ID: 1007620486

View in Genome Browser
Species Human (GRCh38)
Location 6:43210609-43210631
Sequence TGCCATACCCTTAATGTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007620484_1007620486 3 Left 1007620484 6:43210583-43210605 CCCTGGGATTGTTTTGCTTTTAA 0: 1
1: 1
2: 3
3: 37
4: 556
Right 1007620486 6:43210609-43210631 TGCCATACCCTTAATGTTTTAGG No data
1007620480_1007620486 30 Left 1007620480 6:43210556-43210578 CCAGTATTCTAATTTTGTTAGAA 0: 1
1: 0
2: 1
3: 36
4: 341
Right 1007620486 6:43210609-43210631 TGCCATACCCTTAATGTTTTAGG No data
1007620485_1007620486 2 Left 1007620485 6:43210584-43210606 CCTGGGATTGTTTTGCTTTTAAC 0: 1
1: 0
2: 0
3: 20
4: 361
Right 1007620486 6:43210609-43210631 TGCCATACCCTTAATGTTTTAGG No data
1007620483_1007620486 4 Left 1007620483 6:43210582-43210604 CCCCTGGGATTGTTTTGCTTTTA 0: 1
1: 0
2: 2
3: 38
4: 381
Right 1007620486 6:43210609-43210631 TGCCATACCCTTAATGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007620486 Original CRISPR TGCCATACCCTTAATGTTTT AGG Intronic
No off target data available for this crispr