ID: 1007626068

View in Genome Browser
Species Human (GRCh38)
Location 6:43247063-43247085
Sequence CAGTGTGGCGGAGGAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007626056_1007626068 23 Left 1007626056 6:43247017-43247039 CCCGGAACAACTCCTGGTTGGAT 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG No data
1007626061_1007626068 11 Left 1007626061 6:43247029-43247051 CCTGGTTGGATGTCTGGGCAGGA 0: 1
1: 0
2: 1
3: 9
4: 186
Right 1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG No data
1007626054_1007626068 28 Left 1007626054 6:43247012-43247034 CCAAGCCCGGAACAACTCCTGGT 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG No data
1007626057_1007626068 22 Left 1007626057 6:43247018-43247040 CCGGAACAACTCCTGGTTGGATG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007626068 Original CRISPR CAGTGTGGCGGAGGAGGAAG AGG Intronic
No off target data available for this crispr