ID: 1007628149

View in Genome Browser
Species Human (GRCh38)
Location 6:43258123-43258145
Sequence CTCTATGCTCAGATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007628149_1007628159 24 Left 1007628149 6:43258123-43258145 CCACCCTCAATCTGAGCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1007628159 6:43258170-43258192 TTTAACCTTAGTGGGTCCCTGGG 0: 1
1: 0
2: 2
3: 5
4: 79
1007628149_1007628157 16 Left 1007628149 6:43258123-43258145 CCACCCTCAATCTGAGCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1007628157 6:43258162-43258184 TTGGAGTTTTTAACCTTAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 144
1007628149_1007628158 23 Left 1007628149 6:43258123-43258145 CCACCCTCAATCTGAGCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1007628158 6:43258169-43258191 TTTTAACCTTAGTGGGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 98
1007628149_1007628161 26 Left 1007628149 6:43258123-43258145 CCACCCTCAATCTGAGCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1007628161 6:43258172-43258194 TAACCTTAGTGGGTCCCTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 75
1007628149_1007628154 -3 Left 1007628149 6:43258123-43258145 CCACCCTCAATCTGAGCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1007628154 6:43258143-43258165 GAGTGGGCATCTTCCTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 127
1007628149_1007628156 15 Left 1007628149 6:43258123-43258145 CCACCCTCAATCTGAGCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1007628156 6:43258161-43258183 TTTGGAGTTTTTAACCTTAGTGG 0: 1
1: 0
2: 2
3: 25
4: 313
1007628149_1007628160 25 Left 1007628149 6:43258123-43258145 CCACCCTCAATCTGAGCATAGAG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1007628160 6:43258171-43258193 TTAACCTTAGTGGGTCCCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007628149 Original CRISPR CTCTATGCTCAGATTGAGGG TGG (reversed) Intronic
901462251 1:9398641-9398663 CTGTATGCCCAGCTTGTGGGAGG - Intergenic
907256164 1:53180685-53180707 CTCTGAGCTCTGACTGAGGGTGG + Intergenic
910550235 1:88467001-88467023 CTCTCTGGTCTGGTTGAGGGCGG + Intergenic
912466789 1:109880082-109880104 CTCTGTGCTAAGATTCAGGAGGG + Intergenic
912518655 1:110230950-110230972 CTCTACTCTCAGATGGTGGGTGG - Intronic
915878095 1:159634353-159634375 AACTATGCTCATATTCAGGGAGG - Intergenic
916358138 1:163936251-163936273 CTCAATGGTCAGAGTGAGGCAGG - Intergenic
919382203 1:196873267-196873289 CTCCCTGCTCAGAGTAAGGGTGG + Intronic
920704323 1:208240746-208240768 CTTTATGATCAGAATGGGGGTGG + Intronic
1063450753 10:6148433-6148455 CCCTATGCTCAGCGTGAGGCTGG + Intronic
1066203959 10:33169247-33169269 CTCTTTGCTCTGATTGGGAGTGG + Intergenic
1066329162 10:34399253-34399275 ATTTATGCTCAGATAGAGAGTGG - Intronic
1068749109 10:60570979-60571001 CTCTATGTTCAGAATCATGGTGG + Intronic
1069720561 10:70547149-70547171 CTCAGTTCTCAGACTGAGGGAGG - Intronic
1069779272 10:70944641-70944663 CTCTGTGCTAAGCTTTAGGGAGG - Intergenic
1074738911 10:116465176-116465198 TTATAGGCTCAGAATGAGGGAGG + Intronic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1076826231 10:132971023-132971045 CTCCATGCTCAGGAGGAGGGAGG + Intergenic
1078575598 11:12499357-12499379 CTCTCCGCTCAGGATGAGGGTGG + Intronic
1078893683 11:15579590-15579612 CTCTGTGCCCACCTTGAGGGAGG - Intergenic
1087557366 11:99738299-99738321 CTCTCTGCTTAGCTTGTGGGTGG - Intronic
1090058014 11:123439846-123439868 CTCTGTGGTCAGATTGTGGAGGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1093250076 12:16792133-16792155 CTCTAAGCTCAGAGTTAGGATGG - Intergenic
1102176122 12:110876238-110876260 ATCTATCCTCTGATTGTGGGGGG - Intronic
1102389128 12:112535396-112535418 CTCCATGCCCAGCTAGAGGGTGG - Intergenic
1103137425 12:118519550-118519572 TTCTTTGCTTAGATTGAAGGAGG + Intergenic
1109706425 13:66099194-66099216 CTCTAGGCTCATATTGAAGGAGG + Intergenic
1110174141 13:72536238-72536260 CTCTGTGTCCAGATTAAGGGAGG - Intergenic
1111938427 13:94582665-94582687 GTGCATACTCAGATTGAGGGTGG - Intronic
1113545583 13:111146728-111146750 CTCTCTGCTTTGGTTGAGGGTGG + Intronic
1116786145 14:49290797-49290819 CTCTATTCTGTGATTGAGGCAGG + Intergenic
1116930345 14:50684398-50684420 CCCTATCCTAAGATGGAGGGGGG - Intergenic
1117263213 14:54058167-54058189 CAGTCTGCTCAGATTGATGGTGG + Intergenic
1119854306 14:77887789-77887811 CTCTGTGCTCAGAGTAAGGGCGG + Intronic
1120234159 14:81871594-81871616 CTCCATGCTCAGTGTGTGGGTGG + Intergenic
1137554406 16:49461585-49461607 CTCTGTGCTGAGATAAAGGGGGG - Intergenic
1138294283 16:55873406-55873428 CTCTATGGTCAGACTGGGTGAGG - Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1147191420 17:38740230-38740252 CTCTGTGCCCAGATTGGGGCGGG - Intronic
1151086010 17:71381497-71381519 ATCTATGCTTAGATTGTGTGTGG + Intergenic
1155483952 18:26319939-26319961 CTCTAATCTCAGATTCAGGCAGG - Intronic
1156184782 18:34649428-34649450 CTCTATCTTTAGGTTGAGGGAGG - Intronic
1156871959 18:41955458-41955480 CTCAAGGCCCAGATTGGGGGCGG + Intronic
1158225700 18:55198845-55198867 AGCTATGCCCAGACTGAGGGAGG + Intergenic
1159723258 18:71919816-71919838 CTCTATAGTCATATGGAGGGGGG + Intergenic
1161846218 19:6713305-6713327 CTCCCTTCTCAGATTGAGGATGG - Exonic
1164896964 19:31885403-31885425 CTCTTTGCTTACAGTGAGGGGGG + Intergenic
1168132954 19:54332479-54332501 CTCTGGGCTCAGAGGGAGGGTGG - Intergenic
1168451407 19:56469359-56469381 CTCTGGGGTCAGACTGAGGGTGG + Intronic
1168509912 19:56966178-56966200 CTCTTGGCTCAGATAGAGGTGGG + Intergenic
925674768 2:6350402-6350424 CTCTATGCTAAGATTGAAGGTGG - Intergenic
927105710 2:19821961-19821983 CTCTCTGCTCAGCATGTGGGTGG + Intergenic
928135074 2:28682021-28682043 CTTTATGCTCAAATTAAAGGTGG + Intergenic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
932218080 2:69979564-69979586 CTTTGTGCCCAGTTTGAGGGGGG - Intergenic
933657925 2:84905018-84905040 CTCTTTGCTCAGGTTGGGGGCGG - Intronic
934691186 2:96360949-96360971 CTCCATGCTGAAATTCAGGGGGG + Intronic
937677537 2:124608429-124608451 CTGCATGCTCAGATAGAGGCAGG - Intronic
939085105 2:137709146-137709168 CTCTATGGTCAGAATAAGGTTGG - Intergenic
941141039 2:161782098-161782120 CTCTATGCTCTGAGCTAGGGAGG - Intronic
941232174 2:162924271-162924293 CTTTATGCTCAGATCAAGGCAGG - Intergenic
946518806 2:220443614-220443636 CCATTTGCTCAGAGTGAGGGAGG + Intergenic
946771044 2:223089395-223089417 TTCTATTCTCAGAGTGAGGGTGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169782602 20:9325506-9325528 CTGGATGCTCAGATTCTGGGAGG - Intronic
1170816783 20:19720820-19720842 CTCTCGTCTCAGATTGTGGGAGG - Intronic
1174036050 20:47668882-47668904 CCCTGTGCTCAGAATCAGGGCGG - Intronic
1174201941 20:48812659-48812681 CCCTCTTCTTAGATTGAGGGGGG - Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
950871306 3:16231927-16231949 CTCTAGGCACAGATCAAGGGTGG + Intronic
953448945 3:42990538-42990560 CTCAATGCTCAAATGGAGGCCGG - Intronic
954049050 3:47957841-47957863 CTGTATATTCTGATTGAGGGAGG - Intronic
954223571 3:49168881-49168903 CTCTCTGCTCAGATAGAGCTGGG - Intergenic
954437185 3:50502631-50502653 CTCTCTCCTCAGGTGGAGGGGGG + Intronic
962060498 3:131922029-131922051 TACTATGCTCAGAATGTGGGTGG - Intronic
962321273 3:134392640-134392662 CACTGTGCTCAGAGTGAGGCTGG - Intergenic
963350385 3:144144113-144144135 CTCTATGTTTACATTCAGGGAGG + Intergenic
973035055 4:45396123-45396145 CTTGATTCTCAGATTGAGAGTGG + Intergenic
982399791 4:154953923-154953945 ATCTATTCTTAGATTCAGGGAGG - Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
987736895 5:21857936-21857958 CTCTGTGCTCAGACAGAGAGAGG + Intronic
989641993 5:43591795-43591817 GTCTTTGCTGAGAGTGAGGGTGG + Intergenic
990252265 5:53928073-53928095 CTCTGTGCTGAGAATGAGTGTGG - Intronic
995402876 5:111761291-111761313 CTCTCTGGTCAGATTGAATGAGG + Intronic
996317446 5:122176506-122176528 CTCTATCCTCAGATTTAGACAGG + Intronic
999466902 5:151815947-151815969 CTCTATGATTAAATTGGGGGTGG + Intergenic
999887249 5:155936972-155936994 CTCTAATCTCAGAGTGAGGGCGG - Intronic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1007481235 6:42151466-42151488 CTCTGTGCTCAGGCTGTGGGAGG + Intergenic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1007704598 6:43783183-43783205 GCCTGTGCTCAGAGTGAGGGAGG + Intronic
1009402480 6:63273901-63273923 CACTCTGCTGAGCTTGAGGGAGG - Intergenic
1011493921 6:87920387-87920409 CTCAATGCTCAACTAGAGGGAGG + Intergenic
1015543799 6:134342302-134342324 CTCTCTGCACAGCTTGAGGTTGG - Intergenic
1018912430 6:168109737-168109759 CTCTATGCTGAGATCTAGAGTGG + Intergenic
1021620700 7:22549135-22549157 CCCCATGCTCAGATTTGGGGTGG - Intronic
1027963088 7:84971766-84971788 CTCTTTGCTAAGTTTGAGGAGGG - Intergenic
1033096045 7:138431866-138431888 CTCTATGATCATATTGAGAGAGG - Intergenic
1035810764 8:2489187-2489209 CTCTATGCTTAGGTTCAGTGAGG - Intergenic
1036932127 8:12966270-12966292 CTCTGTGCTCAGGGTGTGGGCGG + Intronic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1039911921 8:41833056-41833078 TTCTAAGCTCAGATTGTGGTAGG - Intronic
1044545423 8:93454009-93454031 CCCTTTGCTCACCTTGAGGGTGG - Intergenic
1044771960 8:95645568-95645590 CTCTTTACTCAGCTTGGGGGTGG + Intergenic
1050435411 9:5604589-5604611 ATCTCTGCTGAGATTGAGCGAGG + Intergenic
1055085077 9:72305488-72305510 CCCTATGCTTAGAATAAGGGTGG - Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1058709893 9:107670199-107670221 CTTTGTGATGAGATTGAGGGTGG - Intergenic
1059847752 9:118300120-118300142 ATCTGTGCTTAGATTGAGGATGG + Intergenic
1059913926 9:119077502-119077524 GTCTCTGCTCAGATCGAGGTGGG - Intergenic
1189893799 X:45632755-45632777 CTCCAGGCTGAGATTGAGGGCGG - Intergenic
1190773902 X:53537463-53537485 CTCTAGCCTCAAATTTAGGGAGG - Intronic
1191245149 X:58222800-58222822 CTCTATCCTCAGATTGCCTGAGG - Intergenic
1197474228 X:126900928-126900950 GTCGATGTTCAGGTTGAGGGTGG - Intergenic
1202042252 Y:20697795-20697817 CTCTCTGCTCAGACTGGTGGTGG + Intergenic