ID: 1007631402 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:43275339-43275361 |
Sequence | GCGGCGGGGGACGCGAACCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1007631402_1007631418 | 29 | Left | 1007631402 | 6:43275339-43275361 | CCTGGGTTCGCGTCCCCCGCCGC | No data | ||
Right | 1007631418 | 6:43275391-43275413 | CGTTTGCTTTTCCCTGCTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1007631402 | Original CRISPR | GCGGCGGGGGACGCGAACCC AGG (reversed) | Intronic | ||