ID: 1007622229

View in Genome Browser
Species Human (GRCh38)
Location 6:43222294-43222316
Sequence CCTAGCAAGGATACGTTGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007622229_1007622239 27 Left 1007622229 6:43222294-43222316 CCTCCCAACGTATCCTTGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1007622239 6:43222344-43222366 GGTTTCAGGACTATAATGAGAGG 0: 1
1: 0
2: 0
3: 6
4: 87
1007622229_1007622235 -2 Left 1007622229 6:43222294-43222316 CCTCCCAACGTATCCTTGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1007622235 6:43222315-43222337 GGTAAGCAAGGCAGCTCGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 103
1007622229_1007622237 13 Left 1007622229 6:43222294-43222316 CCTCCCAACGTATCCTTGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1007622237 6:43222330-43222352 TCGCCAGGAGAAGCGGTTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1007622229_1007622236 6 Left 1007622229 6:43222294-43222316 CCTCCCAACGTATCCTTGCTAGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1007622236 6:43222323-43222345 AGGCAGCTCGCCAGGAGAAGCGG 0: 1
1: 0
2: 1
3: 21
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007622229 Original CRISPR CCTAGCAAGGATACGTTGGG AGG (reversed) Exonic
917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG + Intronic
1063556130 10:7081399-7081421 CCTAGGAAGGATGAGTGGGGAGG - Intergenic
1072347392 10:94521492-94521514 CCAAGAAAGGAGACGTTGTGGGG - Intronic
1078860386 11:15241082-15241104 CCTAGCAAAAAGAAGTTGGGTGG - Intronic
1089077677 11:115751389-115751411 CCTAGGAAGGATGAGGTGGGAGG - Intergenic
1094023810 12:25941681-25941703 CCCAGCAAGGATACTTCGGATGG - Intergenic
1095781451 12:46064783-46064805 CCTAGGAAGGCTAAGGTGGGAGG + Intergenic
1097023535 12:56037060-56037082 CCTATCAGGGATATTTTGGGGGG + Exonic
1101058787 12:100948999-100949021 CCTAGCAAAGAAAGGTGGGGTGG + Intronic
1104544847 12:129701355-129701377 CCTTGGAAGGATATATTGGGAGG + Intronic
1111911116 13:94313105-94313127 CCGAGACAGAATACGTTGGGTGG - Intronic
1116891129 14:50269573-50269595 CCTAGCAAGGATACTTAGTAAGG + Intronic
1119620313 14:76126806-76126828 TGTACCAAGGATAGGTTGGGGGG + Intergenic
1120900863 14:89574416-89574438 CCTGGCAGGGATACGCTTGGTGG + Intronic
1121357239 14:93225817-93225839 TCTAGCAAGGATACTGTAGGAGG - Intronic
1136365949 16:29809411-29809433 GCTACCAAGGATACCGTGGGAGG + Intronic
1151565437 17:74894724-74894746 CCTAGGAAAGAGAAGTTGGGTGG + Intergenic
1159906459 18:74097121-74097143 CCTAGGAAGGATCCTTGGGGAGG + Intronic
1165479032 19:36050899-36050921 CTTAGTAAAGATTCGTTGGGTGG - Intronic
1167104436 19:47421903-47421925 CCCAGGGAGGATACGGTGGGGGG - Intergenic
945188782 2:207166042-207166064 ACTAGCAAGGATGGGGTGGGGGG - Intronic
947028829 2:225769691-225769713 CCTAGCAAGTAAGTGTTGGGAGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1175029171 20:55935084-55935106 GCTGGCAAGGATAAGATGGGAGG - Intergenic
1182501152 22:30748539-30748561 CCTAGCAAGGATCTGTTGTGGGG + Intronic
1183313860 22:37126754-37126776 CCTAGGAAAGATACGTGGAGGGG + Exonic
950610885 3:14125798-14125820 CCTAGCAAGGATTTGGTTGGAGG + Intronic
954374641 3:50187920-50187942 CCTGGTAAGGAGGCGTTGGGGGG - Exonic
972963610 4:44484086-44484108 CCAAGAAAGGATACCTTAGGGGG - Intergenic
980174153 4:129324736-129324758 CCCTGCAAGGTTACCTTGGGTGG - Intergenic
981206239 4:142043864-142043886 CCTAGCATGAATAAGTAGGGTGG + Intronic
989444441 5:41510796-41510818 CCTAGGAAGGATAAGACGGGAGG - Intergenic
998369078 5:141649719-141649741 CCCAGCAAGGACACTGTGGGTGG - Intronic
1000015541 5:157272370-157272392 GCTAACAAGGAGACTTTGGGTGG + Intronic
1007352189 6:41282072-41282094 CCTCCCAAGGATGCGTTTGGTGG - Intronic
1007622229 6:43222294-43222316 CCTAGCAAGGATACGTTGGGAGG - Exonic
1019745705 7:2699536-2699558 CCCAGCAAGCATATGTTTGGGGG - Intronic
1026505221 7:70976803-70976825 CCATGCAAGGTGACGTTGGGTGG - Intergenic
1036095795 8:5724311-5724333 CCAAGAAAGGATACGTTGGAAGG + Intergenic
1037202223 8:16269748-16269770 CCTAGCAAGGCTATGTTGAAAGG - Intronic
1041627602 8:60048346-60048368 GTTAGCAAGGATATGTTGGGTGG - Intergenic
1046733877 8:117755094-117755116 CCTAGCCAAGATACAATGGGTGG + Intergenic
1050173276 9:2844256-2844278 CCTTGCAAGAATCCGTCGGGCGG + Intergenic
1055507479 9:76963243-76963265 CCTAGAAATGATAAGTTGGAAGG + Intergenic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic