ID: 1007631403

View in Genome Browser
Species Human (GRCh38)
Location 6:43275352-43275374
Sequence CGGGGCGACGGGGGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631403_1007631418 16 Left 1007631403 6:43275352-43275374 CCCCCGCCGCCCCCGTCGCCCCG No data
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data
1007631403_1007631423 30 Left 1007631403 6:43275352-43275374 CCCCCGCCGCCCCCGTCGCCCCG No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631403_1007631419 20 Left 1007631403 6:43275352-43275374 CCCCCGCCGCCCCCGTCGCCCCG No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631403_1007631420 23 Left 1007631403 6:43275352-43275374 CCCCCGCCGCCCCCGTCGCCCCG No data
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631403 Original CRISPR CGGGGCGACGGGGGCGGCGG GGG (reversed) Intronic