ID: 1007631408

View in Genome Browser
Species Human (GRCh38)
Location 6:43275361-43275383
Sequence GCGCGAAGGCGGGGCGACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631408_1007631419 11 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631408_1007631420 14 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374
1007631408_1007631423 21 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243
1007631408_1007631425 29 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631425 6:43275413-43275435 GCTGGCGGCCTTTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1007631408_1007631418 7 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data
1007631408_1007631424 22 Left 1007631408 6:43275361-43275383 CCCCCGTCGCCCCGCCTTCGCGC No data
Right 1007631424 6:43275406-43275428 GCTGCTGGCTGGCGGCCTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631408 Original CRISPR GCGCGAAGGCGGGGCGACGG GGG (reversed) Intronic