ID: 1007631402

View in Genome Browser
Species Human (GRCh38)
Location 6:43275339-43275361
Sequence GCGGCGGGGGACGCGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631402_1007631418 29 Left 1007631402 6:43275339-43275361 CCTGGGTTCGCGTCCCCCGCCGC No data
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631402 Original CRISPR GCGGCGGGGGACGCGAACCC AGG (reversed) Intronic