ID: 1007626134

View in Genome Browser
Species Human (GRCh38)
Location 6:43247320-43247342
Sequence GGCCGAGCAGCCCGAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007626134_1007626141 15 Left 1007626134 6:43247320-43247342 CCGGGGCTTCGGGCTGCTCGGCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1007626141 6:43247358-43247380 TCTCAGCCTCCTCGGGAGCCGGG No data
1007626134_1007626140 14 Left 1007626134 6:43247320-43247342 CCGGGGCTTCGGGCTGCTCGGCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1007626140 6:43247357-43247379 GTCTCAGCCTCCTCGGGAGCCGG 0: 1
1: 2
2: 341
3: 11272
4: 134601
1007626134_1007626145 30 Left 1007626134 6:43247320-43247342 CCGGGGCTTCGGGCTGCTCGGCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1007626145 6:43247373-43247395 GAGCCGGGCCTGCCTCGGAGCGG No data
1007626134_1007626144 25 Left 1007626134 6:43247320-43247342 CCGGGGCTTCGGGCTGCTCGGCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1007626144 6:43247368-43247390 CTCGGGAGCCGGGCCTGCCTCGG 0: 1
1: 0
2: 1
3: 19
4: 235
1007626134_1007626138 7 Left 1007626134 6:43247320-43247342 CCGGGGCTTCGGGCTGCTCGGCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1007626138 6:43247350-43247372 AGTTGTAGTCTCAGCCTCCTCGG 0: 1
1: 0
2: 3
3: 79
4: 1128
1007626134_1007626139 8 Left 1007626134 6:43247320-43247342 CCGGGGCTTCGGGCTGCTCGGCC 0: 1
1: 0
2: 3
3: 21
4: 209
Right 1007626139 6:43247351-43247373 GTTGTAGTCTCAGCCTCCTCGGG 0: 1
1: 0
2: 1
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007626134 Original CRISPR GGCCGAGCAGCCCGAAGCCC CGG (reversed) Intronic
900907077 1:5566901-5566923 GGCCCGGCTGCCCAAAGCCCTGG - Intergenic
901640043 1:10688538-10688560 GGCCGAGGAGCCAGGAGCCAGGG - Intronic
901801246 1:11709315-11709337 GGCAGAGCTCTCCGAAGCCCAGG + Exonic
904826977 1:33280311-33280333 GGCCAAGCAGGCCGTGGCCCTGG - Exonic
905126402 1:35718772-35718794 GGCCGAGGAACCCCCAGCCCAGG - Exonic
905132182 1:35769624-35769646 GGCCACGGAGCCCGAAGCGCGGG + Intronic
905626070 1:39491426-39491448 GGGCGAGGAGCCCGCAGCCTGGG - Intergenic
906528555 1:46510543-46510565 GGCTCAGCAGCTCGAGGCCCTGG + Exonic
915828374 1:159102594-159102616 GGCAGAGCTGCCCAAAGCCATGG + Intronic
916249504 1:162723573-162723595 AGCCCAGCAGTCTGAAGCCCTGG + Intronic
918366885 1:183817489-183817511 GGCCGAGCAGCCAAAGACCCTGG - Intronic
919006915 1:191909967-191909989 GGCAGAGCAGCCCAAGGCCTTGG - Intergenic
919394134 1:197023318-197023340 GGCAGAGCAGCCCAAGGCCTTGG + Intergenic
922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG + Exonic
923629547 1:235640849-235640871 GGCCCAGCAGCCCCAGTCCCTGG + Intronic
924947407 1:248855729-248855751 GGCCCAGCAGACTGAGGCCCTGG - Exonic
1065140365 10:22714053-22714075 GGGCGAGCAGCCGGAGGTCCAGG + Intronic
1067204582 10:44201969-44201991 TGCAGAGCAGCCCAAAGCCATGG + Intergenic
1067945290 10:50685095-50685117 GGCCGGGCAGCCCTCAGCCCAGG - Intergenic
1068198013 10:53744349-53744371 GGCAGAGCAGCCCAAGGCCTTGG - Intergenic
1068714730 10:60175731-60175753 GGCTCAGCAGCCAGGAGCCCGGG + Intronic
1070866801 10:79711967-79711989 GGCCAGGCAGCCCTCAGCCCAGG - Exonic
1070880590 10:79850088-79850110 GGCCGGGCAGCCCTCAGCCCAGG - Exonic
1071633712 10:87234190-87234212 GGCCGGGCAGCCCTCAGCCCAGG - Exonic
1071647160 10:87366406-87366428 GGCCGGGCAGCCCTCAGCCCAGG - Exonic
1073544614 10:104337957-104337979 GGAGGAGCTGCCCGCAGCCCTGG + Intronic
1074226510 10:111489358-111489380 GGCAGAGCTGCCCAAAGCCTTGG + Intergenic
1076480779 10:130783984-130784006 GGCCGTCCAGACCGCAGCCCTGG - Intergenic
1076778535 10:132711206-132711228 GGTGGAGCAGCCCGGAGCACTGG - Intronic
1076867786 10:133176522-133176544 GGCCGAGCATCCAGATGGCCAGG - Intronic
1077045744 11:544529-544551 GCCAGAGGAGCCCGCAGCCCTGG + Intronic
1077162535 11:1120274-1120296 GGCAGAGCATCAGGAAGCCCTGG + Intergenic
1077183916 11:1228182-1228204 GGCCCCGCAGCCGGCAGCCCTGG + Intronic
1077322055 11:1947034-1947056 GGCCCCACAGCCTGAAGCCCGGG - Intergenic
1080802058 11:35618520-35618542 GGCCGAAGCGCCCGAAGCCCCGG + Exonic
1083672152 11:64305679-64305701 GGCCGAGCGGCCCGGAGTGCCGG - Intronic
1083993898 11:66262804-66262826 GGCCCTGCAGCCCCTAGCCCAGG + Exonic
1085044821 11:73346731-73346753 GGGGGAACAGCCCGGAGCCCTGG + Intronic
1085322445 11:75583391-75583413 GGCGGCGGAGCCCGGAGCCCGGG + Intergenic
1085600803 11:77854609-77854631 GGCAGAGCTGCCCAAAGCCTTGG - Intronic
1089104179 11:115988378-115988400 AGCTGAGGAGCCCGAAGCTCAGG + Intergenic
1090572939 11:128067918-128067940 GGCAGAGCTGCCCAAGGCCCTGG - Intergenic
1091215181 11:133896957-133896979 GGCCCAGCAGCAGGATGCCCAGG + Intergenic
1202805071 11_KI270721v1_random:2347-2369 GGCCCCACAGCCTGAAGCCCGGG - Intergenic
1094738371 12:33260385-33260407 GGCAGAGCTGCCCGAGGCCATGG + Intergenic
1096102592 12:48978707-48978729 GGCCGCTCTGCCCGCAGCCCTGG + Exonic
1096389400 12:51217475-51217497 GGCCCAGCATCCCGCCGCCCCGG + Intronic
1097020949 12:56020648-56020670 GCCCCAGCAGCCGAAAGCCCTGG - Intronic
1101679924 12:106955527-106955549 GGGCGAGGGGCGCGAAGCCCGGG - Intergenic
1103932443 12:124457846-124457868 GGCCCACCAGCCCGCAGCCTGGG + Intronic
1104736653 12:131139436-131139458 AGCCCAGCAGCCTGATGCCCAGG + Exonic
1105512097 13:21060534-21060556 GGCCTGGCCGCCCGCAGCCCGGG + Intronic
1106338918 13:28809663-28809685 GGCAGAGCTGCCCAAGGCCCTGG + Intergenic
1108796123 13:54033126-54033148 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
1110064603 13:71087650-71087672 GGCAGCTCTGCCCGAAGCCCTGG + Intergenic
1112363589 13:98738964-98738986 GGCAGAGCTGCCCAAAGCCCTGG + Intronic
1112678148 13:101728792-101728814 GGCAGAGACACCCGAAGCCCAGG - Intronic
1117920226 14:60721456-60721478 GGCCCCGCAGCCCAAAGCCCGGG - Intronic
1120413846 14:84194272-84194294 GGCAGAGCAGCCCAAAGCCATGG + Intergenic
1121445539 14:93976539-93976561 GGCAGAGCAGCCAGAAGCTTGGG - Exonic
1122329827 14:100904672-100904694 CGCCCAGCAGCCCCCAGCCCCGG - Intergenic
1122647515 14:103205193-103205215 GGCCCAGAAGGCCGCAGCCCAGG + Intergenic
1122697392 14:103562708-103562730 GGCCGAACACCCCTAAACCCGGG + Intronic
1123671524 15:22664364-22664386 GGACGAGCAGCCCGACAGCCTGG + Intergenic
1124323563 15:28737588-28737610 GGACGAGCAGCCCGACAGCCTGG + Intronic
1125505708 15:40266392-40266414 GGGAGAGCAGCCTGAAGCGCAGG + Exonic
1129695572 15:77739046-77739068 GGCCCAGCAGCCCCCACCCCAGG + Intronic
1130979694 15:88803888-88803910 GGCAGTGCAGCCCCCAGCCCCGG - Intronic
1132872932 16:2123696-2123718 CACCGAGCGGCCCTAAGCCCAGG + Intronic
1132953455 16:2578144-2578166 GGCCGAGCAACCCGAAGGCCGGG - Intronic
1132960897 16:2622024-2622046 GGCCGAGCAACCCGAAGGCCGGG + Intergenic
1133043023 16:3070661-3070683 GGCGGAGCTGCCCCAGGCCCTGG - Intronic
1133045109 16:3083596-3083618 GGCAGAGCTGCCCGAGGCCCTGG - Intergenic
1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG + Intronic
1134552022 16:15142875-15142897 CACCGAGCGGCCCTAAGCCCAGG + Intergenic
1136245842 16:28975256-28975278 GTCCGAGGAGCCCGAGGTCCCGG + Exonic
1141134181 16:81455143-81455165 GGCCGGCCAGCCGGGAGCCCGGG + Intronic
1141797999 16:86287363-86287385 GGCCCAGCAGCGCGGGGCCCGGG - Intergenic
1141863457 16:86733712-86733734 GGAAGAGCAGCGGGAAGCCCTGG + Intergenic
1142107993 16:88316478-88316500 GGCTGAGCAGCAGGGAGCCCAGG - Intergenic
1143034984 17:3989610-3989632 GGCCCTGCAGGCCGAGGCCCCGG - Intergenic
1143240412 17:5438932-5438954 CGCTGAGCAGCCCGAAGGGCCGG + Exonic
1144968658 17:19093601-19093623 GGCCGAGGTGTCCGAGGCCCAGG - Exonic
1144979257 17:19158465-19158487 GGCCGAGGTGTCCGAGGCCCAGG + Exonic
1144988965 17:19219767-19219789 GGCCGAGGTGTCCGAGGCCCAGG - Exonic
1145025064 17:19461946-19461968 GGCGGAGCTGCCCAAAGCCTTGG + Intergenic
1147348825 17:39824110-39824132 GGCGGAGCTGCCCAAAGCCATGG + Intronic
1148820539 17:50357135-50357157 GGCGGTGCAGCCCTCAGCCCAGG + Exonic
1152066450 17:78115191-78115213 GGACGAGCTGCCTGGAGCCCTGG + Intronic
1152321278 17:79609979-79610001 GGCCGCGCTGCTCGAGGCCCTGG + Intergenic
1152868298 17:82737000-82737022 GGCTTAGCAGCCCCAAGGCCGGG + Intronic
1153076234 18:1164995-1165017 GGCAGAGCTGCCCGAGGCCGTGG - Intergenic
1160379363 18:78439773-78439795 GGCCCAGCAGTGCAAAGCCCAGG + Intergenic
1160379384 18:78439952-78439974 GGCCCAGCAGCTCAAAGCCCAGG - Intergenic
1160406181 18:78647820-78647842 GGCAGAGAAGCCAGAAGCCTGGG + Intergenic
1160710704 19:549777-549799 GGCCGATCGGCCTGATGCCCTGG + Exonic
1160765357 19:805235-805257 GGCCGCTCAGTCCGGAGCCCCGG + Intronic
1161327604 19:3671126-3671148 GGCCGAGCAGGGGGACGCCCGGG - Intronic
1162002808 19:7758085-7758107 GGCAGAGCTGCCCAAAGCCATGG + Intergenic
1162046699 19:8005214-8005236 GGCCGTGCAGCCCGGCCCCCCGG + Intronic
1162100196 19:8334572-8334594 GGCCGCGCAGACCGAGTCCCCGG - Exonic
1163484294 19:17576996-17577018 TGCACAGCAGCCCAAAGCCCTGG - Intronic
1163655175 19:18541754-18541776 GGCTGAGCAGCCTGGGGCCCTGG - Exonic
1165382297 19:35489954-35489976 GGCAGAGCAGCTCCAAACCCAGG - Intronic
1166205191 19:41264819-41264841 GGCCGGGGAGCCCGGAGCCTGGG + Intronic
926734562 2:16063104-16063126 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
927743192 2:25590788-25590810 GGACTAGCAGCCCGACCCCCAGG + Intronic
927868943 2:26611221-26611243 GGCCCTGCAGCCCGAAGGCTAGG - Intronic
930071414 2:47369399-47369421 GGCCGGGCAGCGCGAGGCCTGGG - Exonic
930115260 2:47712630-47712652 GGCAGAGCAGCCTGAGGCCTAGG + Intronic
935171602 2:100614706-100614728 GACAGAGCAGCACGCAGCCCAGG - Intergenic
936500457 2:113062307-113062329 AGCCGGGCAGCCCACAGCCCTGG + Intronic
936734713 2:115427137-115427159 AGCAGAGCTGCCCAAAGCCCTGG - Intronic
938761365 2:134429304-134429326 TGGCGAGCAGCCAGCAGCCCTGG + Intronic
940361969 2:152805157-152805179 GGCCCAGGAGCGCGCAGCCCTGG + Intergenic
941719292 2:168796444-168796466 GGGCCAGCTGCCCCAAGCCCAGG + Intronic
943215260 2:185025465-185025487 TGGCGAGCTGCCCGAACCCCTGG + Intergenic
944495917 2:200307018-200307040 GGCCGAGCATTCCGCAGCCCGGG + Intronic
945770393 2:214035277-214035299 GGCCCAGCAGCCCGGCCCCCAGG + Intronic
945900724 2:215534453-215534475 GGCAGAGCTGCCCAAGGCCCTGG + Intergenic
947506686 2:230713147-230713169 GAACGAGCAGCCCGAAGCGGCGG + Exonic
947667946 2:231918862-231918884 GGCCCAGCAGCACTAGGCCCAGG - Intergenic
948508078 2:238444462-238444484 GGAGGAGCAGCCGGAAGCACTGG - Exonic
948945022 2:241215059-241215081 GGGCGGGCAGCCCAGAGCCCGGG - Intronic
1169045295 20:2530193-2530215 GGGCCAGCAGCCCGGTGCCCAGG + Intergenic
1169305662 20:4488180-4488202 TGCAGAGCAGCCCGGACCCCAGG - Intergenic
1175428973 20:58889706-58889728 AGCCCAGCAGCCCGAAGCCCGGG + Intronic
1175429011 20:58889801-58889823 GGCCGGGCAGCCCGAGGCCGGGG + Intronic
1175488607 20:59363677-59363699 TGCCGAGGAGCCCAAAGCCCTGG + Intergenic
1176145471 20:63563466-63563488 GGCCGAGCACCCCCACGCCCTGG - Exonic
1176516719 21:7789654-7789676 GGCCAGGCAGCCCTCAGCCCAGG - Intergenic
1177792567 21:25735795-25735817 GGGCGAGCGGCCTGGAGCCCGGG + Intronic
1178539477 21:33437290-33437312 GGCTGAGCAGTCAGAAGACCTGG + Exonic
1178650747 21:34419666-34419688 GGCCAGGCAGCCCTCAGCCCAGG - Intronic
1179469106 21:41598693-41598715 GGCAGTGCAGCCACAAGCCCTGG + Intergenic
1180137504 21:45871123-45871145 GGCCGTGCAGCCCAGTGCCCAGG + Intronic
1180170438 21:46055487-46055509 GGCCAAGGAGCCCGAATCCCTGG - Intergenic
1180846090 22:18983252-18983274 GGCTTAGCAGCCGGAAGCCCAGG - Intergenic
1180847386 22:18991284-18991306 GGCTGAGCAGCCCTAACCCTGGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181007472 22:20020906-20020928 GCCCGCGCAGCCCGAAGCTTTGG + Intronic
1181025451 22:20124869-20124891 GGCCGTGAAGTCAGAAGCCCAGG - Intronic
1181041310 22:20193962-20193984 GGCCGGGCAGCCTGAGGGCCAGG + Intergenic
1181412187 22:22731665-22731687 GGGTGAGCAGCCAGCAGCCCAGG - Intergenic
1181419420 22:22787443-22787465 GGGTGAGCAGCCAGCAGCCCAGG - Intronic
1181486412 22:23234549-23234571 GGGAGAGCATCCCGCAGCCCAGG + Intronic
1183667776 22:39255180-39255202 GGCCCAGCAGCCCGGGGGCCTGG - Intergenic
1184712832 22:46263166-46263188 CGCCGCGCACCCCGAGGCCCGGG + Exonic
1184781762 22:46653224-46653246 GGCCGTGCCGCCCGCTGCCCCGG + Intronic
1185098948 22:48827357-48827379 GGCGGAGAAGCCGGAAACCCAGG - Intronic
1185296708 22:50058299-50058321 GCCCGCGCAGCCCCACGCCCCGG - Intergenic
950121268 3:10483891-10483913 GGCCGGGCACCCAGAGGCCCAGG + Intronic
950406489 3:12808286-12808308 GGCTGTGCAGCTGGAAGCCCTGG + Exonic
950776144 3:15352090-15352112 GGCAGAGCTGCCCAAAGCCTTGG + Intergenic
953265738 3:41385854-41385876 GGCCTAGGAGCCCAAAGCCCTGG - Intronic
953638687 3:44685497-44685519 GCCAGCGCAGCCCGCAGCCCCGG + Intergenic
955826363 3:62951762-62951784 GGCAGAGCTGCCCAAAGCCATGG + Intergenic
963798839 3:149657702-149657724 GCCCGAGGAGCCTGGAGCCCTGG + Intronic
964638769 3:158886020-158886042 GGCAGAGCTGCCCAAGGCCCTGG + Intergenic
966670424 3:182519809-182519831 AGCCAGGCAGCCCAAAGCCCAGG - Intergenic
967976134 3:195035701-195035723 GGGTGAGGAGCCAGAAGCCCTGG - Intergenic
968486475 4:865457-865479 GGCGGAGCAGCTCGCAGGCCAGG + Intronic
968574218 4:1357501-1357523 GGCCGAGCTGCCAGCAGTCCCGG - Intronic
969297436 4:6278216-6278238 GGCCGAGCTGACTGAGGCCCTGG + Intronic
969490140 4:7494935-7494957 AGCCGGGCAGCTCCAAGCCCAGG - Intronic
971244038 4:24912759-24912781 GGCCGAGCGGCCGCCAGCCCCGG - Intronic
972093520 4:35318696-35318718 GGCCAAGCAGCCAGCAGCCCAGG - Intergenic
972511452 4:39771395-39771417 GGCCGGGCAGCTGGAAGCGCAGG + Intronic
973107827 4:46361767-46361789 GGCCGAGCTGCCCAAGGCCATGG + Intronic
975456544 4:74597608-74597630 GGCAGAGCTGCCCAAGGCCCTGG + Intergenic
976431135 4:84965681-84965703 GGGGGAGAGGCCCGAAGCCCTGG + Intronic
985368541 4:189260459-189260481 GGCAGAGTTGCCCAAAGCCCTGG - Intergenic
986608270 5:9544889-9544911 GCCCGATCTGCCCGAAACCCTGG + Intronic
986924546 5:12731180-12731202 GGCAGAGCTGCCCGAGGCCTTGG - Intergenic
987610730 5:20199274-20199296 GGCAGAGCTGCCCAAAGCCATGG + Intronic
992153953 5:73935954-73935976 GGCCAGGCACCCAGAAGCCCAGG - Intronic
996717667 5:126600890-126600912 GGCGGGGCAGCCGGAAGGCCCGG - Exonic
1002597756 5:180335268-180335290 GGGGCCGCAGCCCGAAGCCCAGG - Intronic
1002927284 6:1611692-1611714 GGCCGAGCCGCCCGCGCCCCCGG - Exonic
1003309433 6:4956711-4956733 GGCTGAGCAGTCTTAAGCCCAGG - Intergenic
1006136909 6:31901263-31901285 GGCCGGGCAGCTGGAAGCGCAGG + Exonic
1007626134 6:43247320-43247342 GGCCGAGCAGCCCGAAGCCCCGG - Intronic
1011506317 6:88047913-88047935 GGCGGAGCAGCCCGTGCCCCTGG - Exonic
1013935180 6:115586029-115586051 GGCAGAGCAGCCCAAGGCCATGG - Intergenic
1015939367 6:138432686-138432708 GGCACAGCAGCTCGGAGCCCTGG - Exonic
1017903441 6:158738119-158738141 GGCAGGGCAGCCCTAACCCCAGG + Intronic
1018420568 6:163637375-163637397 GGCCGAGGAGCCGGGAGTCCAGG + Intergenic
1018548347 6:164963060-164963082 GGCAGGGCTGCCTGAAGCCCTGG + Intergenic
1019344197 7:521559-521581 GCGCGAGCAGTCCGAGGCCCAGG - Intergenic
1022524358 7:31027855-31027877 TGCTGAGCAGCCCAAGGCCCTGG - Intergenic
1023188486 7:37555147-37555169 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
1024578284 7:50782342-50782364 GGCCGATCCGCCCGCCGCCCCGG + Intronic
1024988013 7:55212827-55212849 GGCCGAGCAGCCAGGAGGCTGGG + Intronic
1026767131 7:73167125-73167147 GGACGACCAGTCCTAAGCCCTGG - Intergenic
1026974616 7:74489812-74489834 GGCCCAGCTGCCCCAAGCACTGG + Intronic
1027043600 7:74976836-74976858 GGACGACCAGTCCTAAGCCCTGG - Intronic
1027080047 7:75225523-75225545 GGACGACCAGTCCTAAGCCCTGG + Intergenic
1027236716 7:76302802-76302824 GCCGGGGCAGCCCGAAGGCCTGG - Exonic
1029593040 7:101519948-101519970 GGATGAGCAGCCAGATGCCCTGG + Intronic
1031899489 7:127393011-127393033 GGCCGAGCAGCCCGTCTCCGTGG - Intronic
1034839321 7:154381045-154381067 GGCAGAGAAGCCCCACGCCCAGG - Intronic
1035117070 7:156533572-156533594 GGACTAGCAGCCCGAGGTCCCGG - Intergenic
1037820656 8:22133286-22133308 GGCGGAGCAGCCCCCGGCCCAGG + Intronic
1038094610 8:24293949-24293971 GGCCCAGCAGGCGGAAGTCCTGG - Intergenic
1039613514 8:38937316-38937338 GCCAGAGCAGCCAGAGGCCCAGG + Intronic
1040575789 8:48650172-48650194 GCTCGAGCAACCCCAAGCCCAGG + Intergenic
1042053041 8:64732253-64732275 GGCAGAGCTGCCCAAAGCCATGG + Intronic
1045003734 8:97900006-97900028 GGCTGTGCAGCCGGAATCCCAGG + Intronic
1045700680 8:104862828-104862850 GGCAGAGCTGCCCGAGGCCTTGG + Intronic
1048086521 8:131186657-131186679 GGCAGAGCTGCCCAAAGCCTTGG + Intergenic
1048416740 8:134235241-134235263 GGCAGAGCTGCCCAAAGCCCTGG - Intergenic
1048975573 8:139671190-139671212 GGCTGGGCAGCCAGAAGCCCAGG - Intronic
1049383536 8:142329628-142329650 GCCCGAGCACCCCAGAGCCCAGG + Intronic
1049494212 8:142922195-142922217 GGCCGAGCAGCCCCGGCCCCAGG + Intergenic
1052666003 9:31496419-31496441 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
1052991751 9:34522811-34522833 CGCCGAGCATCCCGCTGCCCCGG - Exonic
1054329569 9:63738557-63738579 GGCAGAGCAGCCCAAAGCCTTGG - Intergenic
1055068919 9:72146847-72146869 GGCCCAGGATCCAGAAGCCCTGG - Intronic
1056192635 9:84199195-84199217 GGCAGAGCTGCCCAAAGCCTTGG - Intergenic
1057312093 9:93949032-93949054 GGCTGAGCTTCCCGGAGCCCGGG - Intergenic
1057570128 9:96198016-96198038 GACAGAGGAGCCCAAAGCCCTGG - Intergenic
1061583779 9:131553977-131553999 GGCCCAGCAGCTTGAAGCCAGGG - Intergenic
1062248895 9:135584321-135584343 GGCAGGGCATCCCCAAGCCCAGG + Intergenic
1062279545 9:135745817-135745839 GGCCCGGCAGCCAGAGGCCCAGG - Intronic
1062324586 9:136005977-136005999 GGCCACGCAGCCTGAACCCCAGG + Intergenic
1062499539 9:136846328-136846350 CGCCGAGGAGCCCGCGGCCCCGG + Exonic
1062621058 9:137422888-137422910 CGCCGAGCAGCCGGACGCCGCGG - Intronic
1062689364 9:137833532-137833554 GCCCCAGCAGCTCCAAGCCCTGG + Intronic
1187477036 X:19620546-19620568 AGCTGAGCAGCCCGAGGGCCTGG - Intronic
1197335223 X:125203894-125203916 GGCCGAGACGCCCTAAGTCCCGG - Intergenic
1197980903 X:132217628-132217650 GTCGGAGGAGCCCGCAGCCCGGG + Exonic
1199192110 X:144982199-144982221 GGCAGAGCTGCCCAAAGCCATGG + Intergenic
1200118843 X:153781061-153781083 GGCCACGCAGCCCGCAGCTCCGG - Exonic
1200230684 X:154442448-154442470 GGGCGGGCAGCCAGGAGCCCAGG - Intronic