ID: 1007621128

View in Genome Browser
Species Human (GRCh38)
Location 6:43215289-43215311
Sequence TCGCTCTGGCTGCCACAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007621128_1007621130 -7 Left 1007621128 6:43215289-43215311 CCTTTCTGTGGCAGCCAGAGCGA 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1007621130 6:43215305-43215327 AGAGCGAAACCTCCAAGCCCAGG 0: 1
1: 0
2: 1
3: 10
4: 149
1007621128_1007621136 24 Left 1007621128 6:43215289-43215311 CCTTTCTGTGGCAGCCAGAGCGA 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1007621136 6:43215336-43215358 GCACCTGACCCCTTGCAGTGAGG 0: 1
1: 0
2: 3
3: 15
4: 138
1007621128_1007621138 27 Left 1007621128 6:43215289-43215311 CCTTTCTGTGGCAGCCAGAGCGA 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1007621138 6:43215339-43215361 CCTGACCCCTTGCAGTGAGGCGG 0: 1
1: 0
2: 4
3: 27
4: 240
1007621128_1007621139 28 Left 1007621128 6:43215289-43215311 CCTTTCTGTGGCAGCCAGAGCGA 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1007621139 6:43215340-43215362 CTGACCCCTTGCAGTGAGGCGGG 0: 1
1: 0
2: 3
3: 16
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007621128 Original CRISPR TCGCTCTGGCTGCCACAGAA AGG (reversed) Exonic
900585745 1:3431476-3431498 TGGCCCTGGCCGGCACAGAATGG - Intronic
900967175 1:5966837-5966859 TCCCTCTGGCTGCCTGGGAACGG + Intronic
903380022 1:22890247-22890269 TTGCTGTGGGTGCCACAGGAGGG - Intronic
905051821 1:35058360-35058382 TCACTCTGGGAGCCACAGACTGG + Intergenic
905356328 1:37387548-37387570 AGGCTCTGGCTCCCCCAGAAAGG + Intergenic
907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG + Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
912977341 1:114342566-114342588 TCCCCCTGGCAGCCACAGCATGG + Intergenic
923182573 1:231534347-231534369 TCACTCTGGCAGCTACAGAAAGG + Intronic
1064914619 10:20442306-20442328 TCACTCTGGGTGCTGCAGAATGG + Intergenic
1068483702 10:57628760-57628782 TCAATCTGTCTGCCACAGCATGG - Intergenic
1069388200 10:67903855-67903877 TCCCTATGGCAGCAACAGAATGG + Intronic
1073435255 10:103512429-103512451 TGGCTCTGCCAGCCACAGATAGG + Intronic
1076132875 10:128025948-128025970 TGGCTCTGGCTGCCAAAGAAAGG - Intronic
1076379937 10:130017885-130017907 TCACTCTGGCCGCCTCAGAAGGG - Intergenic
1077873615 11:6284170-6284192 TCTTTCTGGCAACCACAGAAGGG + Intergenic
1079091297 11:17482146-17482168 TGCCTCTGGCTGGCACAGCATGG + Intergenic
1080231027 11:30017491-30017513 GCGCTCTGGCAGGCACAGGAGGG - Intergenic
1080866299 11:36198482-36198504 TCCTGCTGGCTGACACAGAAAGG - Intronic
1091980306 12:4859329-4859351 TCTCACTGCCAGCCACAGAAAGG + Intergenic
1092634376 12:10425920-10425942 TCGCTCTGGCAGCCATTGGATGG - Intronic
1092635421 12:10441345-10441367 TCGCTCTGGCAGCCATTGGATGG - Intronic
1095649321 12:44588323-44588345 TGGCTCAGGCTGCCTCAGAGAGG - Intronic
1099781666 12:87202985-87203007 TCTCTCTGGCTACCACAGCTGGG - Intergenic
1099874646 12:88390151-88390173 CCTCTGTGGCTGCCACAGCAGGG - Intergenic
1108252342 13:48579659-48579681 TGGCACTGGCTGACACAAAATGG - Intergenic
1108638984 13:52364431-52364453 ACGCTCTGGCTGCCACATGTGGG + Intergenic
1113236133 13:108277464-108277486 TTTCTCTGGCGACCACAGAAGGG - Intronic
1115228512 14:31131259-31131281 TCGTTTTAGCTGCCACAGATGGG - Intronic
1115630973 14:35245021-35245043 TAGCTCTGACTTCCCCAGAAGGG - Intronic
1116461763 14:45184801-45184823 TCGCTGTTACTGCCACAGACTGG + Intronic
1117632316 14:57706934-57706956 TCTCTCTGGCTGCAATAGAAAGG + Intronic
1118768541 14:68926513-68926535 TCTCTCTGGTTGCCACAGAGTGG - Intronic
1118885936 14:69865927-69865949 TCCCTCTGGCTGCCACAGAGAGG - Intronic
1119174883 14:72561761-72561783 TGCCTCTGGGTGCCACAGATGGG + Intronic
1122856552 14:104562995-104563017 TCCCTCTGGCTGCCAGGGAGTGG - Intronic
1124796029 15:32780696-32780718 TCTTTCTGGCAACCACAGAAGGG + Intronic
1125579099 15:40773306-40773328 TGTCTCTGGCTGCCCCAGAAAGG - Intronic
1125933733 15:43617596-43617618 AGGCTCTGGCTGCCCCAAAATGG + Exonic
1125946831 15:43717058-43717080 AGGCTCTGGCTGCCCCAAAATGG + Intergenic
1129300980 15:74625331-74625353 TCAGTGTGTCTGCCACAGAAAGG - Intronic
1129313579 15:74728125-74728147 CCACTCTGGGTGCCACAGGATGG - Intergenic
1131424340 15:92333567-92333589 TCCCACTGACTGCCACAGGATGG + Intergenic
1131970420 15:97886942-97886964 TCTCTCTGTCTCCCAAAGAAGGG - Intergenic
1132085825 15:98907625-98907647 TCTCTCTGGCTTCCCCAGGAAGG - Intronic
1132305196 15:100807198-100807220 TCACTCTGGCTGCAACAGGGAGG + Intergenic
1132928536 16:2446212-2446234 TCGCTCTGGCAGGCACAGGCTGG + Intronic
1135325976 16:21526167-21526189 TCACTCAGGCTGCAGCAGAAGGG + Intergenic
1135909878 16:26550135-26550157 GTGCTCTGGCTGACAGAGAAGGG + Intergenic
1136403011 16:30028708-30028730 ACTCAGTGGCTGCCACAGAAGGG + Intronic
1138024456 16:53511764-53511786 TGGCTGTGGCTGTTACAGAAGGG - Intergenic
1139373449 16:66482045-66482067 TCAGCCTTGCTGCCACAGAAGGG + Intronic
1140043817 16:71426321-71426343 TCGCTCTTGCGGCCACTGAGCGG - Intergenic
1141739308 16:85880156-85880178 TCACTCTGGATGCCACAGTGAGG + Intergenic
1142039011 16:87880858-87880880 TCACTCAGGCTGCAGCAGAAGGG + Intergenic
1142057828 16:88011097-88011119 TGGCTCTGAGTGCCACAGAGCGG + Intronic
1142251488 16:88993901-88993923 TGGTTCTGGCTCTCACAGAAGGG - Intergenic
1203141277 16_KI270728v1_random:1768410-1768432 TCTCTCTGGTTGCCATAGATAGG + Intergenic
1143896530 17:10141024-10141046 CCCCTCTGACAGCCACAGAAAGG + Intronic
1143945842 17:10591379-10591401 TCGCTCTTGCTGCCCCAGGCTGG + Intergenic
1144190201 17:12838699-12838721 TCACTCTTGCTGCCCCAGATTGG + Intronic
1144618618 17:16800049-16800071 AGGCTCTGGCTGCCCCAGATTGG + Intronic
1144812244 17:18007934-18007956 TCCCTCTGGCTGCCACATGGAGG - Intronic
1148135178 17:45287356-45287378 TCGGACTGGCTGTCACAAAAGGG + Exonic
1152103872 17:78317891-78317913 TAGCTGTGGCTGCCAGAGGAGGG + Intergenic
1152765362 17:82134476-82134498 TCTTTGTGCCTGCCACAGAAAGG - Intronic
1153322113 18:3783850-3783872 TCGCTGTGGCATCCATAGAAAGG - Intronic
1154411538 18:14144615-14144637 TGGCTCTGGCTGCCTCAGCCTGG + Intergenic
1156185825 18:34661973-34661995 TCCCTCTGACTGCCACACAGAGG - Intronic
1160572283 18:79826272-79826294 CAGCTCTGCCTGCCTCAGAAGGG - Intergenic
1160695698 19:483316-483338 TGGCTCTGGCTGACATAGAGTGG - Intergenic
1161657142 19:5523276-5523298 GCCCTCTGGCTGCCAAAGAGAGG - Intergenic
1162569728 19:11464491-11464513 TGGCTCTGGCTGTGACACAATGG - Intronic
1163005773 19:14395947-14395969 TCGGCCTGACTCCCACAGAACGG - Intronic
927202531 2:20587376-20587398 TTGCTCTCCCTGCCACAGATGGG - Intronic
927202827 2:20589100-20589122 TTGCCCTGGGGGCCACAGAATGG + Intronic
929234056 2:39588241-39588263 TAGCTCTGGCTTCCTAAGAAGGG - Intergenic
929634139 2:43499414-43499436 TCGCCCAGGCTGGAACAGAATGG + Intronic
931067013 2:58598656-58598678 TCGCTCTTGCTGCCCCAGGCTGG + Intergenic
931626967 2:64265196-64265218 TTGCGCTGACTGCCACAGGAGGG - Intergenic
933769492 2:85734092-85734114 GCCCTCTGGCTTCCCCAGAAGGG - Intergenic
935099939 2:99984445-99984467 TGGTCCAGGCTGCCACAGAAGGG - Intronic
938051982 2:128182196-128182218 TCTCTTCGGCTGTCACAGAAAGG - Exonic
938201919 2:129379241-129379263 CCGCTCTGCCTGTCACAAAATGG - Intergenic
939720579 2:145645018-145645040 TTGTTCTGGCTGCTAGAGAAGGG - Intergenic
941181993 2:162270592-162270614 TCCCTTTGGGTGCCCCAGAATGG - Intronic
942119829 2:172765784-172765806 TCGGTCTGGCTGCCACTGTTGGG + Intronic
948123859 2:235550578-235550600 TCGGTCTGGGAGCCACAGACAGG + Intronic
948341654 2:237257502-237257524 CCGGTCTGGCTGCCCCAGAGCGG + Exonic
1168997222 20:2142435-2142457 TGGCTCTGCCTGACAAAGAAAGG + Intronic
1169881980 20:10356873-10356895 CCTCTGTGGTTGCCACAGAAGGG - Intergenic
1171028815 20:21657408-21657430 TCCTTCTGGCAACCACAGAAGGG + Intergenic
1171394447 20:24822744-24822766 TCCCTCCTGCTGCCACAAAATGG + Intergenic
1171511241 20:25686349-25686371 TCGTTCTTGCTGTCACAGGATGG - Intronic
1175986856 20:62768346-62768368 CCCCCCTGGCTGGCACAGAACGG + Intergenic
1176044846 20:63087219-63087241 GAGCTCTGGATGCCACAGACAGG - Intergenic
1176178988 20:63740872-63740894 TCGGTCTGGCTGCCAGGGCAGGG + Intronic
1176519120 21:7811835-7811857 TGTCTCAGGCTTCCACAGAATGG - Intergenic
1176861517 21:14013809-14013831 TGGCTCTGGCTGCCTCAGCCTGG - Intergenic
1177751710 21:25293087-25293109 TCACACTGGCTGCTATAGAAAGG - Intergenic
1178653148 21:34441848-34441870 TGTCTCAGGCTTCCACAGAATGG - Intergenic
1179925365 21:44531236-44531258 GTGCTGTGGCTGCCACACAAAGG + Intronic
1179954410 21:44730217-44730239 TTGCTCTGTCTGCCACATGAGGG - Intergenic
1180028705 21:45185823-45185845 TCACTGTGGGTGCCACAGGAGGG - Intronic
1180107031 21:45625863-45625885 TGGCCCTGGCTGCCACAGCAGGG - Intergenic
1183113309 22:35669242-35669264 TCTTTCTGGCAACCACAGAAGGG + Intergenic
1184661136 22:45966078-45966100 CCCCTCGGGCTGCCAGAGAAGGG - Intronic
949686195 3:6574514-6574536 TATCTCTGGCTGAAACAGAAGGG - Intergenic
949873443 3:8608355-8608377 TCCCTCTGTCTGCCTCTGAATGG + Intergenic
950663499 3:14481447-14481469 TGGCACTGGGAGCCACAGAAGGG + Intronic
951313864 3:21164125-21164147 TCTCTCTCTCTGCCACAGAAGGG - Intergenic
951388308 3:22069895-22069917 TGGTTCTGTCTGCTACAGAATGG + Intronic
952111840 3:30133182-30133204 TCACTGTGGGTGCCACAGATCGG - Intergenic
952296501 3:32067307-32067329 TGGCTCTGGGTTCCACAGAAGGG - Intronic
953996492 3:47523863-47523885 CAGCACTGGCTGCCTCAGAAGGG + Intergenic
961714671 3:128850131-128850153 TCACTCTGGCTGCCTCCAAATGG + Intergenic
964743724 3:159992062-159992084 TTGGTCTAGCTACCACAGAAAGG + Intronic
968155805 3:196379841-196379863 TCATTCTGGCGACCACAGAAGGG - Intronic
968296239 3:197578433-197578455 AGGCTGTGGCTGCCACAGCAGGG + Intergenic
968774089 4:2528823-2528845 TCGCTCTTGTTGCCACAGGCTGG - Intronic
969433807 4:7172422-7172444 TGACTCTGGCTGACTCAGAAAGG + Intergenic
970538900 4:17057857-17057879 TAGATCTGCCTGCCATAGAATGG + Intergenic
971261041 4:25057295-25057317 TTACCCTGTCTGCCACAGAAAGG + Intergenic
975722603 4:77262809-77262831 TCATTCTGCCTACCACAGAAAGG + Intronic
977048022 4:92091173-92091195 TCTTTCTGGCAACCACAGAAGGG - Intergenic
977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG + Intronic
982221239 4:153126977-153126999 TAGATCTGGCTGCCCCAGAAAGG - Intergenic
982991061 4:162274623-162274645 TTTCTCTAGCTGTCACAGAAGGG - Intergenic
984217185 4:176928609-176928631 TCCCTCTGTCTGCCACTGATTGG + Intergenic
985714385 5:1447045-1447067 TGTCAGTGGCTGCCACAGAAGGG + Intergenic
985924673 5:3006522-3006544 TGGCGCTGGCTGCCACTGAGAGG + Intergenic
988725562 5:33922925-33922947 AGGTTCTGACTGCCACAGAAAGG + Intergenic
989566685 5:42908456-42908478 TGGCTCTTGCTGCAACAGTAAGG + Intergenic
992753518 5:79882954-79882976 TGGCTCTGGATGCCATAGGAAGG - Intergenic
998011138 5:138696640-138696662 CCTCATTGGCTGCCACAGAAGGG - Intronic
998895832 5:146799059-146799081 TTGTTCTGGCTGCCCCGGAATGG - Intronic
999382486 5:151131316-151131338 TTATTCTGGCTGCCTCAGAAGGG + Intronic
1000534361 5:162461829-162461851 TGGCTCTGTGTCCCACAGAAAGG + Intergenic
1000989751 5:167899634-167899656 TCACTCTGGTTTCCACAGAGAGG - Intronic
1002968468 6:1990910-1990932 ACTCTCTGGCTGCCAAAAAATGG + Intronic
1005937212 6:30532456-30532478 TTGCTCTCCCTGCCACAGCAAGG - Intergenic
1006990369 6:38210002-38210024 ACGCTGTGGCAGCTACAGAAAGG + Intronic
1007189481 6:40001222-40001244 GCGCCCTGGATGACACAGAAGGG - Intergenic
1007353445 6:41292349-41292371 TCTTTCTGGCAACCACAGAAGGG - Intergenic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1008558375 6:52697803-52697825 TCTCTCTCTCTGCCTCAGAATGG + Intergenic
1011759460 6:90545684-90545706 TAGCTGTGTCTGCCACAGATGGG - Intronic
1015826686 6:137320230-137320252 TCGCTGTGGGTGCCACAGGCTGG - Intergenic
1018017786 6:159727517-159727539 TGGGTCTCGCTGCCACAAAATGG - Intronic
1019442800 7:1055936-1055958 TGGCTTTGGCTGTCACAGAGTGG - Intronic
1019503005 7:1374694-1374716 TCGCTCCCGCTGCAACAGACAGG - Intergenic
1020708362 7:11573734-11573756 TCTCTCTGGCTATCAGAGAAAGG + Intronic
1022534955 7:31092743-31092765 TGGCTGTGGCAGCCACACAATGG - Intronic
1023112271 7:36825839-36825861 TATCTCTGGCTGCTGCAGAAAGG + Intergenic
1023255299 7:38306818-38306840 TCCCACTGGCTGCCAGAAAATGG - Intergenic
1024804216 7:53117767-53117789 TCACTCTGGCTGCCATGGAGAGG + Intergenic
1026271178 7:68838304-68838326 TCACTCTGGCTGCTAGACAATGG + Intergenic
1027857974 7:83537233-83537255 TAGCTCAAGCTACCACAGAATGG - Intronic
1028566582 7:92239521-92239543 TCTCTTTGGATGCCACAGATTGG - Intronic
1029088903 7:98032761-98032783 TCTTTCTGGGTTCCACAGAAGGG - Intergenic
1029374098 7:100167640-100167662 CCCCTCTGGCTGTCACAGATGGG + Intronic
1035718352 8:1771213-1771235 TCTCTCTGGCCACCAAAGAACGG - Exonic
1037435981 8:18863859-18863881 TCCCTCTGGCCGCCAAAGGATGG + Intronic
1043304047 8:78771815-78771837 TAGCAGTGGCTGCAACAGAAAGG - Intronic
1043387789 8:79765504-79765526 CCGCTGTTGCTGCCCCAGAACGG - Exonic
1044638471 8:94352849-94352871 TGGGTCTGCCTGCCAGAGAAAGG + Intergenic
1047954522 8:129963285-129963307 TCGAACTGGCTTCCGCAGAAAGG - Intronic
1049425053 8:142534249-142534271 GATCTCTGGCTGCCACAGGAAGG + Intronic
1051292234 9:15556241-15556263 TCTCTCTGGCTGCCAGTGATGGG + Intronic
1051481346 9:17564673-17564695 TCTCTCTTGCTGTCACAGGAGGG - Intergenic
1052147014 9:25061739-25061761 TCTCACTGGGAGCCACAGAATGG + Intergenic
1053108346 9:35433776-35433798 TCCCTCTGGCTGTTTCAGAAGGG + Intergenic
1059280776 9:113131850-113131872 TCACACTGGCTGCCTCAGACAGG + Intergenic
1060152176 9:121295736-121295758 TCTCTGTGTCTGCCACAGGATGG - Intronic
1060898684 9:127238292-127238314 TGGCTGTGGCTGCCACAGCTAGG + Intronic
1061658983 9:132115543-132115565 TCACACTGGCTCTCACAGAAAGG + Intergenic
1062331622 9:136047431-136047453 TGGCTCTGGATGCCACAGTCTGG - Intronic
1062428346 9:136516288-136516310 ACGCCCTCGCTCCCACAGAAGGG + Intronic
1192908650 X:75579642-75579664 CCACTCTGGCAGCCACAGAGTGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1198051448 X:132956627-132956649 GCGCTGTGGCGGCCACAGAAAGG - Intronic
1200311684 X:155084928-155084950 TCGCTCAGGCTGGCACACAGTGG - Intronic