ID: 1007631243

View in Genome Browser
Species Human (GRCh38)
Location 6:43274807-43274829
Sequence GACGCCCACTGGATGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631243_1007631258 27 Left 1007631243 6:43274807-43274829 CCACACACCATCCAGTGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1007631258 6:43274857-43274879 GCCCGCTTCCTCCAAATGAGGGG No data
1007631243_1007631247 -10 Left 1007631243 6:43274807-43274829 CCACACACCATCCAGTGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1007631247 6:43274820-43274842 AGTGGGCGTCCCAGCCCAGGAGG 0: 1
1: 1
2: 0
3: 12
4: 196
1007631243_1007631257 26 Left 1007631243 6:43274807-43274829 CCACACACCATCCAGTGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1007631257 6:43274856-43274878 TGCCCGCTTCCTCCAAATGAGGG No data
1007631243_1007631261 30 Left 1007631243 6:43274807-43274829 CCACACACCATCCAGTGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1007631261 6:43274860-43274882 CGCTTCCTCCAAATGAGGGGTGG 0: 1
1: 0
2: 1
3: 7
4: 84
1007631243_1007631256 25 Left 1007631243 6:43274807-43274829 CCACACACCATCCAGTGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1007631256 6:43274855-43274877 GTGCCCGCTTCCTCCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631243 Original CRISPR GACGCCCACTGGATGGTGTG TGG (reversed) Intronic
900431451 1:2604982-2605004 GAGGCCCCCTGGATTGTGTCTGG + Intronic
900611039 1:3544764-3544786 AAACCCCACTCGATGGTGTGTGG - Intronic
901295380 1:8157105-8157127 GACGCACAGAGGAAGGTGTGGGG - Intergenic
905904737 1:41610477-41610499 GAATCCTACTGGATGGTGGGAGG + Intronic
907751930 1:57271084-57271106 TACACCAACTGGATGGTGTCAGG - Intronic
909634166 1:77796707-77796729 GAAGCACACTGAAAGGTGTGAGG - Intronic
916485645 1:165256139-165256161 GACGCCCACGGCTTGGTGTAAGG - Intronic
917149373 1:171928533-171928555 GATGAGCACTGGAGGGTGTGTGG + Intronic
924792588 1:247266469-247266491 GGTGCCCACTGGGTGGTGTGGGG + Intergenic
1064384405 10:14878306-14878328 GATTCCGACTGGTTGGTGTGGGG - Intergenic
1070332682 10:75429719-75429741 GAAGGCCAGTTGATGGTGTGGGG - Intergenic
1070671175 10:78378311-78378333 GAGACCCACTGGAAGGTGTTTGG - Intergenic
1072744855 10:97932914-97932936 GACTCCCACAGGATGTTGTTGGG + Intronic
1075676855 10:124301886-124301908 GACTCGCATTGGATGGGGTGGGG - Intergenic
1076391833 10:130109342-130109364 GACACCCAGGGGATGGTGTGAGG + Intergenic
1077154423 11:1085040-1085062 GAGGACCACGGGGTGGTGTGAGG - Intergenic
1078462174 11:11522330-11522352 GTCGGCCACTGGAAGTTGTGTGG - Intronic
1078615326 11:12860048-12860070 GATGGTCACAGGATGGTGTGTGG + Intronic
1083252331 11:61476533-61476555 GACACACACTTGGTGGTGTGTGG + Intronic
1083896724 11:65623871-65623893 GATGCCCACGGGATGGTCAGAGG - Intronic
1085016616 11:73178099-73178121 TAAGCGCACTGGATGGGGTGAGG + Intergenic
1085461539 11:76696878-76696900 GACGCCTACATGGTGGTGTGGGG - Intergenic
1087127120 11:94639418-94639440 GATGTCCACTGCATGGTGTCAGG - Intergenic
1088928800 11:114328350-114328372 GAAGAGCACTGGGTGGTGTGGGG - Intergenic
1091791784 12:3276105-3276127 GATGCCCACGGGAAGGTGAGGGG + Intronic
1091919087 12:4290033-4290055 GACACCCTCTGGATGGTCCGGGG + Intronic
1101121267 12:101583043-101583065 GTAGCCTACTGCATGGTGTGTGG + Intronic
1101398749 12:104370456-104370478 GACGGACCCTGGATGGGGTGTGG - Intergenic
1104397530 12:128447249-128447271 GACAGCCAAAGGATGGTGTGTGG - Intronic
1105206609 13:18231051-18231073 GGGGCCCACTGGAGGGTGGGAGG - Intergenic
1108361818 13:49674789-49674811 GGAGCCCAGAGGATGGTGTGAGG + Intronic
1113697007 13:112354124-112354146 GACCCCACCTGGATGGGGTGGGG - Intergenic
1114631882 14:24164505-24164527 GAAGCCCCCTGGCTGGTGTGGGG + Intronic
1119679580 14:76582137-76582159 CACGCCCACTAAATGCTGTGGGG - Intergenic
1121779856 14:96615352-96615374 GAAGCCGCCCGGATGGTGTGTGG + Intergenic
1123929740 15:25159823-25159845 GATGCCCACTGGATGTTGCATGG + Intergenic
1124710242 15:32003734-32003756 GATGGCCACTGGGTGGTGGGTGG - Intergenic
1125374208 15:39011583-39011605 GGTACCCACTGGGTGGTGTGGGG + Intergenic
1125538034 15:40454044-40454066 GAAACCCTCAGGATGGTGTGCGG + Intronic
1127008278 15:54594814-54594836 GGTACCCACTGGGTGGTGTGGGG - Intronic
1129454665 15:75670335-75670357 GATGCCTACTGCAGGGTGTGGGG + Intergenic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1134452577 16:14372567-14372589 GCCGCCCTCTGGATGGGGGGTGG - Intergenic
1135075932 16:19393597-19393619 GGTACCCACTGGGTGGTGTGGGG - Intergenic
1135076885 16:19401581-19401603 GGTACCCACTGGGTGGTGTGGGG - Intergenic
1138649984 16:58454493-58454515 GACAACCACTGTATGGAGTGAGG + Intergenic
1139429677 16:66904439-66904461 TACGACCACTGGGTGGTGTTGGG + Intergenic
1141894003 16:86946981-86947003 GACCCCCACCTGATGGTGTGGGG - Intergenic
1142029466 16:87831378-87831400 CGGGCCCACTGGATGGTGAGGGG + Exonic
1144022431 17:11249264-11249286 CACGGCCACTGGATGGCGGGAGG - Intronic
1144574120 17:16418212-16418234 GATTCTCACTGGATGGAGTGTGG - Intronic
1145208368 17:20996384-20996406 ACCTCCCACTGGGTGGTGTGTGG - Intergenic
1145716940 17:27032382-27032404 GAAGCCCACTTGATGATGGGTGG - Intergenic
1151889973 17:76946180-76946202 GAGGGCTACTGGAGGGTGTGCGG + Intronic
1153596370 18:6729607-6729629 CACGCCCACGGGCTGGAGTGGGG - Intergenic
1158282042 18:55838934-55838956 GACGCTCACTGCCTAGTGTGGGG + Intergenic
1161080965 19:2309948-2309970 GCCCCCCACAGGATGCTGTGGGG + Intronic
1161608165 19:5226127-5226149 GGCGCCCTCTGGCTGCTGTGGGG - Intronic
1162818356 19:13209080-13209102 GAGGCCACCTGGAAGGTGTGGGG + Intronic
1166895852 19:46021651-46021673 GACTCCCTCTGGCTGCTGTGGGG - Intronic
1167489425 19:49782905-49782927 GAAGCTGACTTGATGGTGTGAGG + Intronic
1167686832 19:50961850-50961872 TATGCACACTGGATGGTGTCAGG + Exonic
925070912 2:965697-965719 GAATTCCACTGGATGGGGTGGGG + Intronic
926164127 2:10507526-10507548 CGCTCCCACTGGCTGGTGTGAGG - Intergenic
931848327 2:66228131-66228153 GAGGCTGAGTGGATGGTGTGGGG - Intergenic
932481506 2:72042206-72042228 GCTGGCCACTGGTTGGTGTGAGG + Intergenic
933066814 2:77808148-77808170 GGTACCCACTGGGTGGTGTGGGG + Intergenic
933418915 2:82023206-82023228 GGTACCCACTGGGTGGTGTGGGG + Intergenic
936254675 2:110901733-110901755 GTTGCCCATTGGGTGGTGTGTGG + Intronic
937365001 2:121255107-121255129 GACACCCACTGGGTGGGATGTGG - Intronic
937715150 2:125024224-125024246 GGTACCCACTGGGTGGTGTGGGG - Intergenic
940961000 2:159785839-159785861 CACTGCCATTGGATGGTGTGTGG - Intronic
947932195 2:233973338-233973360 GACTCCCTCTGGAGGCTGTGCGG + Intronic
948587842 2:239030880-239030902 AATGCCCACTGGCTGGTGAGTGG - Intergenic
948693748 2:239722491-239722513 GACCCCACCTGAATGGTGTGGGG - Intergenic
1169227203 20:3864269-3864291 CAGGCCCACGGGATGGTGTGAGG - Exonic
1169264645 20:4160453-4160475 GACGCCACCTGGATGGAGTGAGG - Intronic
1171006238 20:21468002-21468024 GACCCCAACTGCATGGAGTGTGG - Intergenic
1172183222 20:33016201-33016223 GTCGCCCTCTGGGGGGTGTGGGG - Intronic
1175246719 20:57586462-57586484 CAGGGCCACTGGGTGGTGTGGGG + Intergenic
1175427181 20:58875690-58875712 GACTGCCACTGAATGGGGTGGGG - Intronic
1175658010 20:60788785-60788807 GATGCCCACTGTATGGGGTAAGG + Intergenic
1176431655 21:6579795-6579817 GAAGCCCCATGGATGGTGTTGGG + Intergenic
1179707049 21:43187257-43187279 GAAGCCCCATGGATGGTGTTGGG + Intergenic
1181312300 22:21952075-21952097 GAGGCCCACTGCATGGTGGCGGG - Intronic
950773134 3:15328146-15328168 GAGGCGAACTGGAGGGTGTGAGG - Intronic
953467590 3:43137093-43137115 GACGCCCAAGTGATGGTGTTAGG - Intergenic
958807482 3:98829436-98829458 GAGGCCTACTGGAGGGTGGGAGG - Intronic
965024485 3:163283205-163283227 GATACCCGCTGGTTGGTGTGGGG - Intergenic
983661347 4:170133314-170133336 AATACCCACTGGGTGGTGTGGGG - Intergenic
984387070 4:179074428-179074450 GCCTCCCACTGGAGGGTGGGAGG + Intergenic
984932632 4:184860536-184860558 AACACCCACTGGGTGGAGTGAGG + Intergenic
985260406 4:188109658-188109680 GACGCCTTCCTGATGGTGTGAGG - Intergenic
985492254 5:186818-186840 GACCCCCCAGGGATGGTGTGGGG + Exonic
986974530 5:13379874-13379896 GGTGCCCACTGCTTGGTGTGTGG + Intergenic
992399646 5:76401017-76401039 GACGCCCCGTGGAAGGTGTTTGG - Intergenic
996406690 5:123112168-123112190 GTGGCCCACTGGAAGGTGTTTGG + Intronic
999234596 5:150082934-150082956 GAAGCCCACTGTAAGGTGTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000372359 5:160549315-160549337 GACACCCACAGGATGGGGTAAGG + Intergenic
1001615031 5:173036409-173036431 GACAAACACTGGATGGAGTGTGG - Intergenic
1003163902 6:3659770-3659792 TACGCCTACTGGGTGCTGTGTGG + Intergenic
1004252342 6:14032857-14032879 GATGCCCCCTGCATGGTTTGTGG + Intergenic
1006832191 6:36975766-36975788 GAAGCCCACCCGTTGGTGTGGGG + Intronic
1007419897 6:41713104-41713126 GAGGCCCTCTGTATGGGGTGGGG - Intronic
1007631243 6:43274807-43274829 GACGCCCACTGGATGGTGTGTGG - Intronic
1008441742 6:51539665-51539687 GAGGACCACTGGATTGTATGTGG - Intergenic
1019585837 7:1802939-1802961 GATGGCCAGTGGCTGGTGTGGGG + Intergenic
1019990016 7:4683749-4683771 GACCCAGACTGGATGGGGTGGGG - Intronic
1020013728 7:4819572-4819594 GAGGCGCACACGATGGTGTGAGG + Intronic
1022637910 7:32154726-32154748 GGTGCCCACTGTATGGTATGGGG - Intronic
1026437128 7:70408777-70408799 GAAGCCCACAGCAAGGTGTGTGG - Intronic
1026549569 7:71356684-71356706 GGGGCCCACTGGAAGGTGTTTGG - Intronic
1026890998 7:73982412-73982434 GCAGCCCACAGGAGGGTGTGGGG + Intergenic
1027697420 7:81429554-81429576 GACAGCCACTGGATGGAATGTGG + Intergenic
1028192265 7:87867038-87867060 GGTACCCACTGGGTGGTGTGCGG + Intronic
1030106997 7:105995918-105995940 CACTCCCACTGGAGGGAGTGAGG - Intronic
1038906111 8:31904861-31904883 GAGGCCTACTGGAGGGTGGGAGG + Intronic
1042855461 8:73262298-73262320 GATGTCCGCTGGAGGGTGTGAGG - Intergenic
1057726435 9:97571852-97571874 GAGGCTCACTGGATGGCGGGTGG - Intronic
1059353733 9:113684117-113684139 GAAGCCCACTGGAAGGGATGAGG + Intergenic
1192157388 X:68756839-68756861 GGCTCCCTCTGGATGCTGTGTGG + Intergenic
1194867766 X:99089629-99089651 GAAGCCTACTTGATAGTGTGGGG - Intergenic
1197833690 X:130672402-130672424 GTGGCCCACTGGATGGTGTGCGG - Intronic
1201229670 Y:11852129-11852151 GACGCCGACTGGAGGGTGGAGGG + Intergenic