ID: 1007618487

View in Genome Browser
Species Human (GRCh38)
Location 6:43196803-43196825
Sequence ATTGAGAAGCATCATGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 245}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007618487_1007618496 26 Left 1007618487 6:43196803-43196825 CCATCCTCATGATGCTTCTCAAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1007618496 6:43196852-43196874 TGAGCGTGCAGGTACCATTGTGG 0: 1
1: 0
2: 1
3: 3
4: 54
1007618487_1007618497 29 Left 1007618487 6:43196803-43196825 CCATCCTCATGATGCTTCTCAAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1007618497 6:43196855-43196877 GCGTGCAGGTACCATTGTGGAGG 0: 1
1: 0
2: 0
3: 2
4: 67
1007618487_1007618490 -3 Left 1007618487 6:43196803-43196825 CCATCCTCATGATGCTTCTCAAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1007618490 6:43196823-43196845 AATCGCTACTCAGAGCCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1007618487_1007618498 30 Left 1007618487 6:43196803-43196825 CCATCCTCATGATGCTTCTCAAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1007618498 6:43196856-43196878 CGTGCAGGTACCATTGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 62
1007618487_1007618489 -4 Left 1007618487 6:43196803-43196825 CCATCCTCATGATGCTTCTCAAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1007618489 6:43196822-43196844 CAATCGCTACTCAGAGCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 41
1007618487_1007618493 15 Left 1007618487 6:43196803-43196825 CCATCCTCATGATGCTTCTCAAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1007618493 6:43196841-43196863 CCGGGCAGCCCTGAGCGTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007618487 Original CRISPR ATTGAGAAGCATCATGAGGA TGG (reversed) Exonic
900675707 1:3884471-3884493 ATTTAGAAGAGTCAAGAGGATGG - Exonic
900799835 1:4730446-4730468 AATGAGAGGGATCAAGAGGAAGG - Intronic
904774208 1:32896702-32896724 AGTGAGGAACATCAGGAGGAAGG - Intronic
905126261 1:35718215-35718237 ATTGAAGAGCATGAAGAGGAAGG + Intronic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
908838473 1:68253350-68253372 AAAGAGAAGAATCATGAGGTGGG + Intergenic
909667814 1:78155012-78155034 ATTGAAAAGCATGATGTGGTAGG + Intergenic
911032326 1:93502753-93502775 ATTGAGAATCATCCTTAGAATGG - Intronic
911151906 1:94604246-94604268 ATTGATGAGCAGCATGAGCATGG + Intergenic
911512550 1:98825673-98825695 ATGGAAATGCATCATGAGTAAGG + Intergenic
912443842 1:109718222-109718244 ATTGAGAAGTGTCATGACGAAGG - Exonic
912864101 1:113241567-113241589 ATTGAGAAGCATTTTAAGGCTGG + Intergenic
913367271 1:118053884-118053906 ATTGGGAAGAAGCATGAAGATGG - Intronic
914846914 1:151288538-151288560 ATTGGGGAGCATCATGGGGCAGG - Exonic
916350549 1:163844844-163844866 ATTAAGAACCAATATGAGGAAGG - Intergenic
918140562 1:181716193-181716215 TTTGAGAAGCACCACAAGGAGGG + Intronic
919274752 1:195399437-195399459 ACTGTGCAGCCTCATGAGGAAGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920814431 1:209318145-209318167 TTTGAGTGGTATCATGAGGATGG - Intergenic
1063697925 10:8355884-8355906 AGAGAGAAGCATCCTGAGGCAGG - Intergenic
1066433382 10:35373691-35373713 ATTAAGAAAAATCATAAGGAAGG - Intronic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068916571 10:62438825-62438847 TGTGAGAAGCATACTGAGGAAGG - Intronic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071848364 10:89542875-89542897 GTTGAGAAGCATGATAATGAAGG - Intronic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1074324337 10:112433570-112433592 CCTGAGAAGCTTCATGAGGGCGG - Intronic
1075918351 10:126189177-126189199 ATAGAGAAGGATCATGATGAAGG + Intronic
1076942378 10:133618445-133618467 ACTGACCATCATCATGAGGACGG - Intergenic
1077593126 11:3508208-3508230 ATTGAGAAGCTTCAGCAGGTGGG - Intergenic
1077783195 11:5354600-5354622 AGTGGGGAGGATCATGAGGAGGG - Intronic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079362581 11:19781509-19781531 ATTGAGAATAATGATGATGAGGG + Intronic
1079599688 11:22295597-22295619 AATGTGAAGCATTACGAGGATGG + Intergenic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1081578538 11:44334879-44334901 AGAGAGAAGCTTCAAGAGGACGG - Intergenic
1083205826 11:61148452-61148474 ATTCAGCAGCATGATTAGGAAGG - Intronic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084248960 11:67880929-67880951 ATTGAGAAGCTTCAGCAGGTGGG - Intergenic
1084477647 11:69398162-69398184 CTTGAGAGGGATCTTGAGGAGGG - Intergenic
1084823858 11:71714541-71714563 ATTGAGAAGCTTCAGCAGGTGGG + Intergenic
1085199749 11:74694729-74694751 ATTGTGAGTCATCTTGAGGAGGG + Intergenic
1087123527 11:94599661-94599683 AGTGGAAGGCATCATGAGGATGG + Intronic
1088206427 11:107397558-107397580 ATTGGGAAGGATCATCAGGTGGG - Intronic
1088899741 11:114106337-114106359 TTTAAGAAGCATCATTATGATGG + Intronic
1089264244 11:117246920-117246942 ATTGAGAAGCTTTGTGAGAAGGG + Exonic
1089364083 11:117910385-117910407 ATTGACAAGCATTATAATGAGGG + Intronic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090604202 11:128404644-128404666 TGTGATAAGCATCATGAGAAAGG + Intergenic
1090919858 11:131198097-131198119 CTTGGGAAGCATGATCAGGAAGG - Intergenic
1091146552 11:133285077-133285099 AATGAGAGACCTCATGAGGAAGG + Intronic
1092140248 12:6178816-6178838 ATGGAGAAGCGTCATGGGGCAGG + Intergenic
1092419244 12:8316351-8316373 ATTGAGAAGCTTCAGCAGGTGGG - Intergenic
1092905508 12:13097329-13097351 TGTGACAAGGATCATGAGGAGGG - Intronic
1093480225 12:19596774-19596796 ATTGATAAGAATAATGAAGAGGG + Intronic
1093666174 12:21815882-21815904 CTTGAGAAGGATCTGGAGGATGG + Exonic
1093806784 12:23443560-23443582 ATTGAAAAGCATCAACAGAAAGG + Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1095789484 12:46148605-46148627 AATGAAAAACTTCATGAGGAAGG - Intergenic
1102326461 12:111989243-111989265 ATTGAGCAGCATCATGACTGAGG - Intronic
1104395742 12:128431012-128431034 ATGATGAAGCTTCATGAGGAAGG + Intronic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1106693316 13:32143602-32143624 ATTGTGTATCATGATGAGGAAGG - Intronic
1106897581 13:34321301-34321323 ATGGAGAAGAATCATGATAAAGG + Intergenic
1107200836 13:37714813-37714835 TTTGAAAAGCATTATGAAGAAGG - Intronic
1108576128 13:51793017-51793039 ATTGAAAAGTGTCATGAGCAAGG - Intronic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1110577723 13:77079167-77079189 GTTGAAAGGCTTCATGAGGAAGG - Intronic
1110692448 13:78446844-78446866 TTTGAGATACATCATGACGAGGG + Intergenic
1111426070 13:88084752-88084774 ATTGAGATGTATAATGAGGTGGG - Intergenic
1114402954 14:22426635-22426657 TTTGACAAGCATCAGAAGGAGGG - Intergenic
1116733243 14:48653051-48653073 AATGAGAAGAATCAGGAGTAGGG - Intergenic
1117479215 14:56126389-56126411 AGTGAGAAGCATTATGCGGATGG - Intronic
1117939710 14:60948988-60949010 AGTGAGAAGAATCATGGGTAAGG - Intronic
1118491604 14:66266275-66266297 AATGAAAAGTATCAGGAGGAGGG + Intergenic
1119637041 14:76281975-76281997 AATGAAAAGCATTATGAAGATGG + Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1121602047 14:95212649-95212671 GTTGAGAGGCAACATGATGAAGG + Intronic
1124017491 15:25889659-25889681 ATTTGGAAGCATTATGGGGAAGG + Intergenic
1129184178 15:73895756-73895778 TGTCAGAAGCATCCTGAGGAAGG + Intergenic
1131757102 15:95576779-95576801 ACAGAGAAGCATCATGAGCAAGG - Intergenic
1133358757 16:5156822-5156844 ATTGAGAAGCTTCAGCAGGTGGG - Intergenic
1135791912 16:25404698-25404720 ATTGAGAAACATCATGTGGCAGG - Intergenic
1138985737 16:62326429-62326451 ATTTAGAAACATCATGTGAATGG + Intergenic
1144188163 17:12815762-12815784 CTTGAGAAGCTTCATGGGGGAGG + Intronic
1145334287 17:21899296-21899318 ATTGAGGGGTATCATGTGGAAGG + Intergenic
1146606937 17:34268610-34268632 TTTTAGAAGCATCAGGTGGATGG + Intergenic
1147681517 17:42250626-42250648 ATTGAAAATCATCACGAGGCCGG + Intronic
1148210803 17:45807262-45807284 GTTGAGAAGGATCCTGAGGTTGG + Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1155575310 18:27239196-27239218 ATTGAAAAGTCTCATTAGGAAGG + Intergenic
1156042569 18:32839360-32839382 GTTAAGAAGTATCATGAGTATGG + Intergenic
1158052142 18:53234982-53235004 TTTGAAAAACCTCATGAGGATGG + Intronic
1158581569 18:58688852-58688874 ATTGAGAATCACCAAGAGGCCGG + Intronic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1162598715 19:11650127-11650149 ATTGAGTAGCCTGAAGAGGAGGG + Intergenic
1166056510 19:40292826-40292848 ATTGAGAAGATTCCTGGGGAGGG - Intergenic
1166057907 19:40304396-40304418 ATTGAGAAGATTCCTGGGGAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
925333484 2:3076326-3076348 ATTAAGGAGCATAATCAGGAGGG + Intergenic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928316377 2:30249780-30249802 AGTAAGAACCATCATTAGGAAGG + Intronic
929438349 2:41946210-41946232 ATGGAGGAGCAACATGAGCAGGG + Intronic
929770490 2:44887742-44887764 ATAGAGAATCATCTTGAGGAAGG - Intergenic
929877578 2:45809354-45809376 CTTGAGAAGCATTTTGAGTAAGG + Intronic
930550327 2:52826569-52826591 ATAGAGAAGGTTGATGAGGAGGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
931455251 2:62405093-62405115 GTTGAAAAGGATCACGAGGAAGG + Intergenic
931717871 2:65043406-65043428 ATTGTTAAGCATCTTGAGGTAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
936404459 2:112189764-112189786 ATTGGGAATCATCATGAGGTGGG - Intergenic
938508846 2:131918302-131918324 CATGAGAAGCATCACGTGGATGG - Intergenic
940857972 2:158744544-158744566 GTTTAGAAGCATCCTGAGGATGG - Intergenic
942031508 2:171966410-171966432 TTTGAGAAGTATAATAAGGATGG + Exonic
944464977 2:199991948-199991970 ATTCACAAACATCCTGAGGAGGG + Intronic
944542357 2:200766099-200766121 AATGAGACGACTCATGAGGAGGG - Intergenic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
946195340 2:218029237-218029259 ATTGAGAAGAATCATTACAAAGG + Intergenic
947062203 2:226179602-226179624 AATGAGAAGCCTGATAAGGAAGG + Intergenic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947420003 2:229933562-229933584 AAAGAGAAGCATCATGAGCCGGG + Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948447136 2:238041418-238041440 ACTGAGAGGGAGCATGAGGACGG - Exonic
948511198 2:238466426-238466448 CTTGAGAAGCTTCCTGAGGAGGG + Intergenic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1170593666 20:17790022-17790044 ATTGAGAGGCTTCATGAGGTGGG - Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1176784646 21:13240246-13240268 CATGAGAAGCATCACGTGGATGG + Intergenic
1177304876 21:19301838-19301860 AATGAGGAGAATCATAAGGAGGG + Intergenic
1177982694 21:27934091-27934113 CATGAGAAGCATCACGTGGACGG + Intergenic
1179548613 21:42128548-42128570 ATAGAGAAGCAACACAAGGAAGG + Intronic
1181627640 22:24132488-24132510 ATTCAGAAGCCTCTTGAGGCTGG - Intronic
949976907 3:9469063-9469085 ATTGAGCAGCTTCTTCAGGAAGG + Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950775281 3:15344508-15344530 ACTGAGAAGCCTCAGGAAGATGG + Intergenic
951336364 3:21427309-21427331 ACTGAGAAGCATTATTAGTAGGG + Intronic
958040805 3:88223765-88223787 TTTTAGAAGCATCATGATTAAGG - Intergenic
958920860 3:100103902-100103924 ATTAATAAGAATCATGAGCACGG + Intronic
959659108 3:108845442-108845464 ATGGAGAAAAATCATGAGCAGGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
961531913 3:127545110-127545132 GATCCGAAGCATCATGAGGAAGG + Intergenic
961555923 3:127696708-127696730 ATGAAGAAGCATCATGGGGCCGG - Intronic
961672835 3:128547465-128547487 GCTGAGGAGCTTCATGAGGAGGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961896926 3:130175546-130175568 ATTGAGAAGCTTCAGCAGGTGGG - Intergenic
962506267 3:136049271-136049293 ATTTAGAGGCATCATCATGATGG - Exonic
963089883 3:141473885-141473907 CTTGAGATGCATCATTAGGTTGG + Intergenic
964875310 3:161360555-161360577 TTTGTGAAGCATCATAAAGATGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966697618 3:182807890-182807912 ATTTATAAGTATCATGAGCAAGG - Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
969746504 4:9076960-9076982 ATTGAGAAGCTTCAGCAGGTGGG + Intergenic
969805856 4:9608352-9608374 ATTGAGAAGCTTCAGCAGGTGGG + Intergenic
971258188 4:25032108-25032130 ATTGACAAGATCCATGAGGACGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
972715462 4:41641582-41641604 ATAGTGAAGTATCTTGAGGATGG + Intronic
975653387 4:76616725-76616747 GATGAGAAGCATCCTGTGGATGG + Intronic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976774315 4:88690510-88690532 ATAGGCAAGCATCCTGAGGAAGG + Intronic
977069637 4:92368293-92368315 CTTGAGAAGCATTAAGAGGTAGG + Intronic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
984145254 4:176052661-176052683 CTTGAGAAACATTCTGAGGAAGG - Intergenic
986478172 5:8157664-8157686 ATTGAGAAGCCTCGTGGTGATGG - Intergenic
986486738 5:8245560-8245582 TTTGAGAAGCATCATCACGTGGG + Intergenic
987148155 5:15012634-15012656 GTTAAGGAGAATCATGAGGAAGG + Intergenic
988103511 5:26712351-26712373 ATTTAGAATTATCTTGAGGAAGG + Intergenic
989784550 5:45312186-45312208 AATGAGAAGCATCCTCAAGAGGG - Intronic
990450756 5:55929808-55929830 AAGGAGAAGCATCCTGCGGAGGG - Intergenic
990867362 5:60395075-60395097 ATTAAGATGGAGCATGAGGAAGG - Intronic
991473408 5:66994119-66994141 AGTGAGGAGCACCAAGAGGAAGG + Intronic
992362932 5:76060827-76060849 ATTAATAAGCTTCGTGAGGAAGG - Intergenic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
995884004 5:116872535-116872557 ATTGAAAAGCATCTTTAGGCTGG + Intergenic
998006919 5:138663190-138663212 AGAGAGACACATCATGAGGATGG - Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
1000592348 5:163173616-163173638 ATAGAGAAGCCTTATGAGGGAGG - Intergenic
1002924541 6:1597370-1597392 ACTGAGAATTAACATGAGGATGG - Intergenic
1003373744 6:5554345-5554367 ATTTGGAAGCATCAGCAGGAGGG + Intronic
1004350362 6:14885518-14885540 ACTGAGAAGCTTCATGGGAAAGG + Intergenic
1004526014 6:16408492-16408514 AATGAGGAACATGATGAGGATGG + Intronic
1005748529 6:28862383-28862405 ATTGAGGAGCATAATGCCGAAGG - Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1009023461 6:57970143-57970165 ATTGAAAAGCCTCAACAGGAAGG - Intergenic
1009199036 6:60721708-60721730 ATTGAAAAGCCTCAACAGGAAGG - Intergenic
1009627189 6:66149450-66149472 AATGAGAAACATCAAAAGGAGGG - Intergenic
1011452316 6:87506891-87506913 ATGGAGTAGGATCATGAGGTGGG + Intronic
1012148254 6:95713534-95713556 AATGAGAAGAGTTATGAGGATGG + Intergenic
1012510994 6:100001665-100001687 ACGGGGAAGCATCATGAGCATGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1016569848 6:145499051-145499073 AGTGTGAAGAATCATCAGGAAGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017685163 6:156906131-156906153 AGGGAGTGGCATCATGAGGAGGG + Intronic
1017958264 6:159198282-159198304 ATTAAGATGGATCATAAGGAAGG + Intronic
1018504477 6:164450053-164450075 GTTGAGAAGTATCAAGAGGTCGG + Intergenic
1019015938 6:168879178-168879200 GTGGATAAGCATCATGGGGACGG + Intergenic
1020327611 7:6987220-6987242 ATTGAGAAGCTTCAGCAGGTGGG - Intergenic
1020413621 7:7920599-7920621 ATTCAGAAGCGTCATCAGGCTGG - Intronic
1023555828 7:41421914-41421936 GATTAGAAGCATCATGAGGTAGG - Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028178448 7:87685688-87685710 GTTGACAAGCATCATGATGAAGG + Intronic
1028311749 7:89347013-89347035 ATTGTGAAGCATAATGATTAAGG - Intergenic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1029564509 7:101326960-101326982 AGTCAAAAGCATCATGAGGCCGG - Intergenic
1030157964 7:106476079-106476101 ATTGAGAAGAGTCATATGGATGG + Intergenic
1031199244 7:118658230-118658252 ATTTTGAAGCATCATCAGGAGGG - Intergenic
1031595460 7:123644751-123644773 ATTAAGAAGAATGATGTGGAAGG - Intergenic
1031995460 7:128227487-128227509 AATCAGAAGCACCATCAGGAAGG - Intergenic
1033445837 7:141421203-141421225 ATTTAGAAGCATGATGGAGAAGG - Intronic
1036106762 8:5849110-5849132 AATGAGAAGCATCATGGTGTGGG - Intergenic
1036369003 8:8146875-8146897 ATTGAGAAGCTTCAGCAGGTGGG + Intergenic
1036648924 8:10629789-10629811 ACTGTGAGGCATCTTGAGGAGGG - Intronic
1036881890 8:12518767-12518789 ATTGAGAAGCTTCAGCAGGTGGG - Intergenic
1038044608 8:23755536-23755558 ATTGTGAAACATCCAGAGGAGGG - Intergenic
1038526449 8:28278130-28278152 CTGGAGAAGGATCATGATGATGG + Intergenic
1042512218 8:69624064-69624086 ATTGCTAAGCGTCATGATGAAGG + Exonic
1044165187 8:88973721-88973743 ATTGAAAAGCGGCATGAGCAGGG + Intergenic
1044464745 8:92489871-92489893 AATGAGAAGCATGAAAAGGAGGG - Intergenic
1045072285 8:98520703-98520725 CTCGAGATGCATCATGAAGAGGG + Intronic
1046083803 8:109406339-109406361 ATTCAGAAGCATCAGCAGGTAGG - Exonic
1052200948 9:25779166-25779188 ACTGAGAACTAACATGAGGAGGG - Intergenic
1055107616 9:72528679-72528701 ATTCAGAACCTTCAGGAGGATGG - Intronic
1055904907 9:81281902-81281924 ATGAAGATGCATCATGAAGAAGG - Intergenic
1056769683 9:89467824-89467846 ATTTATAAGAATCATGAGGCTGG - Intronic
1056796144 9:89660086-89660108 ATTCAGAGGCATCATGGTGAAGG + Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057592341 9:96383500-96383522 GTTGACAAGCACGATGAGGAAGG + Exonic
1058805792 9:108590378-108590400 ATTGAGCAACAGCATGAAGAAGG - Intergenic
1059745035 9:117191933-117191955 ATGGAAAAGGATCATGAGGGAGG + Intronic
1060451216 9:123742484-123742506 ATTGAGCAGAAACATGTGGAAGG - Intronic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186095834 X:6100897-6100919 ATTGAGAAGGATGAGGAGAAAGG - Intronic
1186347264 X:8706725-8706747 ATTGAAAAGGTTCAGGAGGAGGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187481522 X:19660302-19660324 ATAAAGAAGCATTATGAAGATGG - Intronic
1187953121 X:24490382-24490404 ATTCACAAGCTTCATGAGCAGGG - Intronic
1188822346 X:34790620-34790642 AATGATAGGGATCATGAGGATGG + Intergenic
1189048638 X:37620208-37620230 ATTGAGGAGCATCTTGGGAATGG - Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190437021 X:50435569-50435591 ATTACCAAGAATCATGAGGAAGG + Intronic
1191747850 X:64509564-64509586 ATTGAGATGAATCATGTGGGTGG + Intergenic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1194974194 X:100376792-100376814 AATGAGAAGCTACATGAAGAAGG + Intronic
1196175006 X:112630820-112630842 ATTCTAAAGCATAATGAGGAAGG + Exonic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1201502842 Y:14664015-14664037 ATTGAGAAGGATGAGGAGAAAGG + Intronic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic