ID: 1007623042

View in Genome Browser
Species Human (GRCh38)
Location 6:43226393-43226415
Sequence CCCCTGTGTTGAGGGAAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007623031_1007623042 22 Left 1007623031 6:43226348-43226370 CCAGGTCCTGCTCATGGATGAGC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1007623035_1007623042 -8 Left 1007623035 6:43226378-43226400 CCCCAGCAGCCTCTTCCCCTGTG 0: 1
1: 0
2: 3
3: 95
4: 632
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1007623034_1007623042 -7 Left 1007623034 6:43226377-43226399 CCCCCAGCAGCCTCTTCCCCTGT 0: 1
1: 0
2: 7
3: 102
4: 616
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1007623030_1007623042 27 Left 1007623030 6:43226343-43226365 CCACTCCAGGTCCTGCTCATGGA 0: 1
1: 0
2: 1
3: 25
4: 296
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1007623033_1007623042 0 Left 1007623033 6:43226370-43226392 CCTGTCACCCCCAGCAGCCTCTT 0: 1
1: 0
2: 3
3: 52
4: 421
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1007623037_1007623042 -10 Left 1007623037 6:43226380-43226402 CCAGCAGCCTCTTCCCCTGTGTT 0: 1
1: 0
2: 5
3: 44
4: 483
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1007623036_1007623042 -9 Left 1007623036 6:43226379-43226401 CCCAGCAGCCTCTTCCCCTGTGT 0: 1
1: 1
2: 3
3: 30
4: 394
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215
1007623032_1007623042 16 Left 1007623032 6:43226354-43226376 CCTGCTCATGGATGAGCCTGTCA 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007623042 Original CRISPR CCCCTGTGTTGAGGGAAAGC TGG Exonic
902320990 1:15665811-15665833 CACCTGTGGTGAGGGTGAGCAGG + Exonic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902618730 1:17638302-17638324 ACCCAGTGTGGAGGGGAAGCTGG + Intronic
903421959 1:23224513-23224535 CCCCTTTGTTGCGGGAAGTCAGG - Intergenic
905919243 1:41708427-41708449 CCCCTTGGTTGTGAGAAAGCAGG - Intronic
905995618 1:42378903-42378925 CTCCTGTTTTCAGGAAAAGCTGG - Intergenic
906237639 1:44221480-44221502 CCCCTCTGGTGAGGGAGAGGAGG + Exonic
906277907 1:44531642-44531664 CCCCTGTGATGAGAGAGAACAGG + Intronic
908511317 1:64852064-64852086 GCCCTGTCCTGAGGGATAGCAGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912942302 1:114056103-114056125 TACCTGTGTTGAGGGGAACCTGG - Intergenic
913220604 1:116657419-116657441 GCCCTGTGGTTAGGGAAAGTGGG - Intronic
915125297 1:153659383-153659405 CTCTTGTTCTGAGGGAAAGCAGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916262006 1:162851516-162851538 CCTCAGTGTTGGGGGAAAGTTGG - Intronic
916290404 1:163159485-163159507 CCCCTCTGTTGCGGGAAGTCAGG - Intronic
916464263 1:165058109-165058131 CACCTGTGTTGTGAGAGAGCTGG - Intergenic
917838861 1:178961484-178961506 CCCCTGGGTGGAGAGCAAGCAGG - Intergenic
918453285 1:184681569-184681591 TTCCTGTGTTGAGGGAAGTCAGG - Intergenic
918612728 1:186511673-186511695 CCCCTGTGTTGCGGGTCTGCTGG + Intergenic
919177888 1:194042516-194042538 CCCCCTTTCTGAGGGAAAGCTGG - Intergenic
919482631 1:198108353-198108375 CCTCTGTGTTATGAGAAAGCAGG + Intergenic
919633395 1:199980866-199980888 CCCATGTGTAGTGGGAAAACGGG - Intergenic
919920157 1:202162544-202162566 CCCCTGTGCTTAGGGATACCTGG + Intergenic
920631734 1:207659288-207659310 CCCCTCTGCAGAGGGCAAGCCGG + Intronic
922055337 1:222037171-222037193 CCACAGGGTTGAGGAAAAGCGGG + Intergenic
923907810 1:238404666-238404688 CTCCTGTGTTCAGTGAGAGCAGG - Intergenic
1063999879 10:11654740-11654762 CCTCTGTGCTGAGAGAAGGCAGG - Intergenic
1066686181 10:37983697-37983719 CACCTGTGTTGTGGGAAGTCAGG - Intergenic
1067296859 10:44979663-44979685 CCCCTGTGGTGAGGGCGCGCCGG + Intronic
1073470841 10:103721165-103721187 CACCTGTGTTCATGGAAGGCTGG - Intronic
1073989819 10:109250196-109250218 CCCAAGTGTTGAGAGAAAACAGG + Intergenic
1074065100 10:110007291-110007313 CCCCTATGTGGAGGTGAAGCAGG + Intronic
1074141876 10:110680401-110680423 CCCCTGAGATGGGGGAAACCAGG - Intronic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077588394 11:3472359-3472381 CCCATTTGTTGAGGGAAGTCAGG - Intergenic
1078024211 11:7679424-7679446 CCCATGTGTAGAGGGAAACAGGG + Intergenic
1078862275 11:15260222-15260244 ATCCTGTGTCCAGGGAAAGCAGG - Intergenic
1079364382 11:19796650-19796672 CCTCTCTGTGGAGGGAAGGCTGG + Intronic
1079585938 11:22127005-22127027 CCCTGGTGTTGTGGGAAATCAGG + Intergenic
1080139423 11:28898254-28898276 CCCCTAGGTTTAGGGAAACCTGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081734284 11:45392408-45392430 GCCCGGAGGTGAGGGAAAGCAGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1084367559 11:68712571-68712593 CCTTTGTGTTGAGGGAAAGGAGG - Intronic
1086841997 11:91697734-91697756 CCCCTGAGTTCAGGGCAAGAAGG + Intergenic
1087812826 11:102626557-102626579 CCCATGTGTTGAGGGAGGGAGGG + Intergenic
1091448513 12:558582-558604 GCACTGTGTGGAGGGAAAGATGG + Exonic
1092800837 12:12164533-12164555 CCCCTGTGCTGAGGAAAACGGGG - Exonic
1094249648 12:28344888-28344910 ACACTGAGTTGAGGGGAAGCTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096688979 12:53307859-53307881 CCCCTTTGTTGAAGGAAGGATGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097223815 12:57465277-57465299 ACCCTGAGCTGAGGGAAATCAGG - Intronic
1099601967 12:84751029-84751051 CCCATTTGTTTAGGGAAAGTAGG - Intergenic
1103013556 12:117476510-117476532 CCTCTGTGTCGGGGGACAGCTGG + Exonic
1104179723 12:126367381-126367403 ACCCTGTGTTCAGGTGAAGCTGG - Intergenic
1105804553 13:23945686-23945708 CCCATGGGTTGCGGGGAAGCCGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109156248 13:58913640-58913662 TCCCTTTGTTCAGAGAAAGCAGG - Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1110034081 13:70656684-70656706 GCCCTGTTTTGAGAGAAAGCTGG + Intergenic
1110596979 13:77329741-77329763 CCCTTGTGTTTGGGGAAAGAGGG + Intergenic
1111468364 13:88645891-88645913 CCCATGTGTTGTGGGAAGTCAGG - Intergenic
1113377813 13:109781740-109781762 CCACTGTGTTAAGGGACAGGGGG + Intronic
1115347132 14:32354935-32354957 CCCCTGGGCTGGGAGAAAGCAGG - Intronic
1116691155 14:48107590-48107612 ACCCTGTGGAGAGAGAAAGCAGG - Intergenic
1119730542 14:76948286-76948308 CCCCGGGGCAGAGGGAAAGCGGG + Intergenic
1120045598 14:79802256-79802278 CCCTAGTATTGAGTGAAAGCTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121320574 14:92989425-92989447 TCCCTGTCTTCAGGGACAGCAGG - Intronic
1122087321 14:99316873-99316895 CCCCTGGGTTCGGGGAAAGAGGG + Intergenic
1122599396 14:102913772-102913794 CCCCTGAGCTGAGGGGAGGCAGG - Intergenic
1122632955 14:103115923-103115945 GCCCTGAGTCCAGGGAAAGCAGG - Intergenic
1127147429 15:56038945-56038967 CCCCAGTGTTGGGGGAAGGTGGG - Intergenic
1127900764 15:63339221-63339243 GCCCTGCGTGGAGGGAAACCTGG + Intronic
1132057280 15:98661909-98661931 CCCCAGTGTTGTGGGGAAGGAGG - Intronic
1132691378 16:1183274-1183296 CCTCTGTGCTGGGGGAAAACTGG - Intronic
1132859559 16:2063307-2063329 CTCCTGTGTTGGGTGAAAACCGG - Intronic
1132929838 16:2453469-2453491 CCCCTGTGCTGAGGAAAGTCGGG - Exonic
1133999229 16:10769900-10769922 CCCCAGAGTGGAGGGAAAACAGG - Intronic
1135168477 16:20162350-20162372 TCCCTGGGTTTAGGGAAAGTGGG - Intergenic
1136867449 16:33769019-33769041 CCCCTGGGGTCAGGGTAAGCTGG + Intergenic
1139696975 16:68682067-68682089 CCCCTGCGTGTAGGGAAAGCAGG + Intronic
1203104709 16_KI270728v1_random:1347184-1347206 CCCCTGGGGTCAGGGTAAGCTGG - Intergenic
1203128805 16_KI270728v1_random:1615184-1615206 CCCCTGGGGTCAGGGTAAGCTGG + Intergenic
1142899739 17:3004539-3004561 CCTCTGTGCAGAGGGAAGGCGGG + Intronic
1143001579 17:3798270-3798292 CCCCTGTGTGAAGAGAAGGCAGG - Intronic
1143370020 17:6433827-6433849 CTGCTGTGTTTCGGGAAAGCTGG - Intronic
1143986479 17:10919065-10919087 CACCTGTGATGAAAGAAAGCTGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1147341541 17:39755550-39755572 TGTGTGTGTTGAGGGAAAGCAGG - Intergenic
1147588661 17:41667225-41667247 CCCTTGGGTTGAGTGAAACCGGG + Intergenic
1147911473 17:43858580-43858602 GCCCCTTGTTGAGGGAAAGATGG + Intronic
1147945699 17:44078958-44078980 CCCCTGTTGTGAGGGATATCTGG - Intronic
1148134372 17:45282856-45282878 CCACTGCCTTGAGGGAAAGCAGG + Intronic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1150265667 17:63831016-63831038 CCCCTGTGTGGAGGCCGAGCTGG - Exonic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152040691 17:77900774-77900796 CCCCAGGGTTCAGGGATAGCTGG + Intergenic
1155201859 18:23524746-23524768 CCCCAGGGTGGATGGAAAGCCGG + Intronic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155922294 18:31615446-31615468 CACCTCTGTGGAGGGAAAGTTGG - Intergenic
1155999311 18:32367347-32367369 CCTCTGTGAGGAGGAAAAGCAGG - Intronic
1157564658 18:48671719-48671741 CCCCAGGGTTGAGGGAAAGTAGG - Intronic
1157698653 18:49745320-49745342 CTGCTGTGTGGAGGGAAGGCAGG + Intergenic
1158591558 18:58782888-58782910 CCTCTGTGTTTGTGGAAAGCTGG + Intergenic
1158673381 18:59497153-59497175 CCCCTGTATTGAGCGAAGACAGG - Intronic
1158713454 18:59857739-59857761 CCCCTGTGATGAGGGGAAAGGGG - Intergenic
1159721505 18:71897627-71897649 CCCATGTGTTGAGGGAAGGAGGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163979346 19:20884208-20884230 CCACTGTGGTGAGTGAAAGGTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164573834 19:29393698-29393720 CCCCTCTGTTCAGGGAATGTAGG - Intergenic
1165707424 19:37986494-37986516 CCCCTTTGCTGGGGAAAAGCAGG + Intronic
1166733852 19:45073134-45073156 TTCCTGTCCTGAGGGAAAGCCGG - Intronic
925246229 2:2385912-2385934 CACCTGTATTAAGGGAATGCTGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927597867 2:24413080-24413102 CACCAGTGTTGAGGCAAAGGGGG - Intergenic
929172390 2:38945000-38945022 CCTCTCTGTTGAGAGAAAGCAGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
937678960 2:124623710-124623732 CCACTGTCTTTAGGGACAGCAGG + Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938293166 2:130161046-130161068 CCCCTGTGTCGGGGGGAGGCAGG - Intronic
938463385 2:131511919-131511941 CCCCTGTGTCGGGGGGAGGCAGG + Intergenic
943623803 2:190178215-190178237 CCCCTGGGATTCGGGAAAGCTGG - Intronic
944741843 2:202620127-202620149 ACCCTGGGTTGAGGGAACGTGGG + Intergenic
946688966 2:222296913-222296935 CCCCTGTGTTGGGGAAGACCGGG - Intronic
948014954 2:234680831-234680853 ACCCTGTCTTGAGGGCAGGCTGG - Intergenic
948541540 2:238694626-238694648 CTCCTTTGTTCAGGGAAGGCTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948829211 2:240589588-240589610 CTGCTGTGTTGGGGGAAGGCAGG + Intronic
948916682 2:241037850-241037872 CCCCTGCCTTCAGGGAAAGGGGG + Intronic
1169089290 20:2848197-2848219 CCCTTGTGGTGAGTGAATGCAGG - Intronic
1169500740 20:6158127-6158149 CCCCTGTCCTGTGGGAAAGATGG + Intergenic
1173239782 20:41284345-41284367 GCTCTGTGGTGAGAGAAAGCTGG - Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1174158370 20:48532254-48532276 CTTCTCTGTTGAGGGACAGCAGG - Intergenic
1174159234 20:48538997-48539019 CCCCTGTGTTCATGGAATGCAGG - Intergenic
1174330319 20:49812643-49812665 GCCCTGTGATGGGGAAAAGCCGG + Intergenic
1174953455 20:55068066-55068088 CCCAAGTGTTGAGGAAAAGCAGG - Intergenic
1180079139 21:45478332-45478354 CCCCGGTGAAGACGGAAAGCCGG + Exonic
1180180475 21:46116631-46116653 ACCCTGTGTAGGAGGAAAGCCGG - Exonic
1181190836 22:21138405-21138427 GCCCTGTGGTTAGGGAAGGCGGG + Intergenic
1181477233 22:23176235-23176257 TCCCTCTGTTGGGGAAAAGCTGG + Intergenic
1181562666 22:23714853-23714875 GCCCTGTGTAGAGGGATAGGTGG - Intergenic
1203272270 22_KI270734v1_random:63526-63548 GCCCTGTGGTTAGGGAAGGCGGG - Intergenic
949950005 3:9221206-9221228 GAAATGTGTTGAGGGAAAGCAGG - Intronic
949979282 3:9490771-9490793 TCCCAGTGTTGGGGGAAAGGAGG + Intergenic
950668795 3:14512982-14513004 CTCCTCTGTTGAGAGGAAGCAGG - Intronic
950887347 3:16373581-16373603 CCCAGGTCTTGAGGGTAAGCAGG + Intronic
951000438 3:17553376-17553398 GCAATGTGTGGAGGGAAAGCTGG - Intronic
951705460 3:25540029-25540051 CCCCTGTGTAGAACCAAAGCTGG - Intronic
954845376 3:53551325-53551347 CCTCTGGGTGGAGGGCAAGCCGG - Intronic
956749601 3:72335542-72335564 CCTGCGGGTTGAGGGAAAGCTGG + Intergenic
956771159 3:72527163-72527185 CCCTTGGTTTGGGGGAAAGCTGG - Intergenic
957756193 3:84491528-84491550 CCATTGTGTTGCGGGAAATCAGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960988368 3:123295048-123295070 CCCCTGAGTTTGGGGAAACCAGG - Intronic
962438112 3:135384937-135384959 CCCCTGTGATGAGGGCATTCAGG - Intergenic
964157203 3:153600570-153600592 CCCCTGGGCTGAAGGAATGCTGG - Intergenic
964880482 3:161417889-161417911 CCCCTTTGTTGCGGGAAGTCAGG - Intergenic
965737847 3:171840782-171840804 CCCCTGGGTTGAGGAGAAGGTGG + Intergenic
967917086 3:194586791-194586813 CCTCTGTCTTGAGGGAACTCTGG - Intergenic
968044714 3:195617657-195617679 CCCCTGTCTAGAGGGAGATCGGG - Intergenic
968060501 3:195723709-195723731 CCCCTGTCTAGAGGGAGATCGGG - Intronic
968463540 4:737871-737893 CTCCTCTGTTGTGGGGAAGCTGG - Intronic
968613618 4:1567797-1567819 CCCATGTGTGGAGGGGAGGCTGG - Intergenic
970919666 4:21378700-21378722 CCCTTGTGTTAAGGGATAGCTGG - Intronic
971379431 4:26083482-26083504 CCCCGGTGTGGAGGTAAAGACGG + Intergenic
981841858 4:149122278-149122300 GCTCTGAGCTGAGGGAAAGCAGG - Intergenic
982316857 4:154040821-154040843 CCCCTGTGTGTGGGAAAAGCCGG + Intergenic
984058477 4:174960862-174960884 CTCCTGTCTTCAGGGAAAACTGG - Intronic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987076332 5:14385415-14385437 CGCCTGTGTTTAGGTAGAGCTGG - Intronic
987446314 5:18023943-18023965 CACCTGTGTAGAGAGAAATCAGG - Intergenic
990020822 5:51125268-51125290 CCGCTGAGTTGAGGCAAACCAGG - Intergenic
991291140 5:65035020-65035042 CCCCTGTGATGAGAGACAGCAGG - Intergenic
991969571 5:72126113-72126135 TCCCTGTGTTGAGGGAAGCAGGG + Intronic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
999238024 5:150111425-150111447 CCCCTGTGCAGAGGGCAGGCAGG - Intronic
999324724 5:150636775-150636797 CCCCTGTGCAGAGAGAACGCGGG + Intronic
1003109367 6:3240747-3240769 CCCCAGTGTTGGGGGAAAGGAGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004177124 6:13349665-13349687 CCCCTGTGATAAGGGACAGGTGG + Intergenic
1004930191 6:20455655-20455677 GCCCTGTCTTGAGGGAAAACAGG - Intronic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1008245762 6:49171018-49171040 TCCCTGTGGTGAAGGAAAGAGGG + Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1012234094 6:96792488-96792510 CCCCAGTGTTGAGTCAGAGCTGG - Intergenic
1013388180 6:109653969-109653991 GCCCTGTGTTCCTGGAAAGCAGG + Intronic
1013391364 6:109689441-109689463 ACCCTGTGTTCAGGGAGAGTAGG - Intronic
1018570435 6:165204140-165204162 CCCATGTGTTGAGGGAGGGAGGG - Intergenic
1019762767 7:2825852-2825874 CCCCTGGGTGGTGGGAATGCTGG - Intronic
1021468568 7:20974168-20974190 CCCCTGAGTAGAAAGAAAGCAGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023604095 7:41911874-41911896 CCCATGTGTTGCGTGCAAGCTGG + Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024918069 7:54525726-54525748 CTCCTGGGTCGAGGGAAAGGAGG + Intergenic
1024979180 7:55143331-55143353 CCACTGTGTTGAGGGCAATGAGG - Exonic
1026595860 7:71733496-71733518 CCCCTGAAATGAAGGAAAGCAGG + Intergenic
1029943049 7:104500676-104500698 CCTCTGTGGCGAGGGAAAGGTGG - Intronic
1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG + Intergenic
1034460038 7:151193103-151193125 CCCCTGTGGTGGGGGAATGAAGG - Intronic
1035660591 8:1344602-1344624 CCTCTGTGTTCAGGAAAACCCGG + Intergenic
1035757362 8:2044203-2044225 CCCCTGTGGTGAGGTGCAGCTGG + Intergenic
1042916260 8:73878664-73878686 GCCCTGAGCTGAGGGAAAACAGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043956251 8:86363304-86363326 TACCTGTTTTTAGGGAAAGCTGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1048289732 8:133171577-133171599 TCCCTGAGTTGAGGGGAATCAGG - Intergenic
1051594565 9:18811350-18811372 CCCCAGTGGGGAGGGAAAGGTGG - Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1055796052 9:79976036-79976058 GCCCTGAGTTAATGGAAAGCTGG + Intergenic
1057213004 9:93210688-93210710 CCTCTGAGTAGAGGGAAAGATGG + Intronic
1057698691 9:97347356-97347378 CCCGGGTGTTGAGGGAACACTGG - Exonic
1058393879 9:104526961-104526983 CACCAGTGTTGAGGGAATGGAGG + Exonic
1062054119 9:134462099-134462121 ACCCTGAGTTGAAGGCAAGCTGG - Intergenic
1062321595 9:135993030-135993052 CCCCTGGTTTGAGGGGAAGTTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186564311 X:10645922-10645944 CCCCTGTTCTGAGGGAAAAGAGG - Intronic
1187467811 X:19542191-19542213 CACCTGTGACGAGGGAAGGCAGG + Exonic
1188485153 X:30674395-30674417 CCCTTGTGATGAAGGAAAGTTGG - Intronic
1189094191 X:38120738-38120760 CCCCAGGGTTGGGGGAAGGCAGG + Intronic
1190307732 X:49095107-49095129 TCCCTTTGCAGAGGGAAAGCTGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1196018529 X:110965114-110965136 CCCCTTTGTTCAGGAGAAGCTGG - Intronic
1199565697 X:149213385-149213407 GCCCTGTGTGGAGGGCAAGCAGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200835115 Y:7725325-7725347 CCCAGGTCTTGAGGGTAAGCAGG + Intergenic