ID: 1007631406

View in Genome Browser
Species Human (GRCh38)
Location 6:43275355-43275377
Sequence AGGCGGGGCGACGGGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1385
Summary {0: 1, 1: 1, 2: 6, 3: 141, 4: 1236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631406_1007631423 27 Left 1007631406 6:43275355-43275377 CCGCCGCCCCCGTCGCCCCGCCT 0: 1
1: 1
2: 6
3: 141
4: 1236
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631406_1007631419 17 Left 1007631406 6:43275355-43275377 CCGCCGCCCCCGTCGCCCCGCCT 0: 1
1: 1
2: 6
3: 141
4: 1236
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631406_1007631420 20 Left 1007631406 6:43275355-43275377 CCGCCGCCCCCGTCGCCCCGCCT 0: 1
1: 1
2: 6
3: 141
4: 1236
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374
1007631406_1007631418 13 Left 1007631406 6:43275355-43275377 CCGCCGCCCCCGTCGCCCCGCCT 0: 1
1: 1
2: 6
3: 141
4: 1236
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data
1007631406_1007631424 28 Left 1007631406 6:43275355-43275377 CCGCCGCCCCCGTCGCCCCGCCT 0: 1
1: 1
2: 6
3: 141
4: 1236
Right 1007631424 6:43275406-43275428 GCTGCTGGCTGGCGGCCTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631406 Original CRISPR AGGCGGGGCGACGGGGGCGG CGG (reversed) Intronic