ID: 1007631409

View in Genome Browser
Species Human (GRCh38)
Location 6:43275362-43275384
Sequence GGCGCGAAGGCGGGGCGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007631409_1007631419 10 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631419 6:43275395-43275417 TGCTTTTCCCTGCTGCTGGCTGG 0: 1
1: 0
2: 4
3: 41
4: 285
1007631409_1007631420 13 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631420 6:43275398-43275420 TTTTCCCTGCTGCTGGCTGGCGG 0: 1
1: 0
2: 1
3: 47
4: 374
1007631409_1007631425 28 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631425 6:43275413-43275435 GCTGGCGGCCTTTGGGTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 196
1007631409_1007631418 6 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631418 6:43275391-43275413 CGTTTGCTTTTCCCTGCTGCTGG No data
1007631409_1007631424 21 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631424 6:43275406-43275428 GCTGCTGGCTGGCGGCCTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 181
1007631409_1007631423 20 Left 1007631409 6:43275362-43275384 CCCCGTCGCCCCGCCTTCGCGCC 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1007631423 6:43275405-43275427 TGCTGCTGGCTGGCGGCCTTTGG 0: 1
1: 0
2: 2
3: 32
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007631409 Original CRISPR GGCGCGAAGGCGGGGCGACG GGG (reversed) Intronic