ID: 1007624731

View in Genome Browser
Species Human (GRCh38)
Location 6:43238299-43238321
Sequence GAACTAGTGCCTGTTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007624727_1007624731 14 Left 1007624727 6:43238262-43238284 CCACAGAGTTAACAATTTTTGAG No data
Right 1007624731 6:43238299-43238321 GAACTAGTGCCTGTTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007624731 Original CRISPR GAACTAGTGCCTGTTCCTAC TGG Intergenic
No off target data available for this crispr