20085622 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
927548413 2:23975431-23975453 ATGTCAAAGCAGACTGAGAGCGG + Intronic
927565924 2:24112935-24112957 ATTTGGAAGAAGAGTGAGTATGG - Intronic
927815942 2:26217555-26217577 ATCTGAAAGCAGACAGAGGAAGG + Intronic
928109351 2:28494126-28494148 ATGTGAAAGGAGTTAGAGGAAGG + Intronic
928657248 2:33465047-33465069 ATGATAAAGCCTAGTGAGGAAGG + Intronic
928770640 2:34699514-34699536 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
928779538 2:34803387-34803409 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
929076501 2:38083188-38083210 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
929126509 2:38527258-38527280 CTGTGACAGCTGAGTGGGGAAGG + Intergenic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
932299290 2:70654525-70654547 ATGTGAAAGGAAAGTCAGGCTGG - Intronic
932367069 2:71160360-71160382 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932784887 2:74591566-74591588 AGAAGAAAGCAGAGTTAGGAAGG + Intronic
933036825 2:77410551-77410573 ATGGGAAAGTACATTGAGGATGG + Intronic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933138113 2:78761195-78761217 AAGTGAAAGCAAAGAGAGGATGG - Intergenic
933552221 2:83791328-83791350 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
935019745 2:99218310-99218332 CTGTGACAGCAGAGTGGTGAAGG - Intronic
937023805 2:118681128-118681150 AGGAGAAAGAAGAGTGAGAAAGG + Intergenic
937024052 2:118682774-118682796 AGGTGAATGCAGGGTGGGGAAGG - Intergenic
937715979 2:125033092-125033114 ATGTAAAAACAAAGTGAGGAAGG - Intergenic
938971606 2:136438141-136438163 ATCTGATAGCAAAGTGAGTATGG - Intergenic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939082976 2:137685363-137685385 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
939552633 2:143634661-143634683 ATATTAAAGCAGAATGAAGATGG - Intronic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
939818618 2:146927848-146927870 ATTTGAAAAGAGAGAGAGGAAGG + Intergenic
940921976 2:159317728-159317750 ATGTGACAGCAGAGAGAGTTAGG + Intergenic
941155751 2:161975903-161975925 AGGTGAAATCAGAGTGAGGTGGG + Intronic
941275276 2:163483170-163483192 AAGTGAGAGCAAAGTGATGAAGG + Intergenic
941353561 2:164462401-164462423 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
941456022 2:165712923-165712945 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
941463720 2:165800768-165800790 ATATAAAAACGGAGTGAGGATGG + Intergenic
941483865 2:166053816-166053838 AAGTGAAAGTAGAGTGTAGAAGG - Intronic
941747020 2:169097735-169097757 ATGTGAATTCAAGGTGAGGAGGG - Intergenic
941872936 2:170404665-170404687 ATAGGAAAGAAGAGAGAGGAAGG - Intronic
942430875 2:175910131-175910153 ATGGGAAAGTATAGTGAAGAGGG - Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942730117 2:179054182-179054204 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
942799134 2:179856641-179856663 AAGTCAAAGCAGAGTGGGAAAGG + Intronic
943148139 2:184072118-184072140 ATTTGAAAGCAAAGTAAGTATGG + Intergenic
943286414 2:186007135-186007157 CTGTGAAAACAGAGAGAGGGAGG - Intergenic
944132867 2:196365539-196365561 ATCTGAAAACAGAGTGACAACGG - Intronic
944295664 2:198059610-198059632 ACGAGAAAGCTGAGAGAGGATGG + Intronic
944394316 2:199250218-199250240 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
944463438 2:199976404-199976426 ATGTGATAGGAAAGTGGGGATGG - Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944967431 2:204951066-204951088 ATGTGAAACCAGAATAAGCATGG + Intronic
945301313 2:208218658-208218680 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
945361810 2:208902515-208902537 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
946166196 2:217865432-217865454 ATGTGCAGACAGAGAGAGGAAGG + Intronic
946178269 2:217935161-217935183 ATCTGAAGGCAGGGTGAGGAGGG + Intronic
946214859 2:218176437-218176459 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
946308149 2:218867795-218867817 AGGTGAAAGGTGAGTGGGGATGG + Intronic
946440297 2:219689396-219689418 TTGTGGAAGGAGAGGGAGGACGG - Intergenic
946780870 2:223192258-223192280 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947379414 2:229530814-229530836 ATGTGAAAGAAAATTGAGTATGG + Intronic
947382610 2:229559856-229559878 GTGTGATAGGAGAGTGGGGAAGG - Intronic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
948390867 2:237610238-237610260 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
948729121 2:239952282-239952304 CTCTGAAGGCAGAGTGGGGAGGG + Intronic
1168811174 20:705589-705611 ACGTGAAAGCCCAGAGAGGAAGG + Intergenic
1168925177 20:1573534-1573556 ATGTGAGAGCACAGTAAGGAGGG + Intronic
1168929054 20:1606562-1606584 ATGTGAGAGCACAGTAAGGAGGG + Intronic
1169254041 20:4083711-4083733 ATCTGAAAGCAGAGAGAAGAAGG - Intergenic
1170302847 20:14905460-14905482 GTGAGAAATAAGAGTGAGGAAGG + Intronic
1170370462 20:15642374-15642396 AAGTTAAAGAAGAGTGAGAATGG - Intronic
1170582408 20:17709376-17709398 ATGTGAGAGCAGAGGAATGAAGG + Intronic
1170680264 20:18520024-18520046 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1170942877 20:20863581-20863603 CTGTGGAAGCAGAGAGAGGGCGG + Intergenic
1171165189 20:22963971-22963993 ATGTGATAGTAGAGTCAGGCTGG + Intergenic
1172063977 20:32206888-32206910 ATGGGAAGGAAGAGCGAGGATGG + Intronic
1172151488 20:32793713-32793735 ATGTGAGGGGAGAGTGGGGAGGG - Intronic
1172408002 20:34703829-34703851 GTGGGAAAGCAGAGTGTGTAAGG + Intronic
1172932293 20:38595134-38595156 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1173606567 20:44336180-44336202 AGGTGAAAGCAGAGAGAGAGGGG + Intergenic
1173772514 20:45674527-45674549 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1173781891 20:45762951-45762973 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1174093197 20:48066623-48066645 AGAAGAAAGCAGAGTGAGGTGGG + Intergenic
1174161192 20:48551649-48551671 ATATGGAAGCAGAGAGAGCAAGG - Intergenic
1175275755 20:57769527-57769549 AGGTAAAAGCACTGTGAGGAAGG + Intergenic
1175440728 20:58989338-58989360 AGGTGATAGCAGGGTGAGGGCGG + Intronic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1177100796 21:16895451-16895473 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1177102847 21:16917279-16917301 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1177358963 21:20045004-20045026 ATGTGACAGCAAAGTGACGTGGG - Intergenic
1177928779 21:27252845-27252867 ATGTGAATACTGAGTGTGGAAGG + Intergenic
1178001366 21:28164492-28164514 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179064461 21:38011563-38011585 ATCTGAAAGATGGGTGAGGAGGG - Intronic
1180036905 21:45254767-45254789 TTGTGAAAGCAGAGGGAGCCTGG + Intergenic
1181611168 22:24013137-24013159 ATCTGTAAGCAATGTGAGGATGG - Intronic
1182732457 22:32506060-32506082 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1183286117 22:36965318-36965340 AGGAGAAAGCAGAGTGTGGTGGG - Intergenic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949190213 3:1242230-1242252 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
949212235 3:1516802-1516824 AATTGTAACCAGAGTGAGGATGG + Intergenic
949345722 3:3074865-3074887 ATCTGAAAACAGAGTAAAGAAGG + Exonic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950674321 3:14545411-14545433 ATGTGAACACAGAGTCAGGAGGG + Intergenic
950835422 3:15914525-15914547 ATGTGAGAGCACAGTAAGGAGGG + Intergenic
951316150 3:21191620-21191642 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
951391876 3:22114917-22114939 ATGTGAAAGCACAGCAAGAAGGG + Intronic
951553195 3:23895785-23895807 AGGTGAAAGGAAAGTGGGGAAGG - Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
951748697 3:26009152-26009174 ATGAGAAAGCAAAGGAAGGAAGG - Intergenic
951851811 3:27149804-27149826 ATGATAAAGCTTAGTGAGGAAGG + Intronic
952393074 3:32897525-32897547 ATGTGAAAGCCAAAAGAGGAGGG - Exonic
952663290 3:35876748-35876770 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
952792012 3:37207373-37207395 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
952873785 3:37924997-37925019 AGGTGAGACCAGAGTGGGGAAGG - Intronic
952895047 3:38073090-38073112 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
952895877 3:38078698-38078720 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
953076951 3:39580222-39580244 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
953133352 3:40161764-40161786 AGGTGAGTGTAGAGTGAGGAAGG - Intronic
953177379 3:40564264-40564286 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
953825528 3:46248731-46248753 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
954948927 3:54451771-54451793 ATTTGAAAGCAAAGTGCAGAAGG - Intronic
954969097 3:54636912-54636934 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
955210533 3:56936277-56936299 AAGTGAAGGCAGAGAGAGAAGGG + Intronic
956058781 3:65328964-65328986 AGGTGAAAGCTGAGTGATAATGG - Intergenic
956121230 3:65967833-65967855 AAGGGAAGGAAGAGTGAGGAAGG + Intronic
956421217 3:69087669-69087691 ATTTGAAAGGAAAATGAGGAGGG - Intronic
956548823 3:70437284-70437306 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
956709388 3:72026280-72026302 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
956719640 3:72106526-72106548 ATTTGAAAGAAGACTGAGAAGGG - Intergenic
957295407 3:78327093-78327115 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
957451611 3:80388168-80388190 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
958676627 3:97275402-97275424 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
959877050 3:111395387-111395409 ATGTGAAGACACAGTGAGAAGGG + Intronic
960701987 3:120448639-120448661 ATGTGAAAACAGAGTGCGTTGGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961293659 3:125866881-125866903 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
961321741 3:126081974-126081996 ATGTGCAGGCACAGTGAGGGTGG - Intronic
962022083 3:131511973-131511995 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
962205749 3:133432405-133432427 AGGTGAAAGCAGAGAGAGGCTGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962743761 3:138382267-138382289 ATGTGTCAGCAATGTGAGGAAGG - Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
963425392 3:145116272-145116294 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963456493 3:145553607-145553629 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
963520614 3:146356840-146356862 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963521791 3:146365345-146365367 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963663521 3:148154939-148154961 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
963684502 3:148417636-148417658 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
964175851 3:153825690-153825712 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
964260924 3:154835754-154835776 ATGTGATAACAGAGTCAGGTTGG + Intergenic
965111314 3:164427533-164427555 AAGTCAAACCAGCGTGAGGAGGG + Intergenic
965262483 3:166503204-166503226 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
965336503 3:167434507-167434529 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
965444108 3:168753177-168753199 ATGTGAGAGAATGGTGAGGAAGG - Intergenic
965553804 3:169999053-169999075 ATAAGACAGCAGAGTGAGCATGG + Intergenic
965639862 3:170820385-170820407 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
966085597 3:176064626-176064648 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
966232679 3:177668273-177668295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
966238367 3:177727954-177727976 TTGTTAAAGCACAGTGAGAAAGG + Intergenic
966454369 3:180098615-180098637 ATGTGCATTGAGAGTGAGGAAGG - Intergenic
966698441 3:182818084-182818106 AGCTGAAAGCAGAGTGATGCTGG + Intronic
967005177 3:185376957-185376979 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
967244008 3:187468694-187468716 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
967269458 3:187720766-187720788 ATGTGTCAGCAGAGCTAGGAGGG + Intronic
967275176 3:187767397-187767419 ATATGAAAGCTGAATGATGAAGG + Intergenic
967303939 3:188042728-188042750 AGTTGAAGGCAGAGTCAGGATGG - Intergenic
967496397 3:190147789-190147811 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
967766572 3:193286800-193286822 ATGGGTAAGCTTAGTGAGGAAGG + Intronic
967900026 3:194440388-194440410 ATGTGCAAGCATGGTGAGAATGG + Intronic
967997384 3:195176996-195177018 ATGTGAGAGCCCAGCGAGGAGGG - Intronic
968146299 3:196301750-196301772 ATGTAAAAATAGAGTGGGGAGGG + Intronic
968315015 3:197716823-197716845 ATGTGAAAGCAGAGAGGGCTGGG + Intronic
968471355 4:783936-783958 TTGTTACAGCTGAGTGAGGAAGG - Intergenic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968839276 4:2989964-2989986 AGGCCAAAGCAGAGAGAGGAAGG - Intronic
969086106 4:4657687-4657709 ATGAGAAAGCAGGGAGGGGATGG + Intergenic
969653909 4:8485200-8485222 AGGTGAAAGCAAAGAGAGGCTGG + Intronic
970042250 4:11809566-11809588 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970087715 4:12367054-12367076 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
970254417 4:14152845-14152867 GTGTGAAATCAGAGTGAGGTGGG - Intergenic
970256240 4:14172945-14172967 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
970696477 4:18684273-18684295 ATTTGAGAGCAGATTGTGGATGG + Intergenic
971165935 4:24183680-24183702 AGGAAAGAGCAGAGTGAGGAAGG - Intergenic
972114188 4:35607362-35607384 ATGTGAAAGAAAAGTGGGAATGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972430836 4:38980129-38980151 ATGTGAAAATAAAATGAGGATGG + Intronic
972574885 4:40342727-40342749 TTTTGAAAGCAGTGTGTGGAAGG + Intronic
973721804 4:53731554-53731576 ATGTGAAATCGGGGTGATGATGG + Intronic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974091952 4:57320934-57320956 AGGAGAAAGCAGAGGAAGGAAGG - Intergenic
974154099 4:58047977-58047999 ATGGGAGAGCAGAGTGTGGGAGG - Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976220638 4:82754381-82754403 ATGGGAAAGCAGAGAGAGGGAGG + Intronic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976558736 4:86477873-86477895 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
977062331 4:92273924-92273946 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
978744192 4:112173533-112173555 GTGTGAAAGGATAGTGAAGAAGG + Intronic
978752621 4:112268806-112268828 ATGTGAAGGAAGCATGAGGAGGG + Exonic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979380114 4:119997210-119997232 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979831274 4:125307454-125307476 ATGTGAAAGCTGAGAGAAAAAGG + Intergenic
980528036 4:134015454-134015476 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
980575454 4:134680335-134680357 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
980904113 4:138931152-138931174 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
981949790 4:150392377-150392399 AAGAGAGAGCAGAGTGAGTAGGG + Intronic
982083804 4:151815035-151815057 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982318986 4:154059560-154059582 AGGTAAAAGCAAAGAGAGGATGG - Intergenic
982496942 4:156105904-156105926 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
982736642 4:159013550-159013572 AGGTGAAGACAGAGAGAGGAAGG + Intronic
982849299 4:160292374-160292396 ATCTGAATGCAGAGAGAGGGAGG - Intergenic
983024050 4:162712386-162712408 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983345726 4:166523812-166523834 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
983452505 4:167926178-167926200 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983464722 4:168073127-168073149 ATGTTAAATCTTAGTGAGGAAGG - Intergenic
983559748 4:169088839-169088861 ATTTGAAGGGAGAGTGAAGAAGG - Intergenic
983659745 4:170119738-170119760 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
983973424 4:173902049-173902071 ATGTGAAAGATGAGAGTGGATGG + Intergenic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
984165183 4:176297273-176297295 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
984174252 4:176396645-176396667 GTGTGAAAGCAGAGCAAAGAAGG - Intergenic
984297331 4:177868819-177868841 ATGTGAAGGCAGAGAGACAATGG + Intronic
984322359 4:178210376-178210398 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
984437439 4:179723734-179723756 AAGTGAAAGCTAAGAGAGGATGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985229107 4:187796045-187796067 ATTTGAAGGGAGAGGGAGGAAGG - Intergenic
985531029 5:433950-433972 GCGGGAAAGCACAGTGAGGATGG + Exonic
986193700 5:5518831-5518853 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986389050 5:7266873-7266895 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
986748910 5:10767655-10767677 ACGTGAAAGAAGAGGAAGGAGGG - Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
986905937 5:12493033-12493055 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
987323529 5:16792456-16792478 ATGTGAGAGCTGATTGAGGATGG - Intronic
987755996 5:22098125-22098147 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
988015484 5:25552592-25552614 ATATGAAAGCAGAGAATGGATGG - Intergenic
988199271 5:28048930-28048952 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
988309928 5:29543717-29543739 ATGTGAAAGGAGTGTGAGCTGGG - Intergenic
989352436 5:40501554-40501576 ATTTGAAAGAAGAGTCAGCATGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
989778289 5:45234643-45234665 AGGTGAGAGGAGGGTGAGGATGG - Intergenic
991042285 5:62188356-62188378 ATCTGAAAGCAGAGAGACCAAGG + Intergenic
991619746 5:68533245-68533267 AGGTGAAAAGAGAGTGAGGAGGG + Intergenic
992702002 5:79350295-79350317 ATGTGAAAGCAGAATCAAAATGG - Intergenic
993349601 5:86832330-86832352 ATGAGAAAGCTTAGTGAGGAAGG - Intergenic
994190490 5:96863441-96863463 AAATGAAAGGTGAGTGAGGATGG - Intronic
994666675 5:102713674-102713696 ATGTGAGAGCACAGTGAGTTTGG + Intergenic
994766519 5:103924651-103924673 GGGTGAAAGGAGAGTGAGGTAGG + Intergenic
994949037 5:106432714-106432736 ATGTGAAAACATAGTGAGAAGGG + Intergenic
995122682 5:108552561-108552583 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
995296845 5:110533127-110533149 AGGTGAAAGCAAAGAGAGGCTGG - Intronic
995694623 5:114865654-114865676 GTGTGAAAGCTGGGTGAGGATGG - Intergenic
996052456 5:118949318-118949340 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
996075221 5:119185102-119185124 AGGTGAAAGCAGAGGAAAGAAGG - Intronic
996358446 5:122621291-122621313 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
996574814 5:124969034-124969056 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
997258462 5:132447161-132447183 ATGGGAAGTCAGAGTGAGCAAGG - Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997746572 5:136304598-136304620 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
997770458 5:136548752-136548774 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998908183 5:146929140-146929162 ATGTGGAAGAAGAGAGAGGTAGG - Intronic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999090734 5:148933726-148933748 AGGTGAAAGAAGAGAGAGGGAGG - Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999499176 5:152129682-152129704 ATGAGAAATTAGAGTAAGGAAGG - Intergenic
999618698 5:153452131-153452153 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
999860217 5:155636852-155636874 ATTTGAAAGCAGAGAGATGGGGG - Intergenic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000424765 5:161077634-161077656 ATGTGAAGACACAGTGAGAAAGG - Intergenic
1000507177 5:162135785-162135807 AAGAGGAAGCAGGGTGAGGAAGG + Intronic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1000885151 5:166741519-166741541 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1002610775 5:180417150-180417172 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1003099912 6:3169151-3169173 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1003117627 6:3293803-3293825 TTGTTAAGGCAGAGTGAGGCAGG + Intronic
1003343973 6:5248263-5248285 ATGTGACAGCACAGGGAGAAGGG - Intronic
1004031128 6:11870574-11870596 AGGTGAAGGCAGGGTGGGGACGG - Intergenic
1004106433 6:12670646-12670668 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1004238150 6:13893896-13893918 ATGTGAGGACAGAGTGAGGGGGG + Intergenic
1004283347 6:14299380-14299402 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1004570441 6:16839706-16839728 ATGTGAGAACACAGTGAGAAGGG - Intergenic
1005089182 6:22038452-22038474 ATGTGAGAACAGTGAGAGGAAGG - Intergenic
1005915888 6:30351214-30351236 GTTTCAAAGCAGAGTGAGGCAGG - Intergenic
1006376957 6:33676994-33677016 CGCTGAAAGCAGAGAGAGGAAGG - Exonic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1007293571 6:40804764-40804786 ATTTCAGAGCAGGGTGAGGAAGG - Intergenic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007649673 6:43411406-43411428 ATGTGAAAGAAGAATGTGAAGGG + Intergenic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1008054940 6:46936428-46936450 ATGTGAAAGCATTATGAGAAAGG + Intronic
1008255030 6:49287891-49287913 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1008299086 6:49812168-49812190 ATGAGTAAGCTTAGTGAGGAAGG - Intergenic
1008501457 6:52187570-52187592 ATGGGAAAGGAGAGAGAGGTTGG - Intronic
1008663664 6:53695158-53695180 AGGCCAAAGCAGGGTGAGGAGGG + Intergenic
1009269990 6:61603388-61603410 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1009379312 6:63008610-63008632 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1009901448 6:69812240-69812262 AGGTGGAAGCAGAGTCAGGTGGG + Intergenic
1010098569 6:72076375-72076397 ATGTGAGAGCACAGTGAGAAGGG - Intronic
1011367727 6:86600797-86600819 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1012340055 6:98109751-98109773 ATGGGTAAGCTTAGTGAGGAAGG - Intergenic
1012675265 6:102105239-102105261 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1013299873 6:108794963-108794985 ATGTGAAGACAGAGAAAGGAAGG - Intergenic
1014537341 6:122630192-122630214 ATTTGAAAGCAGGGTGTTGAGGG + Intronic
1014634467 6:123828141-123828163 ATGTGAGTGCAGAGGAAGGATGG - Intronic
1014793817 6:125704287-125704309 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1015271544 6:131342155-131342177 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1015335776 6:132036365-132036387 AAGTGAAAGGCGAGTGTGGAGGG + Intergenic
1015348724 6:132191637-132191659 AGGTGAAAATAGAGAGAGGAGGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1016113974 6:140259871-140259893 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016535586 6:145105576-145105598 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1016765361 6:147786884-147786906 ATGTGACTGCAGAGTGTGGCTGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017389679 6:153924773-153924795 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1017644323 6:156525102-156525124 ATGAGAAAGCAGAATCAGGGAGG - Intergenic
1017650118 6:156572990-156573012 ATTTGAATGCAGAGTTGGGAAGG + Intergenic
1017779173 6:157703078-157703100 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1017869082 6:158470929-158470951 AGGGGAAGGCAGAGAGAGGATGG + Intronic
1018135885 6:160778168-160778190 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1018294764 6:162333776-162333798 ATGATAAAGCTCAGTGAGGAAGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018481494 6:164195526-164195548 ATTTGAAAGTGGAGTGAGGATGG - Intergenic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018638291 6:165884046-165884068 ATGTCAAAGCAGGTGGAGGAAGG + Intronic
1019289005 7:240881-240903 ATGTGAAGGCAGCGGGCGGAGGG + Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1020316220 7:6907066-6907088 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1020540969 7:9460984-9461006 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1021172849 7:17417136-17417158 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1021637492 7:22706527-22706549 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1021977732 7:26026619-26026641 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1022182245 7:27932139-27932161 ATGTGTATGGAGAGTGAGAAAGG + Intronic
1022373047 7:29788126-29788148 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022572623 7:31469457-31469479 AAGTGAAAGCGGAGAGAGGCTGG + Intergenic
1022840620 7:34160788-34160810 ATGAGCAGGCAGAGTGAGGCCGG - Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024632653 7:51262326-51262348 AGGTGACAGGAAAGTGAGGAGGG + Intronic
1025273140 7:57544675-57544697 AGGTTAAAGAAGAGAGAGGAAGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027330481 7:77087661-77087683 ATGTCAAAGCAGTGTGTAGAGGG - Intergenic
1027355443 7:77349775-77349797 AAGTGAAAGAAGAGAGAGGAAGG - Intronic
1027560413 7:79721711-79721733 ATGGGAAAGAAGAGAGATGAGGG - Intergenic
1028455372 7:91032564-91032586 AAGAGAAAGCAGTGTGAAGAGGG + Intronic
1028670676 7:93397219-93397241 AAGTGAAAGCAGAGAGAGGCTGG - Intergenic
1028690343 7:93643144-93643166 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1029137259 7:98382244-98382266 ATTTGAAAAAAGAGTGGGGAGGG + Intronic
1029321514 7:99765018-99765040 ATATGAAAGGAGTGTGAGAAAGG + Intronic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1029785279 7:102783673-102783695 ATGTGAAAGCAGTGTGTAGAGGG + Intronic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030422231 7:109321998-109322020 ATGTGAGAGTAGAGTGAAGCAGG + Intergenic
1030641600 7:112012415-112012437 ATGCTAAGGCAGAGTTAGGAAGG + Intronic
1031004846 7:116458791-116458813 AAGTGAAAGCAAAGAGAGGCTGG - Intronic
1031686016 7:124732318-124732340 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1033464869 7:141581250-141581272 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1033706621 7:143892831-143892853 ATGTGAAAATACAGTGAGAAAGG + Intronic
1033910092 7:146252538-146252560 ATGAGAAAATAGAGAGAGGATGG + Intronic
1034084647 7:148312474-148312496 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1034391224 7:150789048-150789070 ATGAGAACGCAGAGTGCGCAGGG - Intergenic
1034743314 7:153498368-153498390 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034743319 7:153498424-153498446 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1036639655 8:10574552-10574574 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1036673969 8:10813800-10813822 CTCCGAAACCAGAGTGAGGATGG - Intronic
1036731733 8:11271533-11271555 TTGTTAAAGCACAGTAAGGAAGG + Intergenic
1036741283 8:11363956-11363978 TTGTGAAAGTAGAGTGAAAAAGG - Intergenic
1037077402 8:14737665-14737687 ATATGAAAACAGACAGAGGATGG - Intronic
1037494181 8:19423041-19423063 AGGTGCAACCTGAGTGAGGAAGG - Intronic
1037590359 8:20306732-20306754 ATGAGAAGGCAGAGTGGAGAAGG + Intergenic
1038130422 8:24724405-24724427 ATGTAAAAACAAAGTGTGGATGG + Intergenic
1038415077 8:27389239-27389261 ATAGGAAGGCAGAGAGAGGAGGG + Intronic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1038463851 8:27741848-27741870 ATAAGAAAGCAGAGTCAGGATGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039829177 8:41199452-41199474 ATCTGAGAGCAGACTGATGATGG - Intergenic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1040685801 8:49871494-49871516 ATGTGTATGCCTAGTGAGGAAGG - Intergenic
1042705084 8:71658153-71658175 ATGGGAAATCAGAGAGAGAAAGG - Intergenic
1043293546 8:78635860-78635882 ATTTGAAAGCTAAGAGAGGAAGG - Intergenic
1043717729 8:83507575-83507597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044259600 8:90102172-90102194 ATGGGTAAGCCTAGTGAGGAAGG - Intergenic
1044417265 8:91951247-91951269 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1044628059 8:94253925-94253947 TTGTGAAAATAGAGTGGGGATGG - Intronic
1044922167 8:97178363-97178385 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1045770514 8:105733211-105733233 GTGTGAAAGCAGAGTTTGCAGGG - Intronic
1045970750 8:108077306-108077328 ATTGGAAAGCAGTGTGAAGAAGG + Intronic
1046359854 8:113136657-113136679 AGGTGAATGGAAAGTGAGGAAGG + Intronic
1046440186 8:114244625-114244647 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1047061431 8:121231221-121231243 ATGTGAAGGTAGAGGGATGAAGG + Intergenic
1047699526 8:127435004-127435026 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1048097770 8:131313481-131313503 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1048168257 8:132082658-132082680 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1048194820 8:132323622-132323644 ATGGGAAGTCAGAGAGAGGATGG - Intronic
1048369278 8:133763652-133763674 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048369284 8:133763704-133763726 ATGTGAGAGCAGAATGTGGTGGG + Intergenic
1048381651 8:133870647-133870669 AGCTGAAAGGAGGGTGAGGAAGG - Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048562694 8:135558986-135559008 AAGAGAAGGCAGTGTGAGGACGG - Intronic
1048585255 8:135769575-135769597 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1048728254 8:137410700-137410722 AGGTGAAAGCAAAGAGAGGCTGG + Intergenic
1048817507 8:138347662-138347684 ATCAGCAAGCAGAGTGATGATGG - Intronic
1049122710 8:140753586-140753608 ATGTCAAAGGAGACTGAGAAGGG + Intronic
1049945038 9:586229-586251 ACTTCAAAGCACAGTGAGGATGG + Intronic
1050525011 9:6538715-6538737 ATTTGCAAGGAGAGAGAGGAGGG - Intronic
1050797718 9:9565482-9565504 ATCTGAATGCAGAATGATGATGG + Intronic
1051052801 9:12951631-12951653 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1051159671 9:14192612-14192634 ATGTCAAAGCAGAGGAGGGAAGG - Intronic
1051755924 9:20400281-20400303 ATGTGAAAAAAGAGAGATGAGGG + Intronic
1052085106 9:24255600-24255622 ATTTTAGAGCAGAGTGATGATGG + Intergenic
1052720469 9:32166952-32166974 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1053517231 9:38741090-38741112 GAGTGAAAGCAGTGTCAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054807314 9:69407173-69407195 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1055028217 9:71744952-71744974 GTGTGAGAGGAGAGTGAGGGTGG - Intronic
1055233242 9:74088947-74088969 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1055801069 9:80036882-80036904 ATATGAAAGCAGCTTGTGGAAGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056363876 9:85883984-85884006 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1056583177 9:87909490-87909512 ATCTGCAGGCGGAGTGAGGACGG - Intergenic
1056707123 9:88960637-88960659 ATGTGAAGCCAGGGTGAGAAGGG - Intergenic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1057159467 9:92877691-92877713 ATCTGCAGGCGGAGTGAGGACGG - Intronic
1057218364 9:93242148-93242170 CTGTGATAGCACAGTGAGGATGG + Intronic
1057317581 9:93979619-93979641 CTGGGACAGCAGAGTGAGTATGG - Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058612563 9:106791485-106791507 AGGTGAAAGCAAAGAGAGGCTGG - Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1059371521 9:113843400-113843422 ATGCGGAAGGAGAGGGAGGAAGG - Intergenic
1059546005 9:115177046-115177068 AAGTGAAAGCAAAGAGAGGCTGG + Intronic
1059568730 9:115411168-115411190 ATCTGAAAGCAGAGTGAGAGAGG - Intergenic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1060716326 9:125933232-125933254 ATGGGAAGTCAGAGTGAGCAAGG - Intronic
1060737705 9:126077050-126077072 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1060809049 9:126599264-126599286 AGGAGAGAGAAGAGTGAGGAAGG + Intergenic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1061583241 9:131550357-131550379 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1061835364 9:133325244-133325266 ACAAGAAAGCAGAGAGAGGATGG + Intergenic
1185991227 X:4894869-4894891 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186270490 X:7881511-7881533 ATGGGAAAACAGAGTGATCAAGG - Intergenic
1186299602 X:8185419-8185441 GGGTGAATGCAGAATGAGGATGG + Intergenic
1186301677 X:8205884-8205906 ATGTAACAGCAAAGGGAGGATGG - Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187584240 X:20642254-20642276 AAGTGAAAAAAGAGTAAGGAAGG + Intergenic
1187733613 X:22281855-22281877 AAGGGAAAGCAGAGTAAGTAAGG - Intergenic
1187946601 X:24432231-24432253 ATGTGACAGCAGTGGGAGGAAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188463207 X:30451524-30451546 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1189164910 X:38851200-38851222 AAATGAAAGCAGAGAGAGAATGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189248355 X:39580824-39580846 ATGAGAGAGGAGAGAGAGGAGGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190016528 X:46832258-46832280 AGGTGAGTGCAGAGTGAGCAAGG + Intergenic
1190525976 X:51330277-51330299 TTGTGACAGCAATGTGAGGAAGG - Intergenic
1193399063 X:81020904-81020926 ATGTGCAAGCAAAGTGATGAAGG + Intergenic
1193635384 X:83943889-83943911 ATGTGCCAGCAGAGTGATGCTGG + Intergenic
1194211017 X:91068932-91068954 ATGTTAAAGCAGTGTTAAGAAGG + Intergenic
1194367275 X:93026216-93026238 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1194660856 X:96627315-96627337 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1196220815 X:113111142-113111164 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1196525302 X:116723381-116723403 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1196728438 X:118918414-118918436 AAGTGAAAGTAAAGTGAGCATGG + Intergenic
1197499889 X:127229877-127229899 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1198258973 X:134949620-134949642 ATGTGAAGCCAGAGAGAGGAAGG - Intergenic
1198480746 X:137037641-137037663 AAGTGAGATCAGAGAGAGGAAGG - Intergenic
1198598616 X:138262090-138262112 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1198599227 X:138266742-138266764 AAGTGAAAGCAAAGAGAGGCTGG + Intergenic
1199052181 X:143249075-143249097 ATCTGAATGCAGATTCAGGAAGG + Intergenic
1199418563 X:147615976-147615998 CTGTGAAAGGAGAGTGATAATGG + Intergenic
1199479073 X:148277817-148277839 ATGTGAAATAGGAGTGATGAGGG - Intergenic
1199504334 X:148544396-148544418 GAGTGAAAGCAGGGTGGGGATGG - Intronic
1199576650 X:149318946-149318968 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1199798436 X:151226273-151226295 AGGTAAAAGCTGAGTGAGGCTGG + Intergenic
1200675485 Y:6142475-6142497 AAGTGAAAGCAAAGAGAGGCTGG - Intergenic
1200775207 Y:7164440-7164462 AGAAGAAAGCAGAGGGAGGAAGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1201924715 Y:19271922-19271944 ATGTGCCAGCAGACAGAGGAAGG - Intergenic