ID: 1007621238

View in Genome Browser
Species Human (GRCh38)
Location 6:43216060-43216082
Sequence GTATGCTCAAAGAGGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007621234_1007621238 4 Left 1007621234 6:43216033-43216055 CCTGAGGCTGCTTAGGCAAGCGA 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1007621238 6:43216060-43216082 GTATGCTCAAAGAGGGAGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007621238 Original CRISPR GTATGCTCAAAGAGGGAGCT GGG Intronic
904112069 1:28133869-28133891 CTATGATCCAAGAGGGATCTGGG - Intergenic
908490926 1:64643544-64643566 GTGTCCTCAAAGACCGAGCTCGG + Intronic
909939196 1:81590957-81590979 GTATGCTCAAAGAGTATGCCTGG - Intronic
915799697 1:158777123-158777145 GTAAGCACAAAATGGGAGCTGGG + Exonic
916062806 1:161112592-161112614 GTATGTTCAAAGATGAACCTGGG - Intronic
917649960 1:177066580-177066602 GAATGCCCAAAGAGGGAACAGGG - Intronic
919741570 1:200984208-200984230 TGAGGCTCAAAGAGGGAGCCAGG - Intronic
922717183 1:227883850-227883872 GGATGGGCAAACAGGGAGCTAGG - Intergenic
922717189 1:227883872-227883894 GGATGCGCACACAGGGAGCTAGG - Intergenic
923612890 1:235511057-235511079 ATGTGCTCAAGGAGGGAGGTTGG + Intergenic
1063879242 10:10513961-10513983 CTTTGCTCAGAGAGGGATCTAGG - Intergenic
1064391544 10:14946581-14946603 GTATGTCCTAAGAGAGAGCTAGG - Intronic
1065041073 10:21696999-21697021 AGATGCTCAAAGATGAAGCTAGG - Intronic
1071265578 10:83961792-83961814 GTTTACTCAAAGAGGGTCCTTGG - Intergenic
1074097261 10:110324976-110324998 TTGTGCTCAAAGAGGAAGTTTGG + Intergenic
1074322712 10:112417947-112417969 CTATTCTCAAAGAAGGTGCTTGG - Intronic
1076518698 10:131065518-131065540 GTATGCTCCTATAGGTAGCTGGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1080696773 11:34609646-34609668 GTATTCTCAAAAAGGGTGATAGG - Intergenic
1083649507 11:64193390-64193412 GGATACTCAAACAGGGAGGTGGG - Intronic
1084757749 11:71250483-71250505 GTCTGCTCTAAGAGGGGGATTGG - Intronic
1085625221 11:78066622-78066644 GTGGGCTCAAAGTGGGAACTGGG + Intronic
1086080358 11:82897641-82897663 GGTTGCTAAAAGTGGGAGCTGGG + Intronic
1088790642 11:113223288-113223310 GTATCCTCAAAGGGAGAACTGGG + Intronic
1089860246 11:121583598-121583620 GGAGGCTCAGGGAGGGAGCTGGG - Intronic
1091190944 11:133694905-133694927 GAAAGCTCAAAGAGGGCTCTCGG + Intergenic
1092834913 12:12478218-12478240 GTATGCCAGAAGAGGCAGCTGGG + Intronic
1093050214 12:14495652-14495674 GTATCCTCAACCAAGGAGCTGGG + Intronic
1099296731 12:80837395-80837417 GTATCCTTATAGAGGGAGGTGGG + Intronic
1101511569 12:105397724-105397746 AAATGCTCAAAGAGAGAGCAAGG - Intergenic
1102406257 12:112676724-112676746 GTGTGCTCTAAGAGGGAGACGGG - Intronic
1102579260 12:113875844-113875866 GTGTGCACAGAGAGGCAGCTGGG - Intronic
1106463733 13:29994634-29994656 GTGGGCTCATAGAGGGAACTGGG - Intergenic
1109656900 13:65404258-65404280 GTCTGCTAAAAGATGGAGCCAGG - Intergenic
1113974799 13:114219645-114219667 GTAGGCTCCAAGACAGAGCTGGG + Intergenic
1114166858 14:20227647-20227669 CTAAGCTCAAAGAAGCAGCTCGG + Intergenic
1115698570 14:35925805-35925827 GTATAGTGAAACAGGGAGCTTGG + Intronic
1116805971 14:49494205-49494227 GTATGTTTAAAGAGTAAGCTTGG - Intergenic
1117447292 14:55816333-55816355 GAGGGCTCACAGAGGGAGCTGGG - Intergenic
1120060357 14:79975536-79975558 GTGTGCTCAGAGTGGGAGCTCGG + Intergenic
1121491833 14:94366619-94366641 GGATCCTCAACCAGGGAGCTGGG + Intergenic
1122676413 14:103418107-103418129 AAATGATCAAAGAGTGAGCTGGG - Intronic
1124393795 15:29283003-29283025 CCATGCTCACACAGGGAGCTGGG + Intronic
1125003706 15:34795771-34795793 GGATGGCCAAATAGGGAGCTGGG + Exonic
1128620133 15:69141768-69141790 GTATGCACAAATAGCTAGCTTGG - Intergenic
1129160875 15:73747035-73747057 GAAAGGTCAAAGAGGGAGCAGGG - Intronic
1130647395 15:85741130-85741152 TCCTGCTCAATGAGGGAGCTCGG - Exonic
1135191184 16:20356185-20356207 GTGTGCTCAGAGAGGTAGGTGGG - Intronic
1136007713 16:27342307-27342329 GTTTGCCCCAAGAGTGAGCTGGG + Intronic
1138876273 16:60954223-60954245 GTGTTCTCAAAGTGGGACCTTGG + Intergenic
1141323958 16:83038057-83038079 GCATGCTCAGAGAGGTAGGTGGG + Intronic
1142762923 17:2051866-2051888 GGATCCTCTATGAGGGAGCTGGG + Intergenic
1143324992 17:6092876-6092898 GCCTGCCCAAAGAGGCAGCTAGG - Intronic
1146117548 17:30154845-30154867 GTATGCTCAAAGAAGCATTTTGG - Intronic
1149125570 17:53226677-53226699 TTATGTCCAAAGAGAGAGCTTGG - Intergenic
1150247578 17:63687962-63687984 ATATGCTCAAAGATAAAGCTAGG - Intronic
1151407638 17:73899782-73899804 TTATTTTTAAAGAGGGAGCTGGG - Intergenic
1153124770 18:1777801-1777823 GTAAGAACAAAGAGGAAGCTAGG + Intergenic
1157390164 18:47295157-47295179 GTGTGCAGAAAGAGGGAGATGGG - Intergenic
1157534440 18:48448093-48448115 GCATCCTGGAAGAGGGAGCTGGG - Intergenic
1161267271 19:3370087-3370109 GTAGGTTCTTAGAGGGAGCTTGG + Intronic
1165382939 19:35494115-35494137 GTATTCTCAGTGAGGGAGCTAGG - Intronic
1165677191 19:37736749-37736771 TTATGCTCAGAAAAGGAGCTGGG + Intronic
1166912966 19:46173957-46173979 GTCTGGGCAAAGATGGAGCTGGG + Intergenic
1202714643 1_KI270714v1_random:35533-35555 GGAGGCTCACAGATGGAGCTGGG + Intergenic
929788858 2:45009758-45009780 GGATGCCCAAAGAGGGAGGGAGG + Intergenic
930252599 2:49052282-49052304 ATAAGATCAAAGAGGAAGCTGGG - Intronic
931051036 2:58414888-58414910 GTTTGCTAAAAAAGGGAGCTAGG + Intergenic
933465018 2:82641060-82641082 AAATGCTCAGAGAGGGGGCTGGG + Intergenic
942242909 2:173980134-173980156 GGATGCTCACAGAGGATGCTGGG - Intergenic
1169730654 20:8782271-8782293 GTCTGCTCACAGAGGAAGGTTGG + Intronic
1172666680 20:36605259-36605281 GTGTGCCAAAAGAGGGTGCTGGG + Intronic
1173262212 20:41446641-41446663 CTATCCCCACAGAGGGAGCTGGG - Intronic
1173892102 20:46520679-46520701 GCATCCTCAAACAGAGAGCTGGG - Intergenic
1174081788 20:47975099-47975121 GAATCCTGAAAGAGGAAGCTTGG + Intergenic
1175737812 20:61399523-61399545 GGGTGGTCATAGAGGGAGCTGGG - Intronic
1182413943 22:30209114-30209136 GTGTGATCCAAGAGGAAGCTTGG - Intergenic
1182975487 22:34620289-34620311 GTTTGCTCTTAGTGGGAGCTCGG + Intergenic
1184075214 22:42172697-42172719 GTGGGCTCAAGGAGGGAGGTAGG + Intronic
1184799186 22:46749826-46749848 TGATGCTCAGAGAGGGGGCTGGG + Intergenic
1185102568 22:48849564-48849586 GTGTGCAGAGAGAGGGAGCTGGG + Intronic
953722035 3:45364531-45364553 CAAGGCTCAAGGAGGGAGCTGGG - Intergenic
953773545 3:45796838-45796860 GTCAGCTCCAAGACGGAGCTGGG - Intergenic
954383054 3:50229863-50229885 CTATGGTAAAAGAGGCAGCTGGG - Intronic
962328024 3:134451898-134451920 ATGTGCTCACAGAGGGGGCTGGG + Intergenic
962671869 3:137716444-137716466 GTCTGCTGAGAGAGGGAACTTGG + Intergenic
967138268 3:186530883-186530905 GAATGCTCAAGTAGGGAGGTGGG - Intergenic
970485155 4:16517635-16517657 TTATATTCAAAGAGGGATCTCGG - Intronic
977671991 4:99705806-99705828 GTATCCTCAAAAAGTGAGTTGGG - Intergenic
980937999 4:139244444-139244466 TTATGCTCAAAGAGGGCTCCTGG - Intergenic
983839703 4:172441829-172441851 GTATGGTGTATGAGGGAGCTAGG + Intronic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
986997299 5:13621786-13621808 AGAAGCTCAGAGAGGGAGCTTGG - Intergenic
988945690 5:36195800-36195822 GTATGCTTGAGGAGGGAGCAGGG - Intronic
995640143 5:114247006-114247028 GTAGGATCAAAGAGTGACCTGGG + Intergenic
997278063 5:132615040-132615062 GATTTCTCAAAGAGGGAGCTGGG - Intronic
998779203 5:145637714-145637736 GTGTGTTCAAAGAGGCAGTTAGG - Intronic
1000044771 5:157513062-157513084 GACTGCTCTAAGTGGGAGCTGGG - Intronic
1005618137 6:27594765-27594787 GGATTCTTAAAGATGGAGCTTGG + Intergenic
1007360639 6:41353013-41353035 GAATCCTCAGAGAGGGTGCTGGG - Intergenic
1007621238 6:43216060-43216082 GTATGCTCAAAGAGGGAGCTGGG + Intronic
1012361491 6:98387514-98387536 GAATACTCAAAGAGGGAGGATGG - Intergenic
1014095316 6:117453514-117453536 TTAGGCTCAAGGAGGGGGCTGGG - Intronic
1018264871 6:162013523-162013545 ATATTCTCAAAGACGAAGCTAGG + Intronic
1023183851 7:37513411-37513433 CGATGCTGAAAGAGAGAGCTGGG - Intergenic
1024732504 7:52268588-52268610 GTATTGTCATATAGGGAGCTGGG + Intergenic
1026701528 7:72650684-72650706 GTGTGCTCTAACAGGCAGCTAGG - Intronic
1027484521 7:78743923-78743945 GTGTGATCAAAGAGGAAGTTAGG - Intronic
1041787718 8:61653785-61653807 GTATGCTTAAAAAGTGAGGTAGG + Intronic
1047000543 8:120568557-120568579 GGATTCTGACAGAGGGAGCTGGG + Intronic
1048294501 8:133204548-133204570 GAATATTCAAAGAGGGATCTAGG + Intronic
1050122486 9:2321660-2321682 TTATGGTCAAAGAGGGAAGTAGG - Intergenic
1050328475 9:4521331-4521353 TTATGCTCAAAAATGGAGTTTGG + Intronic
1052056323 9:23911524-23911546 GTATGGTCAAAGAAGGAGAGAGG - Intergenic
1057818658 9:98314712-98314734 GCAGACTCAAAGAGAGAGCTTGG - Intronic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1061016806 9:127985909-127985931 GTATGTTTAGAAAGGGAGCTGGG + Intergenic
1061059020 9:128241217-128241239 GGATGCTCAGAGAAGAAGCTGGG + Intronic
1061686351 9:132282885-132282907 GTTTGCTCAAAGAGTGAACTAGG + Intronic
1186444386 X:9614258-9614280 ATATACCCAAAGTGGGAGCTTGG - Intronic
1189827701 X:44936655-44936677 ATATGCACAAAGAGAGATCTTGG + Intronic
1192850030 X:74945117-74945139 GTCTGCTGAAAGAGTGACCTAGG - Intergenic
1193460207 X:81782032-81782054 TTATGCTCAAAGTTGGAGGTGGG + Intergenic
1195680598 X:107543286-107543308 AGATGCTCAGAGAGGCAGCTGGG - Intronic