ID: 1007631401

View in Genome Browser
Species Human (GRCh38)
Location 6:43275338-43275360
Sequence CGGCGGGGGACGCGAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631401_1007631418 30 Left 1007631401 6:43275338-43275360 CCCTGGGTTCGCGTCCCCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631401 Original CRISPR CGGCGGGGGACGCGAACCCA GGG (reversed) Intronic